Characterization of the new AmpC beta-lactamase FOX-8 reveals a single. mutation Phe313Leu located in the R2 loop that affects ceftazidime hydrolysis

Size: px

Start display at page:

Download "Characterization of the new AmpC beta-lactamase FOX-8 reveals a single. mutation Phe313Leu located in the R2 loop that affects ceftazidime hydrolysis"

Ilene Hodge
6 years ago
Views:

1 AAC Accepts, published online ahead of print on 22 July 2013 Antimicrob. Agents Chemother. doi: /aac Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Characterization of the new AmpC beta-lactamase FOX-8 reveals a single mutation Phe313Leu located in the R2 loop that affects ceftazidime hydrolysis Francisco José Pérez-Llarena 1, Frédéric Kerff 2, Laura Zamorano 3, María Carmen Fernández 1, Maria Luz Nuñez 4, Elisenda Miró 5, Antonio Oliver 3, Ferran Navarro 5, and Germán Bou 1* Servicio de Microbiología-INIBIC. Complejo Hospitalario Universitario A Coruña, A Coruña, Spain; 2 Centre d Ingénierie des Protéines, Université de Liège, Liège, Belgium; 3 Servicio de Microbiología. Hospital Universitario Son Espases, Palma de Mallorca, Spain; 4 Servicio de Microbiología. Hospital General Universitario Reina Sofía. Murcia, 5 Servicio de Microbiología. Hospital de la Santa Creu i Sant Pau/ IIB-Sant Pau. Universitat Autónoma de Barcelona, Barcelona, Spain * Corresponding author: Dr. Germán Bou Servicio de Microbiología Complejo Hospitalario Universitario A Coruña Xubias s/n, 3ª Planta Ed. Sur A Coruña, SPAIN Phone Fax German.Bou.Arevalo@sergas.es; german.bou@usc.es

2 25 ABSTRACT A novel class C β-lactamase (FOX-8) was isolated from a clinical strain of Escherichia coli. The FOX-8 enzyme possessed a unique substitution (Phe313Leu) when compared to FOX-3. Isogenic E. coli strains carrying FOX-8 showed an 8 fold reduction in resistance to ceftazidime relative to FOX-3. In kinetic analysis FOX-8 displayed a 33 fold reduction in k cat /Km for ceftazidime compared to FOX-3. In the FOX family of β- lactamases, the Phe313 residue located in the R2 loop affects ceftazidime hydrolysis and alters the phenotype of E.coli strains carrying this variant

3 AmpC β-lactamases are clinically important cephalosporinases, particularly in Enterobacteriaceae (1,2). To date, none of the commercially available β-lactamase inhibitors (clavulanic acid, sulbactam or tazobactam) are effective against high-level class C producers (3). New extended-spectrum class C enzymes that are capable of hydrolysing cephalosporins with large side chains, and even imipenem, are emerging (4). These enzymes differ from typical AmpC β-lactamases because of amino acid insertions, deletions and substitutions (1,2,4). The three regions involved in these modifications are the omega-loop, the R2 loop and the helix H-2 (1,2,4). FOX-type enzymes are plasmid encoded AmpC β-lactamases that are especially active against cefoxitin (5,6,7,8,9,10). Although at least 10 variants have been described ( structural data are not yet available. An amino acid tripeptide Gly-306/Asn-307/Ser308 deletion has recently been performed in the FOX-4 enzyme (11), causing a slight increase in β-lactamase activity against ceftazidime. As a result, the R2 site of FOX-4 has been suggested to be wide enough to accommodate substrates with large R2 groups. In the present study, we compared microbiological and biochemical data on FOX-3 and FOX-8 enzymes in order to investigate the role of Phe313 (present in the R2 loop of FOX enzymes) in cephalosporin hydrolysis. E. coli HGURS42015 carrying the bla FOX-8 gene was isolated from a urine culture from an 80 year old female patient admitted to the Reina Sofía Hospital (Murcia, Spain) in By PCR and using oligonucleotides specific for AmpC-type β-lactamases (12), a positive result was observed for bla FOX-8 -type genes. After DNA sequencing, a new 3

4 69 70 variant, bla FOX-8 was detected, with a Phe313Leu replacement compared to FOX-3 enzyme We used pulsed-field gel electrophoresis (PFGE) with S1 nuclease digestion of wholegenome DNA (S1-PFGE) and PCR-based replicon typing (PBRT) to characterize the plasmids, as described previously (13). We used PFGE with I-CeuI digestion of whole genome DNA, as described by Liu et al. (14), to determine whether the bla FOX-8 gene was located in the chromosome. We successfully transferred and hybridized the S1- PFGE-I-CeuI gels with the FOX probe (data not shown). Unfortunately, hybridization signals were not conclusive. We next isolated a plasmid of ca. of 6 kbp from E. coli HGURS After transformation, this plasmid harboring a bla TEM-1-like gene was obtained. Total DNA of these transformants failed to amplify with bla FOX-8 gene primers. The repeated conjugation experiments with kanamycin resistant E.coli strain were unsuccessful. Although experiments suggested a chromosomal location for bla FOX8, further studies should be performed to confirm this affirmation. We elucidated the genetic environment of bla FOX-8 by PCR and sequencing. First, we amplified the bla FOX-8 gene by PCR and fully sequenced the gene by using primers FOX3F(5 ATGCAACAACGACGTGCG) and FOX3R(5 TCACTCGGCCAACTGACT). We then mapped and sequenced the genetic context by using primers for class 1 integrons (15) and inverse primers from bla FOX-8 FOX3Fi (5 CGCACGTCGTTGTTGCAT) and FOX3Ri (5 AGTCAGTTGGCCGAGTGA). The bla FOX-8 gene was located, by PCR analysis with specific primers, in a class I integron (16). This constituted the first gene cassette after int1i, but all PCR attempts to identify the 3` end of the integron consistently failed For comparative purposes, we cloned the FOX-8 and FOX-3 enzymes in E. coli in an isogenic background. By using the following primers: FOX-8-pBGS18 fw 5-4

5 AAAAGGTACCATGCAACAACGACGTGCG (forward), and FOX-8-pBGS18 rv 5 - AAAAGAATTCTCACTCGGCCAACTGACTC (reverse), which introduced the restriction sites KpnI and EcoRI, respectively, we cloned the bla FOX-8 and bla FOX-3 genes in the plasmid pbgs18-ctx, under the promoter of bla CTX-M-14 gene, in E.coli strain TG1 (11). We used PCR to obtain the bla FOX-8 gene from E. coli HGURS42015 and the bla FOX-3 gene by PCR with a bacterial strains harboring the bla FOX-3 gene (kind gift of Guillaume Arlet, Hôpitaux Universitaires Est Parisiens). We transformed both constructs into E.coli TG1 and the MICs were obtained for selected β-lactam antibiotics (Table 1). Our MICs revealed that in an isogenic E.coli background, FOX-8 was 8-16 fold more susceptible to cefoxitin and ceftazidime relative to FOX-3 (Table 1). There was also a 4 fold reduction in the MICs of aztreonam. However, with FOX-8, there was a notable increase in the MICs of antibiotics such as ampicillin, piperacilin and cephalotin. To purify FOX-3 and FOX-8 proteins, we cloned both genes in the pgex-6p-1 vector with the following primers: FOX-8-pGEX fw 5 - AAAAGAATTCAGCGGGGAGGCCCCGC (forward) and FOX-8-pGEX rv 5 - AAAAGTCGACTCACTCGGCCAACTGACTCAG (reverse), which generated the restriction sites EcoRI and SalI, respectively. We transformed the construct into E.coli BL21 (New England Biolabs, Ipswich, MA, USA) and produced a fusion protein between glutathione S-transferase (GST) and the FOX enzymes without their signal peptide. We purified the β-lactamases to homogeneity, according to the manufacturer s instructions for the GST gene fusion system (Amersham Pharmacia Biotech Europe GmbH, Germany). After cleavage of GST from the FOX enzymes, the purified proteins ( 99% pure) appeared as a single band on sodium dodecyl sulphate-polyacrylamide gels (data not shown). 5

6 In order to monitor hydrolysis of antibiotics by FOX-3 and FOX-8 β-lactamases, we recorded the variation in absorbance resulting from the opening of the β-lactam ring, under the following conditions. We determined the kinetic parameters for nitrocefin and cephalotin from the initial rates, by Hanes-Woolf linearization of the Henri- Michaelis-Menten equation. For the other antibiotics, we measured the Km value as the Ki in a competition experiment, with nitrocefin as the reporter substrate. We then obtained the k cat values by monitoring hydrolysis of the antibiotic at a concentration >>10 times the Km. In the case of cefepime, for which the Km was very high, only the k cat /Km ratio could to be determined under first order conditions ( [S]<< Km) (11). The kinetic analyses revealed a decrease in k cat for FOX-8 relative to FOX-3 for all the tested substrates (Table 2). However, this effect was only significant for cefoxitin and ceftazidime, for which the k cat values were respectively 26 and 105 times lower. For FOX-8, the Km was also lower with all the antibiotics tested, except nitrocefin, for which the Km remained unchanged. The decrease was relatively modest (less than 10 fold modification), except for cefoxitin (23 fold decrease). The effects on the k cat and Km of cefoxitin compensated each other and lead to a similar catalytic efficiency (k cat /Km). Ceftazidime was therefore the only substrate for which FOX-8 has a significantly lower catalytic efficiency (33 fold) than FOX-3. The catalytic efficiencies of FOX-3 and FOX-8 were found to be very similar for the other substrates. These data are consistent with the MIC data, except for cefoxitin. In the latter case, the apparently higher affinity did not seem to compensate the reduced activity in vivo. Finally, the substitution did not affect the low inhibitory properties of classical inhibitors To rule out an effect of enzyme stability on kinetic parameters, we also performed temperature inactivation studies with pure samples and confirmed that the FOX-3 and FOX-8 proteins displayed similar stability (68%±3 and 62%±6 of residual activity with 6

7 nitrocefin, after incubation for 40 minutes at 50ºC, with FOX-3 and FOX-8 respectively) FOX-8 is the second FOX enzyme described in Spain (in addition to FOX-4). Five FOX β-lactamases have been published to date. FOX-8 has a single amino acid difference with respect to FOX-3, with a leucine instead of a phenylalanine at position 313. FOX-8 is the only FOX enzyme with a leucine at this position in the R2 loop. However, this substitution is not unique in the class C β-lactamases. The closely related CMY-10 (76% aminoacid sequence identity) is also characterized by a leucine at the same position as in most of the AmpC enzymes (17). No tridimensional structure is available for the FOX enzymes, and the most relevant structural data available is that of CMY-10 (17). The CMY-10 structure was therefore used to locate the Phe313Leu mutation and to analyze its potential effect on the catalytic mechanism. In previous work, CMY-10 was employed to model FOX-4 (11); we anticipate that a significant difference is not expected in the overall structure of the enzyme and more specifically in the R2 loop (Figure 1A). The same is probably also true for FOX-3 and FOX-8 because they do not have any other substitutions in this area, apart from Phe313Leu. The Phe313Leu mutation lies in close proximity to Tyr151, which is part of the second conserved motif of class C β-lactamases and is involved in the catalytic mechanism (Figure 1B). This position also defines one edge of the active site. In this context, we hypothesize that replacement of a phenylalanine by a less bulky amino acid could lead to a slightly wider and more accessible active site. This is consistent with the general decrease in Km observed for most substrates. The greater effect observed for cefoxitin may be due to the specific constraints of this substrate resulting from the presence of a methoxy group in position 7α on the β lactam ring. However, it is also possible that the 7

8 reduced activity may be due to fewer constraints on the second motif tyrosine, leading to a less optimal positioning of this critical residue. However, the difference in the magnitude of the effect observed for the various substrates cannot be explained with the available data. A potential reason for the very high impact on ceftazidime hydrolysis could be the combination of two large side chains at the position 3 and 7 characterizing this antibiotic. The kinetic parameters of FOX-3 can also be compared with those previously reported for FOX-4 (11). Eight antibiotics have been tested for FOX-3 and FOX-4, and the kinetic parameters of three of these display significant differences: nitrocefin, imipenem and cefotaxime. For imipenem and cefotaxime, the k cat increased by respectively 32 and 17 times, while the k cat for nitrocefin increased by 29 times. These differences lead to significant modifications in the catalytic efficiency for nitrocefin and imipenem (30 fold decrease and 72 fold increase respectively), but not for cefotaxime. In the latter case, the increase in k cat was partly reversed by a slight increase in Km. We attempted to correlate the difference in specificity between FOX-3 and FOX-4 with the 10 amino acids not conserved in the two enzymes. However, judging by their position in the structure of CMY-10, none of these seems to be capable of inducing any significant change potentially responsible for the observed effect. The fact that other class C β-lactamases possess a leucine in the same position and significantly hydrolyse ceftazidime may reduce the effect of Phe313Leu on the FOX group. In Aeromonas caviae, the CAV-1 enzyme (a putative precursor of FOX enzymes), which possesses a phelynalanine residue, displays good activity against ceftazidime, but not cefoxitin. Other mutations must be established in the Phe313 position to clarify these questions. 8

9 In summary, a new FOX-8 β-lactamase carried in a class I integron is described in Spain. The microbiological and biochemical study of this enzyme, in comparison with FOX-3, highlights the Phe313Leu mutation, located in the α10 helix of R2 loop, as being involved in ceftazidime hydrolysis. 197 Nucleotide accession number The nucleotide sequence for the bla FOX-8 has been deposited in the Genbank database under accession number HM Acknowledgement This study was funded by grants from the European Community, FP 7, ID: (MagicBullet), and by Plan Nacional de I+D+I and Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía y Competitividad, Spanish Network for Research in Infectious Diseases (REIPI RD12/0015)-co-financed by European Development Regional Fund A Way to achieve Europe ERDF. Also by the Fondo de Investigación Sanitaria (grants 09/00125, , 10/02021 and PI12/00552). F.K. is a research associate of the FRS- FNRS (Brussels, Belgium). 9

10 210 REFERENCES Jacoby, G.A AmpC β-lactamases. Clinical Microbiology Reviews. 22: Beceiro, A., and G. Bou Class C β-lactamases: an increasing problem worldwide. Rev Med Microb. 15: Pérez-Llarena, F.J., and G. Bou Beta-lactamase: the story so far. Curr. Med. Chem. 16: Nordmann, P., and H. Mammeri Extended-specturm cephalosporinases: structure, detection and epidemiology. Future Microbiol. 2: Bauernefeind, A., S. Wagner, R. Jungwirth, I. Schneider., and D. Meyer A novel class C β-lactamase (FOX-2) in Escherichia coli conferring resistance to cephamycins. Antimicrob. Agents Chemother. 41: Bou, G., A. Oliver, M. Ojeda, C.Monzón., and J. Martínez-Beltrán Molecular characterization of FOX-4, a new AmpC-type plasmid-mediated β lactamase from an Escherichia coli strain isolated in Spain. Antimicrob. Agents Chemother. 44: Fosse, T., C. Giraud-Morin, I. Madinier., and R. Labia Sequence analysis and biochemical characterization of chromosomal CAV-1 (Aeromonas caviae), the parental cephalosporinase of plasmid-mediated AmpC FOX cluster. FEMS Microbiol Letters. 222: González-Leiza, M, J.C. Pérez-Diaz, J. Ayala, J.M. Casellas, J. Martínez- Beltrán, K. Bush., and F. Baquero Gene Sequence and biochemical characterization of FOX-1 from Klebsiella pneumoniae, a new AmpC plasmid-mediated beta-lactamase with two molecular variants. Antimicrob. Agents Chemother. 38:

11 Marchese, A, G. Arlet, G. C. Schito, P.H. Lagrange., and A. Philippon Characterization of FOX-3, an AmpC-type plasmid-mediates-β-lactamase from an Italian isolate of Klebsiella oxytoca. Antimicrob. Agents Chemother. 42: Queenan, A. M, S. Jenkins., and K. Bush Cloning and biochemical characterization of FOX-5, an AmpC plasmid-encoded β-lactamase from a New York City Klebsiella pneumoniae clinical isolate. Antimicrob. Agents Chemother. 45: Mallo, S., F.J. Pérez-Llarena, F. Kerff, N.C. Soares, M. Galleni., and G. Bou A tripeptide deletion in the R2 loop of the class C beta-lactamase enzyme FOX-4 impairs cefoxitin hydrolysis and slightly increases susceptibility to betalactamase inhibitors. J. Antimicrob. Chemother. 65: Pérez-Pérez, F.J., and N.D. Hanson Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 40: García, A., F. Navarro, E. Miró, L. Villa, B. Mirelis, P. Coll and A. Carattoli Acquisition and diffusion of bla CTX-M-9 gene by R478-IncHI2 derivative plasmids. FEMS Microbiol. Lett. 271: Liu, S.L., A. Hessel, and K.E. Sanderson Genomic mapping with I-Ceu I, an intron-encoded endonuclease specific for genes for ribosomal RNA, in Salmonella spp., Escherichia coli, and other bacteria. Proc. Nat. Acad. Sci. USA. 90: Gutiérrez, O., C. Juan, E. Cercenado, F. Navarro, E. Bouza,P. Col, J.L. Pérez, and A. Oliver Molecular epidemiology and mechanisms of carbapenem resistance in Pseudomonas aeruginosa isolates from Spanish hospitals. Antimicrob. Agents Chemother. 51: Miró E, Aguero J, Larrosa MN, Fernandez A, Conejo MC, Bou G, González-López JJ, Lara N, Martinez-Martinez L, Oliver A, Aracil B, Oteo J, 11

12 Pascual A, Rodriguez-Baño J, Zamorano L, Navarro F Prevalence and molecular epidemiology of acquired AmpC beta-lactamases and carbapenemases in Enterobacteriaceae isolates from 35 hospitals in Spain. Eur. J. Clin. Microbiol. Infect. Dis. 32: Erratum 2013 Eur. J. Clin. Microbiol. Infect. Dis.32: Kim, J.Y, H.I. Jung,Y.L. An, J.H. Lee, S.J. Kim, S.H. Jeong, K.J. Lee, P.G. Suh, H.S. Lee, S.H. Lee and S.S. Cha Structural basis for the extended substrate spectrum of CMY-10, a plasmid-encoded class C beta-lactamase. Mol. Microbiol. 60:

13 Table 1. MICs of several antibiotics for FOX-3 and FOX-8 β-lactamases expressed in E.coli TG1 under the CTX-M-14 β-lactamase promoter in the pbgs18-pctx plasmid. MIC (μg/ml) Antibiotic b E. coli TG1 pbgs18-pctx E. coli TG1 pbgs18- pctx FOX-3 E. coli TG1 pbgs18- pctx FOX-8 E. coli a HGURS42015 Ampicillin Piperacilin Piper-Tazo Ampicilinclav Ampicilinsulba Ampicilintazo Cephalotin Cefoxitin Ceftazidime Cefotaxime Cefepime Aztreonam Imipenem a E. coli HGURS42015 produced a TEM-1 type β-lactamase in addition to FOX-8 13

14 290 Table 2. Kinetic data for the pure FOX-8 and the FOX-3 β-lactamases a. 291 k cat (s -1 ) Km ( μm) k cat /Km (μm -1 s -1 ) FOX-3 FOX-8 FOX-3 FOX-8 FOX-3 FOX-8 Nitrocefin ± ± ± ± Ampicillin 0.39± ± ± ± Cephalotin 1634± ±23 163± ± Cefoxitin 1.742± ± ± ± Cefotaxime ± ± ± ± Ceftazidime 0.273± ± ± ± Cefepime ND ND ND ND ± ± Imipenem 0.015± ± ± ± a Data are means ± the standard deviation (where applicable). 294 ND: Not determined. Km are very high and only the k cat /Km ratio was determined on the basis of the first order reaction time for hydrolysis. 14

295 296 297 298 299 300 301 302 303 304 305 Figure 1.A. Representation of the CMY-10 class C β-lactamase with amino acids from the conserved motif displayed as yellow spheres and the R2 loop in green.

15 Figure 1.A. Representation of the CMY-10 class C β-lactamase with amino acids from the conserved motif displayed as yellow spheres and the R2 loop in green. Leu293, which is equivalent to Leu313 of FOX-8 and Phe313 of FOX-3, is shown as orange structures. B. Close up view of the active site with residues from the conserved motif represented as grey structures

Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC phenotype

J Antimicrob Chemother 2010; 65: 460 464 doi:10.1093/jac/dkp484 Advance publication 22 January 2010 Prevalence and molecular characterization of clinical isolates of Escherichia coli expressing an AmpC