Wilds. Cultivars. Landraces. Number of Haplotypes, h 8 Haplotype (gene) diversity, Hd HORVU5Hr1G
|
|
|
- Agnes Paul
- 6 years ago
- Views:
Transcription
1
2
3 Number of Haplotypes, h 8 Haplotype (gene) diversity, Hd Wilds Cultivars Landraces #GeneName CBF14 GeneId HORVU5Hr1G TranscriptId HORVU5Hr1G variants_impact_low 1 variants_impact_moderate 4 variants_effect_missense_variant 1 variants_effect_synonymous_variant 4
4 Number of Haplotypes, h 94 Haplotype (gene) diversity, Hd Wilds Cultivars Landraces #GeneName CBF9 GeneId HORVU5Hr1G TranscriptId HORVU5Hr1G variants_impact_high 1 variants_impact_low 11 variants_impact_moderate 9 variants_impact_modifier 11 variants_effect_3_prime_utr_variant 5 variants_effect_5_prime_utr_variant 4 variants_effect_downstream_gene_variant 2 variants_effect_missense_variant 9 variants_effect_stop_gained 1 variants_effect_synonymous_variant 11
5 Gene Trait Barley candidate Complete Significant variants Coordinates Functional annotation Nº exons Captured Total SNPs Morex Version 2016 annotation Type Number D11 Leaf angle MLOC_ HORVU2Hr1G chr2h: Cytochrome P450 superfamily protein 9 Partially No start codon 11 Missense 2 Number of Haplotypes, h 9 Haplotype (gene) diversity, Hd Tajima s neutrality test ns Ka/Ks Fst (cultivars vs. landraces) Synonimous mutation in exon 5 Thr->Met at 4 codon, WB-496 Arg->Gly in exon 4, WB-467
6 Geographical distribution of the main haplotypes (geo-referenced landraces only) Hap_1 Hap_2 Hap_3
7 VARIANT DATA HAS TO BE ROBUST!! Which is the real coverage of the exon capture probes? Map the capture probes and/or BAM files on the genome
8 VARIANT DATA HAS TO BE ROBUST!! Which is the real coverage of the exon capture probes? There is a serious problem of annotation manually check chr2h Hv_IBSC_PGSB_r1 transcript gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 exon gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 exon gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 exon gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 exon gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 exon gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 5UTR gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 CDS gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 CDS gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 CDS gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 CDS gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 CDS gene_id "HORVU2Hr1G038940"; transcr chr2h Hv_IBSC_PGSB_r1 3UTR gene_id "HORVU2Hr1G038940"; transcr
9 VARIANT DATA HAS TO BE ROBUST!! Which is the real coverage of the exon capture probes? There is a serious problem of annotation manually check How to handle missing data? impute (not always reliable) remove individuals (for example for HvD11 we left with 308 indiviiduals
10 VARIANT DATA HAS TO BE ROBUST!! Which is the real coverage of the exon capture probes? There is a serious problem of annotation manually check How to handle missing data? impute (not always reliable) remove individuals (for example for HvD11 we left with 308 indiviiduals False heterozygus calls
11 Gene Trait Barley candidate Complete Significant variants Coordinates Functional annotation Nº exons Captured Total SNPs Morex Version 2016 annotation Type Number PCF6 Leaf size MLOC_ HORVU5Hr1G chr5h: TCP family transcription factor 4 1 Partially Yes 35 Missense 10 CDS: 615,593, ,594,818, 16 SNPs False heterozygous calls, due to capturing gene paralogs?
12 Gene PsbR Trait Photosynthesis efficiency Barley candidate Complete Significant variants Coordinates Functional annotation Nº exons Captured Total SNPs Morex Version 2016 annotation Type Number - HORVU2Hr1G chr2h: Photosystem II 10 kda polypeptide, chloroplastic 5 Partially Yes 17 START lost 1 missense 2 False heterozygous calls, due to capturing gene paralogs? Or cross capturing conserved domains?
13 VARIANT DATA HAS TO BE ROBUST!! Which is the real coverage of the exon capture probes? There is a serious problem of annotation manually check How to handle missing data? impute (not always reliable) remove individuals (for example for HvD11 we left with 308 indiviiduals False heterozygus calls What about InDels?
14 M3.3: First year characterization of elite material (M14) D3.4: Characterized elite material, and prospective parents for strategic crosses (to pyramid improved straw without penalizing yield) identified (M24)
15 Task 3.3 Genetic variation for traits determining biomass and yield in elite material Acc. Nr Acc. Name GH RT Country of origin Characteristics Pedigree WB-004 KW Glacier Winter 2-row United Kingdom fodder KWS Cassia x Retriever WB-006 KW Capella Winter 2-row United Kingdom fodder WB-007 Saffron Winter 2-row United Kingdom fodder Antigua x Tabatha WB-003 KW Cassia Winter 2-row United Kingdom fodder (Eden x Carat) x Saffron WB-028 Nure Winter 2-row Italy fodder (Fior 40 x Alpha) x Baraka WB-010 Meridian Winter 6-row United Kingdom fodder (Ikone x Lomerit) x Fridericus WB-011 Escadre Winter 6-row United Kingdom fodder Esterel x MH93 FV 41 WB-014 Tonic Winter 6-row Germany fodder Leibniz x LP WB-023 Fridericus Winter 6-row Germany fodder Carola x LP WB-025 Ketos Winter 6-row France fodder (Gotic x Orblonde) x (12813 x 91H595) ITA-01 Atomo Winter 2-row France fodder ITA-02 Cometa Winter 2-row Italy fodder F8PO x (Amillis/Fior 2377) ITA-03 Aquirone Winter 2-row Italy fodder Fior 5186 x Naturel ITA-04 Catalina Winter 2-row France fodder ITA-05 Calanque Winter 2-row France fodder ITA-06 Alimini Winter 6-row Italy fodder FIOR 2551 x Federal ITA-07 Atlante Winter 6-row Italy fodder ITA-08 Etincel Winter 6-row France fodder ITA-09 Lutece Winter 6-row France fodder ITA-10 Shangrila Winter 6-row France fodder SPA-01 Pewter Winter 2-row United Kindom malting barley SPA-02 Zoo Winter 6-row Spain Hybrid fodder SPA-03 Kalea Winter 2-row France fodder SPA-04 Meseta Winter 2-row France fodder SPA-05 Hispanic Winter 2-row France fodder SPA-06 Dulcinea Winter 2-row France fodder SPA-07 Graphic Winter 2-row France fodder SPA-08 Cib 333 Winter 2-row Spain fodder SPA-09 Doblona Winter 6-row Spain fodder SPA-10 Mochona 5 Winter 6-row Spain fodder 10 elite cultivars from Whealbi, in both trials 10 elite Italian cultivars, only sown in Italy 10 elite Spanish cultivars, only sown in Spain
16 ITALY TRIAL: CREA, Fiorenzuola d Arda Sowing date: Experimental design: complete randomized block design with three replications Plot size: 1.36 m x 4 m, 300 seeds/m 2 Traits scored up to now: - Date of seedling emergence: all the plots emerged from November 20 to November 24 - Date of onset of tillering: most of the plots started tillering between February 7 and February 15 Plants did not yet start stem elongation
17
18 SPAIN TRIAL: School of Agronomy, University of Lleida Sowing date: Experimental design: complete randomized block design with three replications Plot size: 1.2 m x 4m, 300 seeds/m 2 Traits scored up to now: date of emergence date of onset of tillering date of stem elongation (DC 3.1) total biomass, LAI, photosynthesis and SPAD on the last elongated leaf at stem elongation stage From stem elongation radiation interception once a week
19
20 The remaining traits will be scored folowing the common protocol developed by Gustavo and Roxana A second year of field trialling will be run in Italy and Spain, plus an extra trial in Polonia (ok for winter lines?)
Association genetics in barley
Association genetics in barley Ildikó Karsai, Hungarian Academy of Sciences, Martonvásár, Hungary Frank Ordon, Dragan Perovic, Julius Kühn Institute, Quedlinburg, Germany Günther Schweizer, Bianca Büttner,
Package FSTpackage. June 27, 2017
Type Package Package FSTpackage June 27, 2017 Title Unified Sequence-Based Association Tests Allowing for Multiple Functional Annotation Scores Version 0.1 Date 2016-12-14 Author Zihuai He Maintainer Zihuai
Gene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
Assessing De-Novo Transcriptome Assemblies
Assessing De-Novo Transcriptome Assemblies Shawn T. O Neil Center for Genome Research and Biocomputing Oregon State University Scott J. Emrich University of Notre Dame 100K Contigs, Perfect 1M Contigs,
Manipulating crop row orientation and crop density to suppress annual ryegrass
Manipulating crop row orientation and crop density to suppress annual ryegrass Catherine Borger, Department of Agriculture of Food Western Australia Merredin, Abul Hashem, Department of Agriculture of
Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
Genome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
Unit 1: DNA and the Genome Sub-topic 6: Mutation
Unit 1: DNA and the Genome Sub-topic 6: Mutation Page 1 of 24 On completion of this topic I will be able to state that: mutations are random changes in the genome, causing no protein or an altered protein
Genomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
A tutorial introduction into the MIPS PlantsDB barley&wheat databases. Manuel Spannagl&Kai Bader transplant user training Poznan June 2013
A tutorial introduction into the MIPS PlantsDB barley&wheat databases Manuel Spannagl&Kai Bader transplant user training Poznan June 2013 MIPS PlantsDB tutorial - some exercises Please go to: http://mips.helmholtz-muenchen.de/plant/genomes.jsp
SNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
OBJECTIVES-ACTIVITIES 2-4
OBJECTIVES-ACTIVITIES 2-4 Germplasm Phenotyping Genomics PBA BIMS MAB Pipeline Implementation GOALS, ACTIVITIES, & DELIVERABLES Cameron Peace, project co-director & MAB Pipeline Team leader Outline of
Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition
RESEARCH ARTICLE Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition Moses M. Muraya 1,2, Thomas Schmutzer 1 *, Chris Ulpinnis
Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
RNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
Insight into the genetic basis of winter hardiness and the potential this has to alter US malting-quality barley
Eric J Stockinger AMBA Barley Improvement Conference San Diego, CA January 14, 2013 Insight into the genetic basis of winter hardiness and the potential this has to alter US malting-quality barley Winter
Answers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
Biotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
Introducing the Winter Star II replacement
Ultrastrike film coat seed recommended USES: 15-50kg/ha 500mm pa BEEF DAIRY SHEEP HAY SILAGE Introducing the Winter Star II replacement Exceptional seedling vigour Improved early winter production High
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Oncomine cfdna Assays Part III: Variant Analysis
Oncomine cfdna Assays Part III: Variant Analysis USER GUIDE for use with: Oncomine Lung cfdna Assay Oncomine Colon cfdna Assay Oncomine Breast cfdna Assay Catalog Numbers A31149, A31182, A31183 Publication
Additional Practice Problems for Reading Period
BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation
Association Mapping in Wheat: Issues and Trends
Association Mapping in Wheat: Issues and Trends Dr. Pawan L. Kulwal Mahatma Phule Agricultural University, Rahuri-413 722 (MS), India Contents Status of AM studies in wheat Comparison with other important
Theory and Application of Multiple Sequence Alignments
Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)
Winter Cereal Varieties for Barry O Reilly, DAFF
Winter Cereal Varieties for 2012 Barry O Reilly, DAFF Winter Barley, 2012 Variety RL Status % Area Sown 2011 % Seed avail 2012 Agt Amarena R R 3 2 KWS Cassia 2R R 25 3 Leibniz R R 9 15 ST Saffron 2R R
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
NITROGEN (N) MANAGEMENT: DO BARLEY VARIETIES RESPOND DIFFERENTLY TO N?
NITROGEN (N) MANAGEMENT: DO BARLEY VARIETIES RESPOND DIFFERENTLY TO N? Linda Walters and Simon Craig (BCG) and Ben Jones (Mallee Focus) TAKE HOME MESSAGES In 213, all barley varieties had a similar yield
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
From Gene to Protein. How Genes Work (Ch. 17)
From Gene to Protein How Genes Work (Ch. 17) What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA proteins cells bodies The Central
Protein Synthesis Honors Biology
Protein Synthesis What do we know? Metabolism is controlled by enzymes enzymes are proteins DNA contains the genetic information to build proteins. DNA is only in the nucleus. Ribosomes are not. How then
Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Genetics Final Exam Summer 2012 VERSION B. Multiple Choice (50 pts. possible) IF you completed the in-class workshop put a CHECK MARK HERE --->
enetics Final Exam Summer 2012 VERSION B Name Multiple hoice (50 pts. possible) Problems (50 points possible) Total (100 points possible) KEY IF you completed the in-class workshop put a HEK MRK HERE --->
Disease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
Sequence Variations. Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms. NCBI SNP Primer:
Sequence Variations Baxevanis and Ouellette, Chapter 7 - Sequence Polymorphisms NCBI SNP Primer: http://www.ncbi.nlm.nih.gov/about/primer/snps.html Overview Mutation and Alleles Linkage Genetic variation
Pathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
Biology BIOL5 Unit 5 Control in cells and in organisms Friday 25 June pm to 3.45 pm For this paper you must have: Time allowed
Centre Number Surname Candidate Number For Examiner s Use Other Names Candidate Signature Examiner s Initials General Certificate of Education Advanced Level Examination June 2010 Question 1 2 Mark Biology
CH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
Prospects for combining high sucrose content with increased fibre to generate multipurpose
Prospects for combining high sucrose content with increased fibre to generate multipurpose cane varieties A. J. Kennedy. West Indies Central Sugar Cane Breeding Station Groves St George Barbados ABSTRACT
Release Notes for Genomes Processed Using Complete Genomics Software
Release Notes for Genomes Processed Using Complete Genomics Software Version 1.11.0 Related Documents... 1 Changes to Version 1.11.0... 2 Changes to Version 1.10.0... 6 Changes to Version 1.9.0... 10 Changes
Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of. Autosomal Recessive Retinitis Pigmentosa
Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of Autosomal Recessive Retinitis Pigmentosa Corton M 1,2 *, Avila-Fernández A 1,2, Campello L 3, Sánchez M 1,2, Benavides
Assignment 9: Genetic Variation
Assignment 9: Genetic Variation Due Date: Friday, March 30 th, 2018, 10 am In this assignment, you will profile genome variation information and attempt to answer biologically relevant questions. The variant
Chapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
Figure S1. Schematic representation of the winter VRN-H1 allele from cv. Strider (AY750993) with positions of markers genotyped in this study
Figure S1. Schematic representation of the winter VRN-H1 allele from cv. Strider (AY750993) with positions of markers genotyped in this study indicated. Exons are denoted by black boxes. SNP1 (T-1,948/C),
produces an RNA copy of the coding region of a gene
1. Transcription Gene Expression The expression of a gene into a protein occurs by: 1) Transcription of a gene into RNA produces an RNA copy of the coding region of a gene the RNA transcript may be the
Lecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden Phone:
The course is designed to help students develop and demonstrate an understanding of the biological concepts of genetics and biodiversity through scientific inquiry, problem solving, personal reflection
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data
Variant detection analysis in the BRCA1/2 genes from Ion torrent PGM data Bruno Zeitouni Bionformatics department of the Institut Curie Inserm U900 Mines ParisTech Ion Torrent User Meeting 2012, October
Microarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
Computational methods for the analysis of rare variants
Computational methods for the analysis of rare variants Shamil Sunyaev Harvard-M.I.T. Health Sciences & Technology Division Combine all non-synonymous variants in a single test Theory: 1) Most new missense
3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
Genome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
An introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
Transcriptome sequencing of two wild barley (Hordeum spontaneum L.) ecotypes differentially adapted to drought stress reveals ecotypespecific
Bedada et al. BMC Genomics 2014, 15:995 RESEARCH ARTICLE Open Access Transcriptome sequencing of two wild barley (Hordeum spontaneum L.) ecotypes differentially adapted to drought stress reveals ecotypespecific
DNA REPLICATION REVIEW
Biology Ms. Ye DNA REPLICATION REVIEW 1. Number the steps of DNA replication the correct order (1, 2, 3): Name Date Block Daughter strands are formed using complementary base pairing DNA unwinds The DNA
Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions
Association mapping of Sclerotinia stalk rot resistance in domesticated sunflower plant introductions Zahirul Talukder 1, Brent Hulke 2, Lili Qi 2, and Thomas Gulya 2 1 Department of Plant Sciences, NDSU
Variant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
The tomato genome re-seq project
The tomato genome re-seq project http://www.tomatogenome.net 5 February 2013, Richard Finkers & Sjaak van Heusden Rationale Genetic diversity in commercial tomato germplasm relatively narrow Unexploited
Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Personal Genomics Platform White Paper Last Updated November 15, Executive Summary
Executive Summary Helix is a personal genomics platform company with a simple but powerful mission: to empower every person to improve their life through DNA. Our platform includes saliva sample collection,
Exploring Similarities of Conserved Domains/Motifs
Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;
11 questions for a total of 120 points
Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive
ChroMoS Guide (version 1.2)
ChroMoS Guide (version 1.2) Background Genome-wide association studies (GWAS) reveal increasing number of disease-associated SNPs. Since majority of these SNPs are located in intergenic and intronic regions
Compete with weeds give your crop heaven and your weeds hell
Compete with weeds give your crop heaven and your weeds hell Peter Newman & Christine Zaicou-Kunesch, Department of Agriculture and Food KEY MESSAGES Weeds are a problem in crops because they compete for
TIGR THE INSTITUTE FOR GENOMIC RESEARCH
Introduction to Genome Annotation: Overview of What You Will Learn This Week C. Robin Buell May 21, 2007 Types of Annotation Structural Annotation: Defining genes, boundaries, sequence motifs e.g. ORF,
Teagasc Crops Forum Shay Phelan 07/9/2016
Teagasc Crops Forum 2016 Shay Phelan 07/9/2016 Agenda Quick review 2016 harvest Planning for 2017 Autumn Agronomy Rotations Seed rates Autumn diseases Winter Crops 2016 Many challenges Waterlogging Late
GENETICS. I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide chains wrap around each other to form a
GENETICS I. Review of DNA/RNA A. Basic Structure DNA 3 parts that make up a nucleotide 1. 2. 3. chains wrap around each other to form a Chains run in opposite direction known as Type of bond between the
K. S. SOMASHEKAR*, B. G. SHEKARA 1, K. N. KALYANA MURTHY AND L. HARISH 2 SUMMARY
Forage Res., 40 (1) : pp. 23-27 (2014) http://forageresearch.in YIELD, NITROGEN UPTAKE, AVAILABLE SOIL NUTRIENTS AND ECONOMICS OF MULTICUT FODDER SORGHUM (SORGHUM SUDANENSE L.) TO DIFFERENT SEED RATES
Wednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
BIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
2/22/2012. Impact of Genomics on Dairy Cattle Breeding. Basics of the DNA molecule. Genomic data revolutionize dairy cattle breeding
Impact of Genomics on Dairy Cattle Breeding Bennet Cassell Virginia Tech 2012 VSFA/VA Tech Nutrition Cow College Genomic data revolutionize dairy cattle breeding Accuracy of selection prior to progeny
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
(a) Which enzyme(s) make 5' - 3' phosphodiester bonds? (c) Which enzyme(s) make single-strand breaks in DNA backbones?
EXAMPLE QUESTIONS AND ANSWERS 1. Topoisomerase does which one of the following? (a) Makes new DNA strands. (b) Unties knots in DNA molecules. (c) Joins the ends of double-stranded DNA molecules. (d) Is
Plant Science 446/546. Final Examination May 16, 2002
Plant Science 446/546 Final Examination May 16, 2002 Ag.Sci. Room 339 10:00am to 12:00 noon Name : Answer all 16 questions A total of 200 points are available A bonus question is available for an extra
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
Abstract. Introduction. Bulgarian Journal of Agricultural Science, 21 (No 4) 2015, Agricultural Academy
742 Bulgarian Journal of Agricultural Science, 21 (No 4) 215, 742-746 Agricultural Academy Efficiency of Some Foliar fertilizers in Winter Wheat S. KOSTADINOVA 1, St. KALINOVA 1, A. HRISTOSKOV 1 and A.
Targeted resequencing
Targeted resequencing Sarah Calvo, Ph.D. Computational Biologist Vamsi Mootha laboratory Snapshots of Genome Wide Analysis in Human Disease (MPG), 4/20/2010 Vamsi Mootha, PI How can I assess a small genomic
The first and only fully-integrated microarray instrument for hands-free array processing
The first and only fully-integrated microarray instrument for hands-free array processing GeneTitan Instrument Transform your lab with a GeneTitan Instrument and experience the unparalleled power of streamlining
1. DNA, RNA structure. 2. DNA replication. 3. Transcription, translation
1. DNA, RNA structure 2. DNA replication 3. Transcription, translation DNA and RNA are polymers of nucleotides DNA is a nucleic acid, made of long chains of nucleotides Nucleotide Phosphate group Nitrogenous
Zahirul Talukder 1, Yunming Long 1, Thomas Gulya 2, Charles Block 3, Gerald Seiler 2, Lili Qi 2. Department of Plant Sciences, NDSU
Sclerotinia stalk rot resistance in sunflower: Introgression of resistance from wild annual species and QTL mapping of resistance in cultivated sunflower Zahirul Talukder 1, Yunming Long 1, Thomas Gulya
TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?
TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day
PERFORMANCE OF VARIOUS HYBRIDS OF SUNFLOWER IN PESHAWAR VALLEY
PERFORMANCE OF VARIOUS HYBRIDS OF SUNFLOWER IN PESHAWAR VALLEY Jehan Bakht 1, Shakeel Ahmad 1, Mohammad Tariq 2, Habib Akber 1 and Mohammad Shafi 1 1 Department of Agronomy, NWFP Agricultural University,
Chapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
Lecture 2-3: Using Mutants to study Biological processes
Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
YIELD AND YIELD COMPONENTS A Practical Guide for Comparing Crop Management Practices
YIELD AND YIELD COMPONENTS A Practical Guide for Comparing Crop Management Practices Acknowledgements This material was developed under the CGIAR Research Program on Climate Change, Agriculture and Food
Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
Date of Planting and Nitrogen management for Malt Barley production in the Northeast
Date of Planting and Nitrogen management for Malt Barley production in the Northeast Caroline Wise, Masoud Hashemi and Talia Aronson Introduction: Growers who are interested in growing malt barley as a
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES.
MAKING WHOLE GENOME ALIGNMENTS USABLE FOR BIOLOGISTS. EXAMPLES AND SAMPLE ANALYSES. Table of Contents Examples 1 Sample Analyses 5 Examples: Introduction to Examples While these examples can be followed
What is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
Scientific Method. Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel
Name: NetID: Exam 1 Version 1 September 12, 2017 Dr. A. Pimentel Each question has a value of 4 points and there is a total of 156 points in the exam. However, the maximum score of this exam will be capped
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat) uthors: Klaas J. Wierenga, MD & Zhijie Jiang, P PhD
USER MANUAL for the use of the human Genome Clinical Annotation Tool (h-gcat)) Authors: Klaas J. Wierenga, MD & Zhijie Jiang, PhD First edition, May 2013 0 Introduction The Human Genome Clinical Annotation