Supporting Online Material for

Transcription

1 Supporting Online Material for Coadministration of a Tumor-Penetrating Peptide Enhances the Efficacy of Cancer Drugs Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach Agemy, Daniel R. Greenwald, Erkki Ruoslahti* *To whom correspondence should be addressed. ruoslahti@burnham.org This PDF file includes: Materials and Methods SOM Text Figs. S1 to S16 Table S1 References Published 8 April 2010 on Science Express DOI: /science

2 Materials and Methods Preparation of compounds. Synthetic peptides (3, 6), inert G 7 phage and irgd phage (3, 6), FAM-labeled untargeted iron oxide nanoworms (16), and FAM-labeled and irgd-coated ABX (3, 19) were prepared as described. Free DOX was purchased from Sigma-Aldrich (St. Louis, MO). DOX-liposomes were composed of 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine and 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-n-[methoxy(polyethylene glycol)-2000] at 2:1.5:1.25:0.25 molar ratios. The lipids (Avanti Polar Lipids, Alabaster, AL) were dissolved in chloroform and the solvent was evaporated to a thin film with moisture free nitrogen gas. The dried lipid film was hydrated with 0.3 M ammonium phosphate buffer (ph 7.4) for 1 hour at 60 C. The mixture was then briefly vortexed and occasionally sonicated in a bath sonicator to form multilamellar vesicles. The vesicles were further sonicated using a Ti probe sonicator for 2-3 minutes until a translucent solution of small unilamellar vesicles was obtained. The vesicles were then sequentially extruded 11 times through polycarbonate membrane filters with pore diameters of 200 nm and 100 nm using an Avanti mini extruder (Avanti Polar Lipids). The buffer was then exchanged with Hepesbuffered saline (20 mm Hepes, 150 mm NaCl, ph 7.4) by gel filtration using NAP-10 or NAP-25 columns (GE Healthcare, Milwaukee, WI). DOX was encapsulated in these liposomes through a transmembrane phosphate gradient as described previously (13). The DOX-liposomes were 120 ± 8 nm in diameter (± indicates standard deviation) as measured by dynamic laser light scattering (refractive index, 1.59; viscosity, 0.89) on a Malvern Zetasizer Nano (Malvern, UK). Cells and tumor models. MIA PaCa-2 human pancreatic ductal cancer, 22Rv1, GFP-PC-3, and PPC-1 human prostate cancer, and 4T1 mouse breast cancer cell lines were cultured in Dulbecco s Modified Eagle Medium (DMEM) with 10% fetal bovine serum and penicillin/streptomycin. The BT474 human breast cancer cell line was cultured in SFM4MAB medium with 10% fetal bovine serum and penicillin/streptomycin (3). The MIA PaCa-2 and 22Rv1 xenografts were created by injecting athymic BALB/c nude mice (Harlan Sprague Dawley, Inc., Indianapolis, IN) orthotopically with 10 6 cells. PPC-1 subcutaneous tumors were created by injection of 10 6 cells into athymic BALB/c nude mice. For the 4T1 xenografts, 10 6 cells were injected orthotopically into BALB/c mice (Charles River, Wilmington, MA). For the BT474 xenografts, 17β-estradiol pellets (Innovative Research of America, Sarasota, FL) were implanted subcutaneously into the back of the mice one day prior to the orthotopic inoculation of 5 x 10 6 cells in matrigel (BD Biosciences, San Jose, CA). Disseminated GFP-PC-3 tumors were made by injecting 2 x 10 6 cells into the left ventricle of the heart. The disseminated nodules were detected under UV light with an Illumatool Bright Light System LT-9900 (Lightools Research, Encinitas, CA). Transgenic mice with de novo pancreatic ductal adenocarcinoma were kindly provided by Dr. Douglas Hanahan (University of California, San Francisco, CA). All animal experimentation was performed according to procedures approved by the Animal Research Committee at the University of California, Santa Barbara. In vivo systemic permeability assay. Tumor mice were injected intravenously with 100 ml of PBS containing either 1 mg of Evans Blue (MP Biomedicals, Irvine, CA), 200 nmol of fluorecein-labeled CRGDC peptide (FAM-CRGDC), 0.2 mg of fixable dextran (Molecular Probes, Eugene, OR), 10 9 plaque-forming units (pfu) of G 7 -expressing phage, 5 mg iron/kg of FAM-labeled iron-oxide nanoworms, 3 mg paclitaxel/kg FAM-ABX, 3 mg/kg of DOXliposomes, 10 mg/kg of free DOX, or 3 mg/kg of trastuzumab (Genentech, South San Francisco, CA), combined with 100 μl of PBS with or without irgd or control peptides. After the indicated time of circulation, the mice were perfused with PBS containing 1% BSA, and tissues were collected. For Evans Blue quantification, the dye was extracted from tissues in N,Ndimethylformamide for 24 hours at 37 C and quantified by measuring the absorbance at 600 nm

3 with a spectrophotometer (6). Tissues from mice that received FAM-CRGDC were imaged with the Illumatool Bright Light System LT-9900 before being processed for immunofluorescence and immunohistochemistry. Tissues with dextran, nanoworms, ABX, DOX-liposomes, free DOX, or trastuzumab were processed for either or both immunohistochemistry and immunofluorescence. The immunohistochemistry sections were scanned with a Scanscope CM-1 scanner, and positively stained areas were quantified with the ImageScope software (Aperio Technologies, Vista, CA) to calculate the % positive areas within the sections (3). To quantify the penetration distance, dynamic profiling of the immunofluorescence was performed with Image J (35). The fluorescence intensity of the compound was plotted relative to the distance from the closest CD31-positive vessel. The distance from the vessel where the fluorescence decreased to background levels was considered as the penetration distance. In vivo skin permeability assay was performed as described elsewhere (6). Immunofluorescence. Tissue preparation and staining of the cryosections were performed as described (3). The primary antibodies were rat anti-mouse CD31 (BD Biosciences), FITC-labeled HLA-A,B,C (BD Biosciences), and FITC-labeled H-2kd (BD Biosciences) monoclonal, and rabbit anti-t7 phage polyclonal (6) antibodies. The secondary antibodies, Alexa Fluor 594 goat anti-rat, 647 goat anti-rat, and 488 donkey anti-rabbit antibodies were from Molecular Probes. Immunohistochemistry. Tissue preparation and staining of the cryosections were performed as described (3). The primary antibodies used were biotinylated rabbit anti-fitc/oregon green polyclonal (Molecular Probes), and biotinylated mouse anti-dextran monoclonal (Stemcell Technologies, Vancouver, BC, Canada) and biotinylated rat anti-mouse CD31 monoclonal (BD Biosciences) andtibodies. Biotinylated secondary polycloncal antibodies were goat anti-rabbit and rabbit anti-human (both from Pierce Biotechnology, Rockford, IL). In some experiments, tissue sections were stained with a TUNEL assay kit (In Situ Cell Death Detection Kit, POD; Roche Applied Science, Indianapolis, IN), and quantified for the positive areas with a scanner as described elsewhere in this manuscript. Ex vivo tumor penetration assay. PPC-1 subcutaneous tumors (about 1 cm in diameter) were excised and placed in DMEM containing 1% BSA. The tumors were first incubated with the inhibitors or peptides for 20 min at 4 C. G 7 or irgd phage were then added to the solution and the tumors were further incubated for 90 min at 37 C or 4 C. The tumors were then washed with cold DMEM containing 1% BSA, fixed in 4% paraformaldehyde, sectioned, immunofluorescently stained, and viewed under a confocal microscope. Quantification of ABX in tumors and tissues was performed as described elsewhere (3). Tumor treatment with ABX. Nude mice bearing orthotopic 2-week-old xenografts of 22Rv1 (typically about 250 mm 3 ) or BT474 (about 100 mm 3 ) received every other day intravenous injections of ABX alone, ABX plus 4 μmol/kg irgd, irgd-coated ABX, or PBS. The dose of ABX in all groups was 3 mg paclitaxel/kg/injection. The mice were weighed every 4 days. After 24 days of treatment for mice with BT474 and 16 days for 22Rv1, the mice were perfused with PBS containing 1% BSA and tumors were harvested and weighed. The tumor volume was calculated using the following formula: volume (mm 3 ) = (d 2 x D)/2, where d is the smallest and D is the largest tumor diameters (3, 19). Quantification of DOX in tumors and normal tissues. The quantification was performed as described (36). Briefly, for DOX-liposomes, mice with 22Rv1 orthotopic tumors were injected intravenously with DOX-liposomes (5 mg/kg) with or without irgd (4 μmol/kg), or empty

4 liposomes. For free DOX, mice with 22Rv1 or 4T1 orthotopic tumors were intravenously injected with free DOX (10 mg/kg) with or without irgd (4 μmol/kg), or PBS. After 3 hours for DOXliposomes or 1 hour for free DOX, the mice were perfused with PBS containing 1% BSA, and the tumors and organs were collected. To determine the concentration of DOX in the tissues, the tissues were homogenized in 1% sodium dodecyl sulfate and 1 mm H 2 SO 4 in water. Then, DOX was extracted by adding 2 ml of chloroform/isopropyl alcohol (1:1, v/v) to the homogenized samples, followed by vortexing and freeze/thaw cycles. The samples were centrifuged at 14,000 x g for 15 minutes and OD490nm of the organic phase (lowest phase) was measured. Tumor treatment with DOX or DOX-liposomes. Mice bearing 2-week old orthotopic xenografts of 22Rv1 or orthotopic 4T1 (about 100 mm 3 ) received intravenous injections of free DOX (1 or 3 mg/kg) or PBS, combined with irgd (4 μmol/kg) or PBS every other day. Mice bearing 2 week-old 22Rv1 orthotopic tumors received daily intravenous injections of DOXliposomes (1 or 3 mg/kg) or PBS, combined with 2 mmol/kg irgd, cyclo(-rgdfk-), or PBS. The mice were weighed every 3-4 days. After 24 days of treatment with DOX for 22RV1 and 12 days for BT474, and 17 days of treatment with DOX-liposomes for 22Rv1, the mice were perfused through the heart with PBS containing 1% BSA and tumors and hearts were harvested, weighed, and processed for histology. Competitive ELISA for quantification of trastuzumab. Tissues from BT474 tumor mice that received trastuzumab injections were homogenized in 1 ml of 0.1 M Glycine ph2 with 1% Tween-20 and protease inhibitors (Complete Mini EDTA-free; Roche Applied Science) followed by a centrifugation (4 C, 10 min, 14,000 rpm). Six hundred microliters of supernatant was collected, and added with 150 μl of 1 M Tris ph8 and 22.5 μl of 5 M NaCl to neutralize the ph. Microtiter wells coated with 5 mg/ml rabbit anti-human IgG (SouthernBiotech, Birmingham, AL) were incubated with the tissue extracts and 1 μg/ml of biotinylated human IgG (Rockland Immunochemicals, Gilbertsville, PA). After 2 hours of incubation at room temperature, the wells were washed with PBS containing 0.01% Tween 20, added with streptavidin-conjugated horseradish peroxidase, and incubated for 30 minutes at room temperature. The amount of biotinylated human IgG captured on the microtiter wells was quantified with 2,2-azino-bis(3- etylbenzthiazoline-6-sulfonic acid) as a substrate and the absorbance at 405 nm was measured. To obtain standard curves, the tissue extracts were substituted with various concentrations of trastuzumab (ranging from 0.01 to 10 μg/ml) in the ELISA. BT474 xenograft treatment with trastuzumab. Mice bearing BT474 orthotopic tumors (about 100 mm 3 ) were injected intravenously every 4 days with trastuzumab at 3 mg/kg for the first injection at day 21 after tumor cell inoculation (= day 0 in Fig. 4C) and 1.5 mg/kg for subsequent injections as a maintenance dose. The treatment was combined with daily injections of 4 μmol/kg irgd in PBS or PBS on the days of trastuzumab injections, and 2 μmol/kg irgd or PBS on the other days. In some groups, trastuzumab of 3-times higher dose than in the irgd combination regimen was used. After 24 days of treatment, the mice were perfused and tissues were harvested. Quantification of human tumor cell DNA by polymerase chain reaction (PCR). Quantitative PCR of human Alu repetitive genomic DNA elements was performed as described (26, 37). Primers (Alu 3-5'GATCGCGCCACTGCACTCC3' and Alu 5-5'GGATTACAGGCGTGAGCCAC3') at 2 μm were included in Power SYBR Mastermix (Applied Biosystems, Foster City, CA), and quantitative PCR and melting curve analysis were performed with a BioRad i-cycler IQ real-time detection system. The PCR conditions were; initial denaturation (12 min, 95 C); 40 amplification cycles of denaturation (20 sec, 95 C), annealing (1 min, 56 C), and extension (1 min, 72 C). Genomic DNA was extracted from cultured cells and

5 tissue samples using DNeasy blood and tissue kit (Qiagen, Valencia, CA). Specificity of PCR for human cells was verified by the lack of DNA amplification using DNA extracted from mouse 4T1 cells and organs from normal mice. The values were normalized to those obtained with a defined number of cultured 22Rv1 or BT474 cells to calculate the number of cells contained in each tissue (cells per mg wet weight). Statistical analysis. Data were analyzed by two-tailed Student s t-test or one-way analysis of variance (ANOVA) followed by suitable post-hoc test. The results are summarized in table S1.

6 Fig. S1. Tumor-specific entry of Evans Blue into extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic MIA PaCa-2 human pancreatic carcinoma xenografts were intravenously injected with 1 mg of Evans Blue, followed 5 minutes later by 4 μmol/kg of irgd or control peptides in PBS, or PBS alone. Tissues were collected 30 minutes later. (A) Evans Blue accumulation in tissues of mice injected with irgd (main panel) and the tumor of a PBSinjected mouse (inset). Note the blue color in the primary tumor and a tumor that invaded the left kidney (arrowheads) of the irgd-injected mouse. T, tumor; P, pancreas; S, spleen. (B to D) Quantification of Evans Blue in the tissues. In (B), different amounts of irgd were injected. In (C), the effect of irgd was compared with that of non-cendr RGD peptides. In (D), 50 μg of an anti-nrp-1 antibody or a control IgG was injected before irgd. Statistical analyses were done with ANOVA. n = 3; Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p <

7 Fig. S2. Tumor-specific entry of Evans Blue into extravascular tumor tissue in various tumor models. Experiments were performed as in fig. S1. (A) Macroscopic appearance of orthotopic xenografts of BT474 human breast and 22Rv1 human prostate cancer, and genetically engineered de novo mouse pancreatic ductal adenocarcinoma (PDAC). (B) Macroscopic appearance of GFP- PC-3 disseminated tumors generated by intracardiac injection of the tumor cells and normal tissues. Note the blue color in the tumors from mice that received both the dye and irgd, including many of the small nodules in the GFP-PC-3 disseminated tumor model (arrowheads). The green fluorescent signals in the right panels show the location of the tumor nodules. (C) Quantification of Evans Blue in jaw tumors of the GFP-PC-3 disseminated tumor model. Note the tumor-specific accumulation of the dye when it was co-injected with irgd, but not with non- CendR RGD peptides or PBS only. Statistical analysis was performed with Student s t-test. Error bars, mean ± SEM; **p < 0.01; n = 3.

8 Fig. S3. The CendR element of irgd (CRGDK) induces local vascular permeabilization in the skin. A modified Miles assay was (6) carried out as follows: Mice were intravenously injected with 150 μl of PBS containing a mixture of 0.5% Evans Blue, 13 μg of Quantilum recombinant luciferase, and 10 9 pfu of non-targeted phage particles. Ten minutes later, the mice received intradermal injections of chemically synthesized CRGDK peptide in 30 μl of PBS or PBS alone. After 30 minutes, skin samples were collected with a 4 mm puncher. Luciferase activity and phage titer were measured to quantify the presence of the iintravenously injected compounds at the intradermal injection sites. The CRGDK values were normalized to samples PBS injection sites. Statistical analyses were performed with ANOVA. Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p < 0.001; n = 3.

9 Fig. S4. The irgd combination delivery system. Intravenously injected irgd peptide penetrates tumor tissue in a 3-step process (right panel) (3); (i) irgd recognizes the αv integrins on tumor blood vessel endothelial cells with the RGD motif, (ii) the peptide is then proteolytically processed to expose the cryptic CendR element, RGDK/R, at the C-terminus (yellow arrow), and the disulfide bond breaks (yellow line), (iii) the CendR element mediates binding to NRP-1, which induces vascular and tissue permeabilization. In the conventional conjugated delivery approach, the cargo (e.g. a drug, or diagnostic compound) is chemically attached to the N- terminal cysteine ( C in red, right panel). In the combination delivery method, the cargo is coadministered with the free peptide. The cargo gains access to the extravascular tumor parenchyma because irgd activates a bulk transport system in the tumor that mediates extravasation, tissue penetration, and internalization into cells.

10 Fig. S5. Accumulation of molecules within extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic 22Rv1 tumors were injected with 200 nmol of fluorescein-labeled CRGDC peptide (FAM-CRGDC), or 0.2 mg of Texas red-labeled 3 kda or 10 kda dextran, followed 5 minutes later, by 4 μmol/kg of irgd peptide in PBS or PBS alone. Tissues were collected 2 hours later for the FAM-CRGDC, and 30 minutes later for the dextrans. (A) Confocal images of the tumors. For FAM-CRGDC, images taken under UV light are also shown (left most panels). The dotted lines indicate the tissue outlines. Phage were detected with an anti-t7 phage antibody. Some images were pseudocolored as shown in the panels. Scale bars = 100 μm. n = 3. (B) Quantification of positive areas for FAM-CRGDC and dextrans in the tumor sections. Cryosections were stained immunohistochemically with an anti-fitc (for FAM-CRGDC) or an anti-dextran (for dextrans), scanned with Scanscope, and analyzed with the ImageScope software. n = 3. (C) Penetration distance of the compounds from the closest CD31-positive blood vessel (35). The distance to 10 blood vessels was measured and 3 images per group were analyzed with Image J. Statistical analyses were performed with Student s t-test. Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p <

11 Fig. S6. Accumulation of nanoparticles within extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic 22Rv1 tumors were injected with 5 mg iron/kg of fluorescein-labeled iron-oxide nanoworms, or 10 9 plaque forming units (pfu) of non-targeted phage, followed 5 minutes later by 4 μmol/kg of irgd peptide in PBS or PBS alone. Tissues were collected 2 hours later for the nanoworms, and 30 minutes later for the phage. (A) Immunofluorescence of the tumors. Phage were detected with an anti-t7 phage antibody. Scale bars = 100 μm. (B) Quantification of phage accumulated in the tissues based on phage titer. Statistical analysis was performed with Student s t-test. Error bars, mean ± SEM; *p < 0.05; n = 3.

12 Fig. S7. irgd-mediated ex vivo tumor penetration by T7 phage. Subcutaneous PPC-1 human prostate cancer xenografts were excised and maintained in short-term culture containing 10 9 pfu/ml of phage expressing irgd peptides (irgd phage) or control phage expressing G 7 peptides (G 7 phage). Sodium azide concentration was 10 mm, the anti-nrp-1 antibody and control goat IgG were used at 15 μg/ml, and the irgd and control peptide were 20 μm. The tumors were first incubated with the inhibitors or free peptides for 20 min at 4 C. The indicated phage samples were then added to the solution and the tumors were further incubated for 90 min at 37 C (4 C where indicated). After the incubation, tumors were washed, fixed, and sectioned. The sections were stained with an anti-t7 phage antibody (green), an anti-cd31 antibody (red), and DAPI (blue), and viewed with a confocal microscope. The dotted lines indicate the edge of the tumor (T). Note that the irgd phage has penetrated deep into the tumor, and that sodium azide, low incubation temperature, and the anti-nrp-1 antibody inhibited the penetration. G 7 phage penetrated into the tumor tissue when co-incubated with irgd peptide, but not with a non- CendR RGD peptide, RGD-4C. Scale bar = 200 μm; n = 3.

13 Fig. S8. In vivo tumor homing of nab-paclitaxel (Abraxane; ABX). Confocal microscopy images of BT474 orthotopic tumors from mice injected with ABX alone, ABX conjugated with irgd, ABX combined with 4 μmol/kg of irgd at 3 mg paclitaxel/kg. The particles were allowed to circulate for 3 hours. The ABX particles were fluorescently labeled. Representative confocal images from three tumors for each conjugate are shown. Scale bars = 100 μm.

14 Fig. S9. Body weight of tumor mice treated with irgd, and free DOX or DOX-liposomes. The mice in the treatment study shown in Fig. 2C (A), fig. S10C (B), and Fig. 3A (C) were weighed during the study. The percent body weight shift is shown. Statistical analyses were performed with ANOVA. Error bars, mean ± SEM; n.s., not significant; ***p <

15 Fig. S10. Enhanced anti-tumor effect of free DOX co-injected with irgd in an orthotopic 4T1 mouse breast cancer model. (A and B) The 4T1 tumor mice were intravenously injected with DOX (10 mg/kg) and 4 μmol/kg of irgd or PBS. Tissues were collected 1 hour later. n = 3. In (A), the tumors were sectioned and stained with anti-cd31. Scale bars = 100 μm. In (B), DOX in the tissues was quantified. (C) The 4T1 tumor mice received every other day intravenous injections of DOX (1 or 3 mg/kg) or PBS, with 4 μmol/kg of irgd or PBS. n = 8, except for the irgd combination groups (n = 9). (D) TUNEL staining was performed on tumor and heart samples from the treatment study, and quantified for positive staining. Statistical analyses were performed with Student s t-test in (B), and ANOVA in (C) and (D). Error bars, mean ± SEM; n.s., not significant; **p < 0.01; ***p <

16 Fig. S11. Enhanced tumor penetration of DOX-liposomes co-injected with irgd. Orthotopic 22Rv1 tumor mice were intravenously injected with DOX-liposomes (5 mg/kg) followed by 4 μmol/kg of irgd or PBS. Tumors were collected 3 hours later, sectioned, stained with an anti- CD31 antibody, and observed with a confocal microscope. The native fluorescence was used to detect DOX. Representative images from three independent tumors per compound are shown. Scale bars = 200 μm.

17 Fig. S12. Localization of DOX within tumor tissue after long-term treatment with the irgd combination regimen. Tumors collected after the treatment studies in Fig. 2C (A, left panels), fig. S10C (A, right panels), and Fig. 3A (B) were fixed, sectioned, stained for CD31, and examined under a confocal microscope. The native fluorescence was used to detect DOX. Note the wide distribution of DOX after treatment with the irgd combination regimen. Representative images from 5 tumors in each group are shown. Scale bars = 100 μm.

18 Fig. S13. Localization of trastuzumab within tumor tissue after treatment with the irgd combination regimen. Tumors collected at the conclusion of the treatment study in Fig. 4C were fixed and sectioned. (A) The tumor sections were immunohistochemically stained with an antihuman IgG antibody to detect trastuzumab and double stained with hematoxylin. Note the homogeneous distribution of trastuzumab in the tumors treated with the irgd combo regimen. In contrast, the tumors treated with trastuzumab alone showed heterogeneous signals, indicating inefficient tissue penetration of the drug. Scale bars = 200 μm. (B) The slides were scanned with Scanscope and analyzed with the ImageScope software to quantify trastuzumab positive areas. Statistical analysis was performed with ANOVA. Error bars, mean ± SEM; **p < 0.01; ***p < 0.001; n = 4.

19 Fig. S14. Detection of human tumor cells within mouse organs using antibodies against major histocompatibility complex (MHC) class I antigens. MHC class I is expressed on most nucleated cells and are antigenically species-specific (25). (A) Orthotopic 22Rv1 human prostate cancer xenografts were stained with an anti-hla-a,b,c (human MHC class I) and an anti-h-2k d (BALB/c mouse MHC class I). Note that the anti-hla-a,b,c detected the tumor parenchyma, while the H-2k d only detected host (mouse)-derived tumor vessels (arrows). (B) Cryosections of a panel of organs from the mice that received PBS or irgd alone in the treatment studies shown in Figs. 2C and 3A were stained with the anti-hla-a,b,c or the anti-h-2k d. Note that the anti- HLA-A,B,C gave no staining, while the anti-h-2k d stained all the organs, showing that human cells were not detectable in the mouse organs. Representative images from 5 samples per organ from each group in the two treatment studies are shown. Scale bars = 200 μm.

20 Fig. S15. Detection of human tumor cells within mouse organs using antibodies against major histocompatibility complex (MHC) class I antigens. Cryosections of a panel of organs from the mice that received PBS or irgd alone in the BT474 breast carcinoma treatment study shown in Fig. 4C were stained with an anti-hla-a,b,c or an anti-h-2k d. Note that the anti-hla-a,b,c gave no staining, while the anti-h-2k d stained all the organs, demonstrating that human cells were not detected in the mouse organs. Representative images from 5 samples per organ from each group are shown. Scale bars = 200 μm.

21 Fig. S16. Detection of human tumor cells within mouse organs with quantitative polymerase chain reaction (PCR) of human Alu repetitive genomic DNA elements. The PCR was performed on the primary tumors and organs collected from the mice treated with PBS or irgd alone in the treatment studies shown in Fig. 2C (A) and Fig. 4C (B). The values were normalized to those obtained with a defined number of cultured 22Rv1 or BT474 cells to calculate the number of cells contained in each tissue (shown as cells per mg wet tissue weight). Statistical analyses with ANOVA demonstrated that none of the samples from irgd-treated mice showed values significantly different from those of the PBS-treated mice or tumor-free normal mice, indicating an absence of irgd-induced metastasis or dissemination of potentially metastatic cells. 22Rv1 mice, n = 4; BT474 mice, n = 3; normal mice, n = 3. Error bars, mean ± SEM.

22

23 Supplemental References 35. A. J. Primeau, A. Rendon, D. Hedley, L. Lilge, I. F. Tannock, Clin. Cancer Res. 11, 8782 (2005). 36. L. D. Mayer, G. Dougherty, T. O. Harasym, M. B. Bally, J. Pharmacol. Exp. Ther. 280, 1406 (1997). 37. D. H. Kass, M. A. Batzer, Anal. Biochem. 228, 185 (1995). Author Contribution K.N.S., T.T., and E.R. designed the experiments, K.N.S. and T.T. conducted the experiments, and K.N.S., T.T., and E.R. wrote the manuscript. P.P.K prepared ABX-conjugates and DOXliposomes and helped conducting the treatment studies. V.R.K. synthesized the peptides. L.A. prepared iron-oxide nanoworms. D.R.G. provided clinical input regarding tumor modeling and drug administration. E.R. supervised the research. K.N.S. and T.T. contributed equally to this work. All authors discussed the results and commented on the manuscript.