Supporting Online Material for
|
|
- Charity Miles
- 6 years ago
- Views:
Transcription
1 Supporting Online Material for Coadministration of a Tumor-Penetrating Peptide Enhances the Efficacy of Cancer Drugs Kazuki N. Sugahara, Tambet Teesalu, Priya Prakash Karmali, Venkata Ramana Kotamraju, Lilach Agemy, Daniel R. Greenwald, Erkki Ruoslahti* *To whom correspondence should be addressed. ruoslahti@burnham.org This PDF file includes: Materials and Methods SOM Text Figs. S1 to S16 Table S1 References Published 8 April 2010 on Science Express DOI: /science
2 Materials and Methods Preparation of compounds. Synthetic peptides (3, 6), inert G 7 phage and irgd phage (3, 6), FAM-labeled untargeted iron oxide nanoworms (16), and FAM-labeled and irgd-coated ABX (3, 19) were prepared as described. Free DOX was purchased from Sigma-Aldrich (St. Louis, MO). DOX-liposomes were composed of 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine and 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-n-[methoxy(polyethylene glycol)-2000] at 2:1.5:1.25:0.25 molar ratios. The lipids (Avanti Polar Lipids, Alabaster, AL) were dissolved in chloroform and the solvent was evaporated to a thin film with moisture free nitrogen gas. The dried lipid film was hydrated with 0.3 M ammonium phosphate buffer (ph 7.4) for 1 hour at 60 C. The mixture was then briefly vortexed and occasionally sonicated in a bath sonicator to form multilamellar vesicles. The vesicles were further sonicated using a Ti probe sonicator for 2-3 minutes until a translucent solution of small unilamellar vesicles was obtained. The vesicles were then sequentially extruded 11 times through polycarbonate membrane filters with pore diameters of 200 nm and 100 nm using an Avanti mini extruder (Avanti Polar Lipids). The buffer was then exchanged with Hepesbuffered saline (20 mm Hepes, 150 mm NaCl, ph 7.4) by gel filtration using NAP-10 or NAP-25 columns (GE Healthcare, Milwaukee, WI). DOX was encapsulated in these liposomes through a transmembrane phosphate gradient as described previously (13). The DOX-liposomes were 120 ± 8 nm in diameter (± indicates standard deviation) as measured by dynamic laser light scattering (refractive index, 1.59; viscosity, 0.89) on a Malvern Zetasizer Nano (Malvern, UK). Cells and tumor models. MIA PaCa-2 human pancreatic ductal cancer, 22Rv1, GFP-PC-3, and PPC-1 human prostate cancer, and 4T1 mouse breast cancer cell lines were cultured in Dulbecco s Modified Eagle Medium (DMEM) with 10% fetal bovine serum and penicillin/streptomycin. The BT474 human breast cancer cell line was cultured in SFM4MAB medium with 10% fetal bovine serum and penicillin/streptomycin (3). The MIA PaCa-2 and 22Rv1 xenografts were created by injecting athymic BALB/c nude mice (Harlan Sprague Dawley, Inc., Indianapolis, IN) orthotopically with 10 6 cells. PPC-1 subcutaneous tumors were created by injection of 10 6 cells into athymic BALB/c nude mice. For the 4T1 xenografts, 10 6 cells were injected orthotopically into BALB/c mice (Charles River, Wilmington, MA). For the BT474 xenografts, 17β-estradiol pellets (Innovative Research of America, Sarasota, FL) were implanted subcutaneously into the back of the mice one day prior to the orthotopic inoculation of 5 x 10 6 cells in matrigel (BD Biosciences, San Jose, CA). Disseminated GFP-PC-3 tumors were made by injecting 2 x 10 6 cells into the left ventricle of the heart. The disseminated nodules were detected under UV light with an Illumatool Bright Light System LT-9900 (Lightools Research, Encinitas, CA). Transgenic mice with de novo pancreatic ductal adenocarcinoma were kindly provided by Dr. Douglas Hanahan (University of California, San Francisco, CA). All animal experimentation was performed according to procedures approved by the Animal Research Committee at the University of California, Santa Barbara. In vivo systemic permeability assay. Tumor mice were injected intravenously with 100 ml of PBS containing either 1 mg of Evans Blue (MP Biomedicals, Irvine, CA), 200 nmol of fluorecein-labeled CRGDC peptide (FAM-CRGDC), 0.2 mg of fixable dextran (Molecular Probes, Eugene, OR), 10 9 plaque-forming units (pfu) of G 7 -expressing phage, 5 mg iron/kg of FAM-labeled iron-oxide nanoworms, 3 mg paclitaxel/kg FAM-ABX, 3 mg/kg of DOXliposomes, 10 mg/kg of free DOX, or 3 mg/kg of trastuzumab (Genentech, South San Francisco, CA), combined with 100 μl of PBS with or without irgd or control peptides. After the indicated time of circulation, the mice were perfused with PBS containing 1% BSA, and tissues were collected. For Evans Blue quantification, the dye was extracted from tissues in N,Ndimethylformamide for 24 hours at 37 C and quantified by measuring the absorbance at 600 nm
3 with a spectrophotometer (6). Tissues from mice that received FAM-CRGDC were imaged with the Illumatool Bright Light System LT-9900 before being processed for immunofluorescence and immunohistochemistry. Tissues with dextran, nanoworms, ABX, DOX-liposomes, free DOX, or trastuzumab were processed for either or both immunohistochemistry and immunofluorescence. The immunohistochemistry sections were scanned with a Scanscope CM-1 scanner, and positively stained areas were quantified with the ImageScope software (Aperio Technologies, Vista, CA) to calculate the % positive areas within the sections (3). To quantify the penetration distance, dynamic profiling of the immunofluorescence was performed with Image J (35). The fluorescence intensity of the compound was plotted relative to the distance from the closest CD31-positive vessel. The distance from the vessel where the fluorescence decreased to background levels was considered as the penetration distance. In vivo skin permeability assay was performed as described elsewhere (6). Immunofluorescence. Tissue preparation and staining of the cryosections were performed as described (3). The primary antibodies were rat anti-mouse CD31 (BD Biosciences), FITC-labeled HLA-A,B,C (BD Biosciences), and FITC-labeled H-2kd (BD Biosciences) monoclonal, and rabbit anti-t7 phage polyclonal (6) antibodies. The secondary antibodies, Alexa Fluor 594 goat anti-rat, 647 goat anti-rat, and 488 donkey anti-rabbit antibodies were from Molecular Probes. Immunohistochemistry. Tissue preparation and staining of the cryosections were performed as described (3). The primary antibodies used were biotinylated rabbit anti-fitc/oregon green polyclonal (Molecular Probes), and biotinylated mouse anti-dextran monoclonal (Stemcell Technologies, Vancouver, BC, Canada) and biotinylated rat anti-mouse CD31 monoclonal (BD Biosciences) andtibodies. Biotinylated secondary polycloncal antibodies were goat anti-rabbit and rabbit anti-human (both from Pierce Biotechnology, Rockford, IL). In some experiments, tissue sections were stained with a TUNEL assay kit (In Situ Cell Death Detection Kit, POD; Roche Applied Science, Indianapolis, IN), and quantified for the positive areas with a scanner as described elsewhere in this manuscript. Ex vivo tumor penetration assay. PPC-1 subcutaneous tumors (about 1 cm in diameter) were excised and placed in DMEM containing 1% BSA. The tumors were first incubated with the inhibitors or peptides for 20 min at 4 C. G 7 or irgd phage were then added to the solution and the tumors were further incubated for 90 min at 37 C or 4 C. The tumors were then washed with cold DMEM containing 1% BSA, fixed in 4% paraformaldehyde, sectioned, immunofluorescently stained, and viewed under a confocal microscope. Quantification of ABX in tumors and tissues was performed as described elsewhere (3). Tumor treatment with ABX. Nude mice bearing orthotopic 2-week-old xenografts of 22Rv1 (typically about 250 mm 3 ) or BT474 (about 100 mm 3 ) received every other day intravenous injections of ABX alone, ABX plus 4 μmol/kg irgd, irgd-coated ABX, or PBS. The dose of ABX in all groups was 3 mg paclitaxel/kg/injection. The mice were weighed every 4 days. After 24 days of treatment for mice with BT474 and 16 days for 22Rv1, the mice were perfused with PBS containing 1% BSA and tumors were harvested and weighed. The tumor volume was calculated using the following formula: volume (mm 3 ) = (d 2 x D)/2, where d is the smallest and D is the largest tumor diameters (3, 19). Quantification of DOX in tumors and normal tissues. The quantification was performed as described (36). Briefly, for DOX-liposomes, mice with 22Rv1 orthotopic tumors were injected intravenously with DOX-liposomes (5 mg/kg) with or without irgd (4 μmol/kg), or empty
4 liposomes. For free DOX, mice with 22Rv1 or 4T1 orthotopic tumors were intravenously injected with free DOX (10 mg/kg) with or without irgd (4 μmol/kg), or PBS. After 3 hours for DOXliposomes or 1 hour for free DOX, the mice were perfused with PBS containing 1% BSA, and the tumors and organs were collected. To determine the concentration of DOX in the tissues, the tissues were homogenized in 1% sodium dodecyl sulfate and 1 mm H 2 SO 4 in water. Then, DOX was extracted by adding 2 ml of chloroform/isopropyl alcohol (1:1, v/v) to the homogenized samples, followed by vortexing and freeze/thaw cycles. The samples were centrifuged at 14,000 x g for 15 minutes and OD490nm of the organic phase (lowest phase) was measured. Tumor treatment with DOX or DOX-liposomes. Mice bearing 2-week old orthotopic xenografts of 22Rv1 or orthotopic 4T1 (about 100 mm 3 ) received intravenous injections of free DOX (1 or 3 mg/kg) or PBS, combined with irgd (4 μmol/kg) or PBS every other day. Mice bearing 2 week-old 22Rv1 orthotopic tumors received daily intravenous injections of DOXliposomes (1 or 3 mg/kg) or PBS, combined with 2 mmol/kg irgd, cyclo(-rgdfk-), or PBS. The mice were weighed every 3-4 days. After 24 days of treatment with DOX for 22RV1 and 12 days for BT474, and 17 days of treatment with DOX-liposomes for 22Rv1, the mice were perfused through the heart with PBS containing 1% BSA and tumors and hearts were harvested, weighed, and processed for histology. Competitive ELISA for quantification of trastuzumab. Tissues from BT474 tumor mice that received trastuzumab injections were homogenized in 1 ml of 0.1 M Glycine ph2 with 1% Tween-20 and protease inhibitors (Complete Mini EDTA-free; Roche Applied Science) followed by a centrifugation (4 C, 10 min, 14,000 rpm). Six hundred microliters of supernatant was collected, and added with 150 μl of 1 M Tris ph8 and 22.5 μl of 5 M NaCl to neutralize the ph. Microtiter wells coated with 5 mg/ml rabbit anti-human IgG (SouthernBiotech, Birmingham, AL) were incubated with the tissue extracts and 1 μg/ml of biotinylated human IgG (Rockland Immunochemicals, Gilbertsville, PA). After 2 hours of incubation at room temperature, the wells were washed with PBS containing 0.01% Tween 20, added with streptavidin-conjugated horseradish peroxidase, and incubated for 30 minutes at room temperature. The amount of biotinylated human IgG captured on the microtiter wells was quantified with 2,2-azino-bis(3- etylbenzthiazoline-6-sulfonic acid) as a substrate and the absorbance at 405 nm was measured. To obtain standard curves, the tissue extracts were substituted with various concentrations of trastuzumab (ranging from 0.01 to 10 μg/ml) in the ELISA. BT474 xenograft treatment with trastuzumab. Mice bearing BT474 orthotopic tumors (about 100 mm 3 ) were injected intravenously every 4 days with trastuzumab at 3 mg/kg for the first injection at day 21 after tumor cell inoculation (= day 0 in Fig. 4C) and 1.5 mg/kg for subsequent injections as a maintenance dose. The treatment was combined with daily injections of 4 μmol/kg irgd in PBS or PBS on the days of trastuzumab injections, and 2 μmol/kg irgd or PBS on the other days. In some groups, trastuzumab of 3-times higher dose than in the irgd combination regimen was used. After 24 days of treatment, the mice were perfused and tissues were harvested. Quantification of human tumor cell DNA by polymerase chain reaction (PCR). Quantitative PCR of human Alu repetitive genomic DNA elements was performed as described (26, 37). Primers (Alu 3-5'GATCGCGCCACTGCACTCC3' and Alu 5-5'GGATTACAGGCGTGAGCCAC3') at 2 μm were included in Power SYBR Mastermix (Applied Biosystems, Foster City, CA), and quantitative PCR and melting curve analysis were performed with a BioRad i-cycler IQ real-time detection system. The PCR conditions were; initial denaturation (12 min, 95 C); 40 amplification cycles of denaturation (20 sec, 95 C), annealing (1 min, 56 C), and extension (1 min, 72 C). Genomic DNA was extracted from cultured cells and
5 tissue samples using DNeasy blood and tissue kit (Qiagen, Valencia, CA). Specificity of PCR for human cells was verified by the lack of DNA amplification using DNA extracted from mouse 4T1 cells and organs from normal mice. The values were normalized to those obtained with a defined number of cultured 22Rv1 or BT474 cells to calculate the number of cells contained in each tissue (cells per mg wet weight). Statistical analysis. Data were analyzed by two-tailed Student s t-test or one-way analysis of variance (ANOVA) followed by suitable post-hoc test. The results are summarized in table S1.
6 Fig. S1. Tumor-specific entry of Evans Blue into extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic MIA PaCa-2 human pancreatic carcinoma xenografts were intravenously injected with 1 mg of Evans Blue, followed 5 minutes later by 4 μmol/kg of irgd or control peptides in PBS, or PBS alone. Tissues were collected 30 minutes later. (A) Evans Blue accumulation in tissues of mice injected with irgd (main panel) and the tumor of a PBSinjected mouse (inset). Note the blue color in the primary tumor and a tumor that invaded the left kidney (arrowheads) of the irgd-injected mouse. T, tumor; P, pancreas; S, spleen. (B to D) Quantification of Evans Blue in the tissues. In (B), different amounts of irgd were injected. In (C), the effect of irgd was compared with that of non-cendr RGD peptides. In (D), 50 μg of an anti-nrp-1 antibody or a control IgG was injected before irgd. Statistical analyses were done with ANOVA. n = 3; Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p <
7 Fig. S2. Tumor-specific entry of Evans Blue into extravascular tumor tissue in various tumor models. Experiments were performed as in fig. S1. (A) Macroscopic appearance of orthotopic xenografts of BT474 human breast and 22Rv1 human prostate cancer, and genetically engineered de novo mouse pancreatic ductal adenocarcinoma (PDAC). (B) Macroscopic appearance of GFP- PC-3 disseminated tumors generated by intracardiac injection of the tumor cells and normal tissues. Note the blue color in the tumors from mice that received both the dye and irgd, including many of the small nodules in the GFP-PC-3 disseminated tumor model (arrowheads). The green fluorescent signals in the right panels show the location of the tumor nodules. (C) Quantification of Evans Blue in jaw tumors of the GFP-PC-3 disseminated tumor model. Note the tumor-specific accumulation of the dye when it was co-injected with irgd, but not with non- CendR RGD peptides or PBS only. Statistical analysis was performed with Student s t-test. Error bars, mean ± SEM; **p < 0.01; n = 3.
8 Fig. S3. The CendR element of irgd (CRGDK) induces local vascular permeabilization in the skin. A modified Miles assay was (6) carried out as follows: Mice were intravenously injected with 150 μl of PBS containing a mixture of 0.5% Evans Blue, 13 μg of Quantilum recombinant luciferase, and 10 9 pfu of non-targeted phage particles. Ten minutes later, the mice received intradermal injections of chemically synthesized CRGDK peptide in 30 μl of PBS or PBS alone. After 30 minutes, skin samples were collected with a 4 mm puncher. Luciferase activity and phage titer were measured to quantify the presence of the iintravenously injected compounds at the intradermal injection sites. The CRGDK values were normalized to samples PBS injection sites. Statistical analyses were performed with ANOVA. Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p < 0.001; n = 3.
9 Fig. S4. The irgd combination delivery system. Intravenously injected irgd peptide penetrates tumor tissue in a 3-step process (right panel) (3); (i) irgd recognizes the αv integrins on tumor blood vessel endothelial cells with the RGD motif, (ii) the peptide is then proteolytically processed to expose the cryptic CendR element, RGDK/R, at the C-terminus (yellow arrow), and the disulfide bond breaks (yellow line), (iii) the CendR element mediates binding to NRP-1, which induces vascular and tissue permeabilization. In the conventional conjugated delivery approach, the cargo (e.g. a drug, or diagnostic compound) is chemically attached to the N- terminal cysteine ( C in red, right panel). In the combination delivery method, the cargo is coadministered with the free peptide. The cargo gains access to the extravascular tumor parenchyma because irgd activates a bulk transport system in the tumor that mediates extravasation, tissue penetration, and internalization into cells.
10 Fig. S5. Accumulation of molecules within extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic 22Rv1 tumors were injected with 200 nmol of fluorescein-labeled CRGDC peptide (FAM-CRGDC), or 0.2 mg of Texas red-labeled 3 kda or 10 kda dextran, followed 5 minutes later, by 4 μmol/kg of irgd peptide in PBS or PBS alone. Tissues were collected 2 hours later for the FAM-CRGDC, and 30 minutes later for the dextrans. (A) Confocal images of the tumors. For FAM-CRGDC, images taken under UV light are also shown (left most panels). The dotted lines indicate the tissue outlines. Phage were detected with an anti-t7 phage antibody. Some images were pseudocolored as shown in the panels. Scale bars = 100 μm. n = 3. (B) Quantification of positive areas for FAM-CRGDC and dextrans in the tumor sections. Cryosections were stained immunohistochemically with an anti-fitc (for FAM-CRGDC) or an anti-dextran (for dextrans), scanned with Scanscope, and analyzed with the ImageScope software. n = 3. (C) Penetration distance of the compounds from the closest CD31-positive blood vessel (35). The distance to 10 blood vessels was measured and 3 images per group were analyzed with Image J. Statistical analyses were performed with Student s t-test. Error bars, mean ± SEM; *p < 0.05; **p < 0.01; ***p <
11 Fig. S6. Accumulation of nanoparticles within extravascular tumor tissue in irgd-injected mice. Mice bearing orthotopic 22Rv1 tumors were injected with 5 mg iron/kg of fluorescein-labeled iron-oxide nanoworms, or 10 9 plaque forming units (pfu) of non-targeted phage, followed 5 minutes later by 4 μmol/kg of irgd peptide in PBS or PBS alone. Tissues were collected 2 hours later for the nanoworms, and 30 minutes later for the phage. (A) Immunofluorescence of the tumors. Phage were detected with an anti-t7 phage antibody. Scale bars = 100 μm. (B) Quantification of phage accumulated in the tissues based on phage titer. Statistical analysis was performed with Student s t-test. Error bars, mean ± SEM; *p < 0.05; n = 3.
12 Fig. S7. irgd-mediated ex vivo tumor penetration by T7 phage. Subcutaneous PPC-1 human prostate cancer xenografts were excised and maintained in short-term culture containing 10 9 pfu/ml of phage expressing irgd peptides (irgd phage) or control phage expressing G 7 peptides (G 7 phage). Sodium azide concentration was 10 mm, the anti-nrp-1 antibody and control goat IgG were used at 15 μg/ml, and the irgd and control peptide were 20 μm. The tumors were first incubated with the inhibitors or free peptides for 20 min at 4 C. The indicated phage samples were then added to the solution and the tumors were further incubated for 90 min at 37 C (4 C where indicated). After the incubation, tumors were washed, fixed, and sectioned. The sections were stained with an anti-t7 phage antibody (green), an anti-cd31 antibody (red), and DAPI (blue), and viewed with a confocal microscope. The dotted lines indicate the edge of the tumor (T). Note that the irgd phage has penetrated deep into the tumor, and that sodium azide, low incubation temperature, and the anti-nrp-1 antibody inhibited the penetration. G 7 phage penetrated into the tumor tissue when co-incubated with irgd peptide, but not with a non- CendR RGD peptide, RGD-4C. Scale bar = 200 μm; n = 3.
13 Fig. S8. In vivo tumor homing of nab-paclitaxel (Abraxane; ABX). Confocal microscopy images of BT474 orthotopic tumors from mice injected with ABX alone, ABX conjugated with irgd, ABX combined with 4 μmol/kg of irgd at 3 mg paclitaxel/kg. The particles were allowed to circulate for 3 hours. The ABX particles were fluorescently labeled. Representative confocal images from three tumors for each conjugate are shown. Scale bars = 100 μm.
14 Fig. S9. Body weight of tumor mice treated with irgd, and free DOX or DOX-liposomes. The mice in the treatment study shown in Fig. 2C (A), fig. S10C (B), and Fig. 3A (C) were weighed during the study. The percent body weight shift is shown. Statistical analyses were performed with ANOVA. Error bars, mean ± SEM; n.s., not significant; ***p <
15 Fig. S10. Enhanced anti-tumor effect of free DOX co-injected with irgd in an orthotopic 4T1 mouse breast cancer model. (A and B) The 4T1 tumor mice were intravenously injected with DOX (10 mg/kg) and 4 μmol/kg of irgd or PBS. Tissues were collected 1 hour later. n = 3. In (A), the tumors were sectioned and stained with anti-cd31. Scale bars = 100 μm. In (B), DOX in the tissues was quantified. (C) The 4T1 tumor mice received every other day intravenous injections of DOX (1 or 3 mg/kg) or PBS, with 4 μmol/kg of irgd or PBS. n = 8, except for the irgd combination groups (n = 9). (D) TUNEL staining was performed on tumor and heart samples from the treatment study, and quantified for positive staining. Statistical analyses were performed with Student s t-test in (B), and ANOVA in (C) and (D). Error bars, mean ± SEM; n.s., not significant; **p < 0.01; ***p <
16 Fig. S11. Enhanced tumor penetration of DOX-liposomes co-injected with irgd. Orthotopic 22Rv1 tumor mice were intravenously injected with DOX-liposomes (5 mg/kg) followed by 4 μmol/kg of irgd or PBS. Tumors were collected 3 hours later, sectioned, stained with an anti- CD31 antibody, and observed with a confocal microscope. The native fluorescence was used to detect DOX. Representative images from three independent tumors per compound are shown. Scale bars = 200 μm.
17 Fig. S12. Localization of DOX within tumor tissue after long-term treatment with the irgd combination regimen. Tumors collected after the treatment studies in Fig. 2C (A, left panels), fig. S10C (A, right panels), and Fig. 3A (B) were fixed, sectioned, stained for CD31, and examined under a confocal microscope. The native fluorescence was used to detect DOX. Note the wide distribution of DOX after treatment with the irgd combination regimen. Representative images from 5 tumors in each group are shown. Scale bars = 100 μm.
18 Fig. S13. Localization of trastuzumab within tumor tissue after treatment with the irgd combination regimen. Tumors collected at the conclusion of the treatment study in Fig. 4C were fixed and sectioned. (A) The tumor sections were immunohistochemically stained with an antihuman IgG antibody to detect trastuzumab and double stained with hematoxylin. Note the homogeneous distribution of trastuzumab in the tumors treated with the irgd combo regimen. In contrast, the tumors treated with trastuzumab alone showed heterogeneous signals, indicating inefficient tissue penetration of the drug. Scale bars = 200 μm. (B) The slides were scanned with Scanscope and analyzed with the ImageScope software to quantify trastuzumab positive areas. Statistical analysis was performed with ANOVA. Error bars, mean ± SEM; **p < 0.01; ***p < 0.001; n = 4.
19 Fig. S14. Detection of human tumor cells within mouse organs using antibodies against major histocompatibility complex (MHC) class I antigens. MHC class I is expressed on most nucleated cells and are antigenically species-specific (25). (A) Orthotopic 22Rv1 human prostate cancer xenografts were stained with an anti-hla-a,b,c (human MHC class I) and an anti-h-2k d (BALB/c mouse MHC class I). Note that the anti-hla-a,b,c detected the tumor parenchyma, while the H-2k d only detected host (mouse)-derived tumor vessels (arrows). (B) Cryosections of a panel of organs from the mice that received PBS or irgd alone in the treatment studies shown in Figs. 2C and 3A were stained with the anti-hla-a,b,c or the anti-h-2k d. Note that the anti- HLA-A,B,C gave no staining, while the anti-h-2k d stained all the organs, showing that human cells were not detectable in the mouse organs. Representative images from 5 samples per organ from each group in the two treatment studies are shown. Scale bars = 200 μm.
20 Fig. S15. Detection of human tumor cells within mouse organs using antibodies against major histocompatibility complex (MHC) class I antigens. Cryosections of a panel of organs from the mice that received PBS or irgd alone in the BT474 breast carcinoma treatment study shown in Fig. 4C were stained with an anti-hla-a,b,c or an anti-h-2k d. Note that the anti-hla-a,b,c gave no staining, while the anti-h-2k d stained all the organs, demonstrating that human cells were not detected in the mouse organs. Representative images from 5 samples per organ from each group are shown. Scale bars = 200 μm.
21 Fig. S16. Detection of human tumor cells within mouse organs with quantitative polymerase chain reaction (PCR) of human Alu repetitive genomic DNA elements. The PCR was performed on the primary tumors and organs collected from the mice treated with PBS or irgd alone in the treatment studies shown in Fig. 2C (A) and Fig. 4C (B). The values were normalized to those obtained with a defined number of cultured 22Rv1 or BT474 cells to calculate the number of cells contained in each tissue (shown as cells per mg wet tissue weight). Statistical analyses with ANOVA demonstrated that none of the samples from irgd-treated mice showed values significantly different from those of the PBS-treated mice or tumor-free normal mice, indicating an absence of irgd-induced metastasis or dissemination of potentially metastatic cells. 22Rv1 mice, n = 4; BT474 mice, n = 3; normal mice, n = 3. Error bars, mean ± SEM.
22
23 Supplemental References 35. A. J. Primeau, A. Rendon, D. Hedley, L. Lilge, I. F. Tannock, Clin. Cancer Res. 11, 8782 (2005). 36. L. D. Mayer, G. Dougherty, T. O. Harasym, M. B. Bally, J. Pharmacol. Exp. Ther. 280, 1406 (1997). 37. D. H. Kass, M. A. Batzer, Anal. Biochem. 228, 185 (1995). Author Contribution K.N.S., T.T., and E.R. designed the experiments, K.N.S. and T.T. conducted the experiments, and K.N.S., T.T., and E.R. wrote the manuscript. P.P.K prepared ABX-conjugates and DOXliposomes and helped conducting the treatment studies. V.R.K. synthesized the peptides. L.A. prepared iron-oxide nanoworms. D.R.G. provided clinical input regarding tumor modeling and drug administration. E.R. supervised the research. K.N.S. and T.T. contributed equally to this work. All authors discussed the results and commented on the manuscript.
Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde
Supplementary text Supplementary materials and methods Histopathological examination Segments of the obstructed intestinal loops were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin wax with
More informationBeta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand
SUPPLEMENTAL FIGURES Beta3 integrin promotes long-lasting activation and polarization of Vascular Endothelial Growth Factor Receptor 2 by immobilized ligand C. Ravelli et al. FIGURE S. I Figure S. I: Gremlin
More information64 CuCl 2 in 50 µl 0.1N NaOAc buffer, and 20 µg of each DOTA-antibody conjugate in 40 µl
Number of DOTA per antibody The average number of DOTA chelators per antibody was measured using a reported procedure with modifications (1,2). Briefly, nonradioactive CuCl 2 (80-fold excess of DOTA antibodies)
More informationSensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric*
Catalog # Kit Size SensoLyte Anti-alpha-Synuclein Quantitative ELISA Kit (Human/Mouse/Rat) *Colorimetric* AS-55550 One 96-well strip plate This kit is optimized to detect human/mouse/rat alpha-synuclein
More informationHypoxyprobe Plus Kit
Updated 2017 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Plus Kit (HPI Part # HP2-XXX) Kit contents: Solid pimonidazole HCl (Hypoxyprobe
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupporting Information
Supporting Information Agemy et al. 10.1073/pnas.1114518108 SI Methods Cell Lines and Tumors. HUVEC (Lonza) were cultured using EBM- 2 medium with endothelial cell growth supplement (Lonza). Human astrocytoma
More informationThis Document Contains:
This Document Contains: 1. In-Cell Western Protocol II. Cell Seeding and Stimulation Supplemental Protocol III. Complete Assay Example: Detailing the Seeding, Stimulation and Detection of the A431 Cellular
More informationHuman IgG Antigen ELISA Kit
Human IgG Antigen ELISA Kit Catalog No: IHUIGGKT Lot No: SAMPLE INTENDED USE This human immunoglobulin G antigen assay is intended for the quantitative determination of total human IgG antigen in serum,
More informationBoLISA BoNT Sandwich ELISA Protocol
BoLISA BoNT Sandwich ELISA Protocol 55 S. Rosa Road, Suite 5 Madison, WI 5379-68-44-874 info@biosentinelpharma.com BioSentinel Part No: L7, Release Date: May, 7 BoLISA A BoNT/A Sandwich ELISA Detection
More informationMouse ICAM-1 / CD54 ELISA Pair Set
Mouse ICAM-1 / CD54 ELISA Pair Set Catalog Number : SEK50440 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the General
More informationMouse Factor XII Total ELISA Kit
Mouse Factor XII Total ELISA Kit Catalog No: IMFXIIKT-TOT Lot No: SAMPLE INTENDED USE This mouse coagulation Factor XII antigen assay is intended for the quantitative determination of total Factor XII
More informationWesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits
WesternMAX Alkaline Phosphatase Chemiluminescent Detection Kits Code N221-KIT N220-KIT Description WesternMAX Chemiluminescent AP Kit, Anti-Mouse Includes: Alkaline Phosphatase (AP) Conjugated Anti-Mouse
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationHuman Granulin / GRN / Progranulin ELISA Pair Set
Human Granulin / GRN / Progranulin ELISA Pair Set Catalog Number : SEKA10826 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationph-responsive gold nanoparticles-in-liposome hybrid nanostructures for
Electronic Supplementary Information ph-responsive gold nanoparticles-in-liposome hybrid nanostructures for enhanced systemic tumor delivery Jutaek Nam, a Yeong Su Ha, b Sekyu Hwang, a Woonghee Lee, b
More informationGoat Anti Rabbit IgG Antibodies
Goat Anti Rabbit IgG Antibodies Table 1. Contents and storage information. Material Amount Concentration Storage Upon Receipt Stability Whole antibodies 0.5 ml F(ab ) 2 fragments 250 µl 2 mg/ml in 0.1
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationAnaTag HiLyte Fluor 647 Protein Labeling Kit
AnaTag HiLyte Fluor 647 Protein Labeling Kit Catalog # 72049 Kit Size 3 Conjugation Reactions This kit is optimized to conjugate HiLyte Fluor 647 SE to proteins (e.g., IgG). It provides ample materials
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationProduct Information. Before you begin. Component A 1 vial of 30 ul vial of 300 ul each Glycerol. Tris
Glowing Products for Science Mix-n-Stain Antibody Labeling Kits Size: 1 labeling per kit Storage: -20 o C Stability: Stable for at least 1 year from date of receipt when stored as recommended. Components:
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationHuman Plasmin Activity Assay ELISA Kit
Human Plasmin Activity Assay ELISA Kit Catalog No. CSI12527A 1 x 96 tests CSI12527B 5 x 96 tests Intended Use: Background: Assay Principle: Reagents Provided: This human plasmin activity assay is for the
More informationLAMININ. For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7
LAMININ For Immunohistochemical Demonstration of Laminin in Paraffin-embedded and Frozen Human Tissue Sections Stock No. IMMH-7 TABLE OF CONTENTS BACKGROUND AND PRINCIPLE... 4 REAGENTS AND EQUIPMENT PROVIDED...
More informationSTANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA)
STANDARD OPERATIONS PROCEDURES FOR THE COMMON FUND: PROTEIN CAPTURE REAGENTS PROGRAM (ELISA) 1. PURPOSE This procedure is to be used for the characterization of purified monoclonal antibody. 2. SCOPE This
More informationSupplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
More informationPorcine IL-12/IL-23 p40 ELISA kit
Porcine IL-12/IL-23 p40 ELISA kit Catalog number: NB-E50014 (96 wells) The kit is designed to quantitatively detect the levels of Porcine IL-12/IL-23 p40 in cell culture supernatants. FOR RESEARCH USE
More informationTranstumoral targeting enabled by a novel neuropilin-binding peptide
(2012) 31, 3754 3763 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc ORIGINAL ARTICLE Transtumoral targeting enabled by a novel neuropilin-binding peptide L Roth
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationCharacterizing Phenotypes of Bacteria by Staining Method
Experiment 3 Laboratory to Biology III Diversity of Microorganisms / Wintersemester / page 1 Experiment Characterizing Phenotypes of Bacteria by Staining Method Advisor Reading NN Chapters 3.1, 3.7, 3.8,
More informationDetection and identification of body fluid stains using antibodynanoparticle
Electronic Supplementary Information Detection and identification of body fluid stains using antibodynanoparticle conjugates Nunzianda Frascione,* a Richard Thorogate a, Barbara Daniel a and Sue Jickells
More informationHEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
More informationMultiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP
Page 1 of 7 INSTRUCTIONS: Z-310 Multiplex Fluorescent Western Blot Starter Kit for the Bio- Rad ChemiDoc MP Rockland Immunochemicals and Bio-Rad Laboratories have jointly developed an easy to use multiplex
More informationApplication Note AN001
Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3
More informationMitoBiogenesis In-Cell ELISA Kit (Colorimetric)
PROTOCOL MitoBiogenesis In-Cell ELISA Kit (Colorimetric) DESCRIPTION 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS643 Rev.2 For identifying inhibitors and activators of mitochondrial biogenesis
More informationEdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
More informationHuman IL-10 ELISA MAX Set Deluxe
Human IL-10 ELISA MAX Set Deluxe Cat. No. 430604 (5 plates) 430605 (10 plates) 430606 (20 plates) ELISA Set for Accurate Cytokine Quantification from Cell Culture Supernatant, Serum, Plasma or Other Body
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/477/dc1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler,
More informationMeDIP-seq library construction protocol v2 Costello Lab June Notes:
MeDIP-seq library construction protocol v2 Costello Lab June 2010 Notes: A. For all Qiagen gel extraction steps (Qiaquick and MinElute), melt gel slice at 37º C instead of 50º (see Quail et al 2008 Nature
More informationSupplement Figure 1. Characterization of the moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to
Supplement Figure 1. Characterization of the 312.8 moab. (A) A series of moabs that are anti-hαiib-specific were tested for their ability to bind to platelets. The black line represents the 312.8 moab
More informationab Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit
ab128967 - Mouse and Rabbit AP/Fast-Red (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use only
More informationSupplementary Materials
Supplementary Materials irgd-mediated Transcytosis of an Irinotecan Silicasome Carrier in Pancreatic Cancer Xiangsheng Liu 1, Paulina Lin 1, Ian Perrett 1, Joshua Lin 1, Yu-Pei Liao 1, Chong Hyun Chang
More informationWhole Mount IHC Protocol
Whole Mount IHC Protocol Authors: Ruth Sullivan, Ryan Trevena and Kyle Wegner Creation Date: 03/17/2016 All steps should be conducted with gentle agitation on an orbital shaker, unless otherwise instructed.
More informationSUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
More informationRat α-melanocyte stimulating hormone (α-msh) ELISA Kit
Rat α-melanocyte stimulating hormone (α-msh) ELISA Kit For the quantitative determination of rat α-melanocyte stimulating hormone (α-msh) concentrations in serum, plasma, tissue homogenates. This package
More informationMouse IGF-1 ELISA Kit
GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: sales@genwaybio.com http://www.genwaybio.com Mouse IGF-1 ELISA Kit Catalog No GWB-ZZD063 Size
More informationEZ-10 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK
EZ-0 SPIN COLUMN GENOMIC DNA MINIPREPS KIT HANDBOOK (Bacteria, Plant, Animal, Blood) Version 8 Rev 05/0/03 EZ-0 Genomic DNA Kit Handbook Table of Contents Introduction Limitations of Use Features Applications
More informationReviewed: Hamilton. Contents; Overview. 2.0 Methods 3.0 Notes 4.0 Acknowledgements & References
Microarray Core UCSF Comprehensive Cancer Center Standard Operating Procedure Title: Array CGH Hybridization Protocol HumArray 3.2 SOP No.: MC023QA Version: 5 Date: 5-12-06 Page No.: 1 of 5 Authors: Albertson,
More informationSupporting information. Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo
Supporting information Single-cell and subcellular pharmacokinetic imaging allows insight into drug action in vivo Greg Thurber 1, Katy Yang 1, Thomas Reiner 1, Rainer Kohler 1, Peter Sorger 2, Tim Mitchison
More informationEnumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry
Enumeration, Phenotyping, and Identification of Activation Events in Conjugates Between T Cells and Antigen-Presenting Cells by Flow Cytometry Kristie M. Grebe and Terry A. Potter* (Published 10 September
More informationIn Vitro Diagnostic Products
In Vitro Diagnostic Products Rely on Rockland for Unparalleled Quality Diagnostic: Overview For over 50 years Rockland has provided a dedicated portfolio of general purpose reagents (GPR) used to collect,
More informationProductInformation. Genomic DNA Isolation Kit. Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN
Genomic DNA Isolation Kit Product No. GDI-3 Technical Bulletin No. MB-275 May 2000 TECHNICAL BULLETIN ProductInformation Product Description Sigma s Genomic DNA Isolation Kit isolates genomic DNA from
More informationAssayMax Human Transferrin ELISA Kit
AssayMax Human Transferrin ELISA Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting or performing
More informationContaminant bovine transferrin assay
ILA Application Note Contaminant bovine transferrin assay INTRODUCTION Bovine transferrin, a 76, Dalton glycoprotein, is one of the constituents of bovine serum. Transferrin found in serum can be associated
More informationPROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon
PROTOCOL Complex I Enzyme Activity Dipstick Assay Kit 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MS130 Rev.3 DESCRIPTION Complex I Enzyme Activity Dipstick Assay Kit Sufficient materials are provided
More informationDNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue
INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic
More informationAnti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase. Product no: C2-HRP
Anti-Asian Sea bass (Lates calcarifer) IgM monoclonal antibody labelled with horseradish peroxidase Product no: C2-HRP Product Description This monoclonal antibody (Mab) reacts with Asian Sea bass (Lates
More informationSupplementary Materials for. Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer
Supplementary Materials for Combinatory screening of DNA aptamers for molecular imaging of HER2 in cancer Guizhi Zhu, Huimin Zhang,, Orit Jacobson, Zhantong Wang, Haojun Chen,, Xiangyu Yang, ǁ, Gang Niu,
More informationSee external label 2 C-8 C Σ=96 tests Cat # 5201Z CARCINOEMBRYONIC ANTIGEN (CEA) ENZYME IMMUNOASSAYTEST KIT CEA ELISA. Cat # 5201Z
DIAGNOSTIC AUTOMATION, INC. 23961 Craftsman Road, Suite D/E/F, Calabasas, CA 91302 Tel: (818) 591-3030 Fax: (818) 591-8383 onestep@rapidtest.com technicalsupport@rapidtest.com www.rapidtest.com See external
More informationHuman IgG ELISA Kit. Strip well format. Reagents for up to 96 tests
Human IgG ELISA Kit Strip well format. Reagents for up to 96 tests Catalog No. CS222A Quantity: 1 x 96 tests CS222B 5 x 96 tests Intended Use: Background: Assay Principle: This human immunoglobulin G antigen
More informationPurification Kits. Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET
 Montage Antibody Purification Kits Fast and Convenient PROSEP -A and PROSEP-G Spin Column Kits for Antibody Purification DATA SHEET Available with immobilized Protein A or Protein G Easy-to-use Antibody
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationRetinol Binding Protein Urinary EIA Kit
K-ASSAY KAMIYA BIOMEDICAL COMPANY KAMIYA BIOMEDICAL COMPANY Retinol Binding Protein Urinary EIA Kit For the quantitative determination of RBP in human, rat, dog and rhesus monkey urine Cat. No. KT-744
More informationContaminant human transferrin assay
ILA Application Note Contaminant human transferrin assay INTRODUCTION Human transferrin is an 8, Dalton glycoprotein found in human serum that facilitates transport of iron between cells. The iron-poor
More informationReagents and cell culture Mcl-1 gene expression: real-time quantitative RT-PCR In vitro PP2A phosphatase assay Detection of Mcl-1 in vivo
Reagents and cell culture Antibodies specific for caspase 3, PARP and GAPDH were purchased from Cell Signaling Technology Inc. (Beverly, MA). Caspase inhibitor z-vad-fmk and ROS scavenger N-acetyl-Lcysteine
More informationBrdU IHC Kit. For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells
K-ASSAY BrdU IHC Kit For the detection and localization of bromodeoxyuridine incorporated into newly synthesized DNA of actively proliferating cells Cat. No. KT-077 For Research Use Only. Not for Use in
More information*Corresponding author. Tel: ;
1 SUPPLEMENTARY DATA 2 3 4 5 6 7 8 9 10 11 Integrin 2 1 in nonactivated conformation can induce focal adhesion kinase signaling Maria Salmela 1, Johanna Jokinen 1,2, Silja Tiitta 1, Pekka Rappu 1, Holland
More informationUpdated April 27, PRODUCT INSERT
Updated April 27, 2009 1 PRODUCT INSERT Hypoxyprobe, Inc. 121 Middlesex Turnpike Burlington, MA 01803 USA www.hypoxyprobe.com Hypoxyprobe Gemini Kit Kit Contents: Solid pimonidazole HCl (Hypoxyprobe -1)
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationElecrtonic Supplementary Information. Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays
Elecrtonic Supplementary Information Application of quantum dot barcodes prepared using biological self-assembly to multiplexed immunoassays Sakandar Rauf, Andrew Glidle and Jonathan M Cooper Department
More informationA Bridging Immunogenicity Assay Using SPARCL TM Technology
A Bridging Immunogenicity Assay Using SPARCL TM Technology Wenhua F. Xie Lumigen Inc., a Beckman Coulter Company INTRODUCTION Evaluating the immune response in patients is an important aspect associated
More informationHuman IgE ELISA Antibody Pair Kit
For detection and measurement of human immunoglobulin E Catalog #01993 1 Kit for 6 Plates Product Description The Human Immunoglobulin E (IgE) ELISA Antibody Pair Kit is for customers who want the flexibility
More informationTHE INSTITUTE FOR GENOMIC RESEARCH Standard Operating Procedure SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03
Standard Operating Procedure PAGE: 1 of 8 SOP #: M004 REVISION LEVEL:.3 EFFECTIVE DATE: 9/16/03 AUTHOR: Jeremy Hasseman PRIMARY REVIEWERS: Renee Gaspard, Bryan Frank 1. PURPOSE This protocol describes
More informationPROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%)
1 AFFINITY HIS-TAG PURIFICATION PROCEDURE FOR USE NICKEL NTA Magnetic Agarose Beads (5%) DESCRIPTION Nickel NTA Magnetic Agarose Beads are products that allow rapid and easy small-scale purification of
More informationAntibody Purification Guide
Guide Innova Biosciences Guide Innova Biosciences Ltd. Babraham Research Campus, Cambridge, UK, CB22 3AT +44 (0)1223 661000 info@innovabiosciences.com Guide 2 Innova Biosciences specializes in easy to
More informationCombined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections)
Combined Digoxigenin-labeled in situ hybridization/ Immunohistochemistry protocol (for fixed frozen cryostat sections) A. Digoxigenin-UTP labeling of crna antisense probe Refer to laboratory protocol and
More informationtel: IRON OXIDE-BASED SUPERPARAMAGNETIC CONTRAST AGENTS
tel:4006551678 email: fige007@163.com IRON OXIDE-BASED SUPERPARAMAGNETIC CONTRAST AGENTS Molday ION TM product line is a family of iron oxide-based superparamagnetic contrast reagents designed to label
More informationNature Medicine: doi: /nm.4464
Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters
More informationUV-Induced DNA Damage ELISA (CPD Quantitation)
KAMIYA BIOMEDICAL COMPANY UV-Induced DNA Damage ELISA (CPD Quantitation) For the rapid detection and quantitation of CPD in any DNA samples Cat. No. KT-914 For Research Use Only. Not for use in diagnostic
More informationIn vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay. Josephine MY Ko and Maria Li Lung *
In vitro Human Umbilical Vein Endothelial Cells (HUVEC) Tube-formation Assay Josephine MY Ko and Maria Li Lung * Clinical Oncology Department, The Univerisity of Hong Kong, Hong Kong, Hong Kong SAR *For
More informationPolyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
More informationphab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation
phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationab Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit
ab64264 - Mouse and Rabbit Specific HRP/DAB (ABC) Detection IHC Kit Instructions for Use For the detection of a specific antibody bound to an antigen in tissue sections. This product is for research use
More information**MATERIAL SAFETY DATA SHEET**
Date Issued: August 19, 2009 Version: 5.0 Supersedes: August 8, 2006 Page 1 of 5 Section 1 Product and Company Identification Product Name: Herceptin Chemical Name: Anti-p185 HER2 Chemical Family: High
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationHuman IL10RB ELISA Pair Set ( CRFB4 )
Human IL10RB ELISA Pair Set ( CRFB4 ) Catalog Number : SEK10945 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized in the
More informationNAG-1 (GDF-15, MIC-1) Prostate Cancer ELISA kit
NAG-1 (GDF-15, MIC-1) Prostate Cancer ELISA kit Catalog Number: NG1 Store at -0 C. FOR RESEARCH USE ONLY v. 1081 Introduction This sandwich ELISA kit is for determination of NAG-1 (GDF-15, MIC-1) levels
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationRat IGF-1 ELISA Kit (rigf-1-elisa)
Rat IGF-1 ELISA Kit (rigf-1-elisa) Cat. No. EK0377 96 Tests in 8 x 12 divisible strips Background Insulin-like growth factor 1 (IGF-1), also known as somatomedin C, is a polypeptide protein hormone similar
More informationSupporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis
Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie
More informationab Human on human IHC kit (AP/Permanent
Version 1 Last updated 13 September 2016 ab214753 Human on human IHC kit (AP/Permanent Red) For staining human primary antibodies on human tissues without background staining This product is for research
More informationHuman TGF-beta1 ELISA
K-ASSAY Human TGF-beta1 ELISA For the quantitative determination of TGF-beta1 in human cell culture supernates, serum, plasma (EDTA) and urine Cat. No. KT-1471 For Research Use Only. Not for diagnostic
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationHuman alpha-galactosidase A / GLA ELISA Pair Set
Human alpha-galactosidase A / GLA ELISA Pair Set Catalog Number : SEK12078 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationmcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 mcherry Monoclonal Antibody (16D7) Catalog Number M11217 Product data sheet Details
More informationAssayMax Mouse Transferrin ELISA Kit
AssayMax Mouse Transferrin ELISA Kit Assaypro LLC 3400 Harry S Truman Blvd St. Charles, MO 63301 T (636) 447-9175 F (636) 395-7419 www.assaypro.com For any questions regarding troubleshooting or performing
More information