Population differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia
|
|
- Julian Bell
- 6 years ago
- Views:
Transcription
1 Population differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia Kevin Galinsky Harvard T. H. Chan School of Public Health American Society of Human Genetics October 10, 2015
2 Population differentiation can detect recent selection Sabeti et al Science 2
3 Example: High-altitude EPAS1 gene in Tibetan populations Yi et al Science 3
4 Selected loci generate false-positive signals in GWAS Population Stratification Phenotype Natural Selection Population Differentiation Ancestry Informative Markers Price et al PLoS Genet, Tian et al PLoS Genet 4
5 Outline Overview of method Simulations Signals of selection in GERA data 5
6 Ancestral Population Population differentiation examines allele frequency differences Pop 1 p1 E p 1 p 2 = 0 Var p 1 p 2 = 2F ST p 1 p p 1 p 2 ~N 0,2F ST p 1 p F ST p 1 p 2 p Pop 2 p2 Weir & Hill 2002 Annu Rev Genet, Bhatia et al Genome Res 6
7 Ancestral Population Population differentiation examines allele frequency differences Pop 1 p1 Sample 1 p 1 p i~n p i, p i 1 p i 2N i p 1 p 2 ~N 0,2F ST p 1 p p Pop 2 p2 Sample 2 p 2 7
8 Ancestral Population Population differentiation examines allele frequency differences Pop 1 p1 Sample 1 p 1 D = p 1 p 2 D~N 0, p 1 p 2F ST + 1 2N N 2 p Smaller F ST = More Power Greater sample size = More Power Pop 2 p2 Bhatia et al AJHG Sample 2 p 2 8
9 Ancestral Population Extending selection statistic to fractional ancestry Pop 1 p1 p 1 and p 2 still follow normal distribution! p Sample Pop 2 p2 α: ancestry x: genotypes p 1 = at x 2a T 1 p 2 = 1 a T x 2 1 a T 1 D still follows a normal distribution! But variance unknown
10 Ancestral Population Approach extends to PCs in the absence of population information Pop 1 p1 Y: normalized genotypes y i = x i 2p i 2p i 1 p i p Sample X: genotypes Eigenvectors v 1,, v K Correspond to ancestry α k = β 0k + β 1k v k Pop 2 p2 D ik y i v k Galinsky et al. biorxiv (under revision, AJHG)
11 Normalizing the SNP loadings with eigenvalues Two problems: Var(D) unknown D = Cyv; C unkown PCA is SVD: Y UΣV T U and V orthonormal Σ diagonal U = YVΣ 1 Var U ij = M 1 M Σ k 2 y iv k 2 ~χ
12 Selection statistic produces genome-wide significant signals Method produces a p-value Correct for M SNPs tested K PCs examined 12
13 Outline Overview of Method Simulations Signals of selection in GERA data 13
14 Ancestral Population Simulation scheme Pop 1 p1 Sample 1 X1 F ST PCs p Pop 2 p2 Sample 2 X2 Differentiated SNPs: D = p 1 p 2 Z 1, Z 2 Selection 14
15 Selection statistic under null is well calibrated 15
16 Power Smaller F ST = More Power D~N 0, p 1 p 2F ST + 1 2N N 2 F_ST Population Differentiation ( D = p 1 -p 2 ) 16
17 Power Larger sample size = More Power F ST = D~N 0, p 1 p 2F ST + 1 2N N 2 N 50k 20k 10k 5k 2k 1k Population Differentiation ( D = p 1 -p 2 ) 17
18 Outline Overview of Method Simulations Signals of selection in GERA data 18
19 Detecting natural selection in a real dataset Genetic Epidemiology Research on Adult Health and Aging (GERA) cohort Looked at samples with European ancestry 670,176 SNPs 62,318 Samples Banda et al Genetics 19
20 Data processing steps Original 670k 62k QC Filtering QC Remove: 609k 55k Related samples <90% European Ancestry Missing data SNPs Low MAF SNPs Selection LD Filtering HWE filter LD filter 162k LD PCA PCs 55k FastPCA Linear time algorithm 57 minutes CPU time 2.6 GB RAM SNPs Samples 20
21 PC1 selection signals LCT, ADH1B, HLA, OCA2 LCT ADH1B HLA OCA2 21
22 PC2 selection signals IGFBP3, IGH, OCA2 IGFBP3 IGH OCA2 22
23 PC3 selection signals LCT, IRF4, HLA, OCA2 LCT IRF4 HLA OCA2 23
24 PC4 selection signals IRF4, HLA, Chromosome 8 inversion IRF4 HLA Chr8 Inversion Tian et al PLoS Genet 24
25 Removing significant regions removes LD signals LCT ADH1B HLA PC1 OCA2 IGFBP3 PC2 IGH OCA2 LCT IRF4 HLA PC3 OCA2 IRF4 PC4 No chromosome 8 inversion HLA Tian et al PLoS Genet 25
26 Detect regions with novel selection Locus Chr Region (Mb) Best Hit PC p-value LCT rs ADH1B rs IRF rs HLA rs IGFBP rs Chr8 Inversion rs IGH rs OCA rs Genome-wide significant after testing 609k SNPs 4 PCs = 2.4M hypotheses p-value threshold =
27 ADH1B: Known phenotype Under selection East Asia Alcohol dehydrogenase rs is C/T SNP and Arg47His ADH1B*47His variant more active Oxidizes ethanol to acetaldehyde Protective against alcoholism Known to be under selection in East Asia Detected novel signal of selection in Europeans Han et al AJHG, Dick et al Alcohol Clin Exp Res 27
28 ADH1B: Independent selection event in Europeans Selection in East Asia detected using EHH methods H7 haplotype detected Contains variant at regulatory SNP rs Variant not found in Europeans Haplotype rs rs Asian (CHB, CHS, JPT) European (CEU, FIN, GBR, IBS, TSI) African (ASW, LWK, YRI) H5 G T 0.36% 1.12% 0% H5b G T 0.18% 0.56% 0% H6 G T 12.1% 0.28% 0% H7 A T 60.9% 0% 0% Other G C 28.0% 91.7% 100% Han et al AJHG, Yi et al Ann Hum Genet 28
29 Novel selection signal at IGFBP3: Gene with cancer and BP phenotypes Insulin-like growth factor-binding protein 3 IGF transport protein in blood Mediates effects of IGF IGF associated with: Breast cancer Implicated in other cancers Blood pressure phenotypes Al-Zahrani et al. Hum. Mol. Genet. 2006, Jogie-Brahim et al. Endocr Rev. 2009, Ganesh et al. AJHG 2014, Zhu et al, AJHG
30 Novel selection signal IGH: Locus associated with MS Immunoglobulin heavy locus Contains variants for heavy chains of antibodies Associated with multiple sclerosis Thought to be an autoimmune disorder Buck et al. Ann. Neurol
31 Conclusions Presented method to detect natural selection Without a priori ancestry Genome-wide significant signals Novel selection in GERA ADH1B in Europeans IGFBP3 IGH 31
32 Acknowledgements Alkes Price Gaurav Bhatia Po-Ru Loh Galinsky et al. biorxiv (under revision, AJHG) Sayan Mukherjee Google Stoyan Georgiev Nick Patterson 32
UK Biobank Axiom Array
DATA SHEET Advancing human health studies with powerful genotyping technology Array highlights The Applied Biosystems UK Biobank Axiom Array is a powerful array for translational research. Designed using
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationSupplementary Figures
Supplementary Figures 1 Supplementary Figure 1. Analyses of present-day population differentiation. (A, B) Enrichment of strongly differentiated genic alleles for all present-day population comparisons
More informationAlkes Price Harvard School of Public Health January 24 & January 26, 2017
EPI 511, Advanced Population and Medical Genetics Week 1: Intro + HapMap / 1000 Genomes Linkage Disequilibrium Alkes Price Harvard School of Public Health January 24 & January 26, 2017 EPI 511: Course
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationDerrek Paul Hibar
Derrek Paul Hibar derrek.hibar@ini.usc.edu Obtain the ADNI Genetic Data Quality Control Procedures Missingness Testing for relatedness Minor allele frequency (MAF) Hardy-Weinberg Equilibrium (HWE) Testing
More informationHaplotype phasing in large cohorts: Modeling, search, or both?
Haplotype phasing in large cohorts: Modeling, search, or both? Po-Ru Loh Harvard T.H. Chan School of Public Health Department of Epidemiology Broad MIA Seminar, 3/9/16 Overview Background: Haplotype phasing
More informationH3A - Genome-Wide Association testing SOP
H3A - Genome-Wide Association testing SOP Introduction File format Strand errors Sample quality control Marker quality control Batch effects Population stratification Association testing Replication Meta
More informationPLINK gplink Haploview
PLINK gplink Haploview Whole genome association software tutorial Shaun Purcell Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA Broad Institute of Harvard & MIT, Cambridge,
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationI/O Suite, VCF (1000 Genome) and HapMap
I/O Suite, VCF (1000 Genome) and HapMap Hin-Tak Leung April 13, 2013 Contents 1 Introduction 1 1.1 Ethnic Composition of 1000G vs HapMap........................ 2 2 1000 Genome vs HapMap YRI (Africans)
More informationPERSPECTIVES. A gene-centric approach to genome-wide association studies
PERSPECTIVES O P I N I O N A gene-centric approach to genome-wide association studies Eric Jorgenson and John S. Witte Abstract Genic variants are more likely to alter gene function and affect disease
More informationPopulation structure, heritability, and polygenic risk
Population structure, heritability, and polygenic risk Alicia Martin Daly Lab October 18, 2016 armartin@broadinstitute.org @genetisaur Project goals Call local ancestry in large case/control PTSD cohort
More informationGenome variation - part 1
Genome variation - part 1 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 21 th January 2016 Aims of the session Introduce major
More informationGeneral aspects of genome-wide association studies
General aspects of genome-wide association studies Abstract number 20201 Session 04 Correctly reporting statistical genetics results in the genomic era Pekka Uimari University of Helsinki Dept. of Agricultural
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationEfficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation
Efficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation Asif Javed 1,2, Petros Drineas 2, Michael W. Mahoney 3 and Peristera Paschou 4 1 Computational Biology Center, IBM T. J. Watson
More informationLeveraging local ancestry to detect gene-gene interactions in genome-wide data
Aschard et al. BMC Genetics (015) 16:14 DOI 10.1186/s1863-015-083-z METHODOLOGY ARTICLE Leveraging local ancestry to detect gene-gene interactions in genome-wide data Hugues Aschard 1*, Alexander Gusev
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationPrincipal Component Analysis in Genomic Data
Principal Component Analysis in Genomic Data Seunggeun Lee Department of Biostatistics University of North Carolina at Chapel Hill March 4, 2010 Seunggeun Lee (UNC-CH) PCA March 4, 2010 1 / 12 Bio Korean
More informationThemes. Homo erectus. Jin and Su, Nature Reviews Genetics (2000)
HC70A & SAS70A Winter 2009 Genetic Engineering in Medicine, Agriculture, and Law Tracking Human Ancestry Professor John Novembre Themes Global patterns of human genetic diversity Tracing our ancient ancestry
More informationhttp://genemapping.org/ Epistasis in Association Studies David Evans Law of Independent Assortment Biological Epistasis Bateson (99) a masking effect whereby a variant or allele at one locus prevents
More informationSimultaneous analysis of all SNPs in genome-wide and re-sequencing association studies
Simultaneous analysis of all SNPs in genome-wide and re-sequencing association studies p. 1/20 Simultaneous analysis of all SNPs in genome-wide and re-sequencing association studies David J. Balding Centre
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationNature Genetics: doi: /ng Supplementary Figure 1. QQ plots of P values from the SMR tests under a range of simulation scenarios.
Supplementary Figure 1 QQ plots of P values from the SMR tests under a range of simulation scenarios. The simulation strategy is described in the Supplementary Note. Shown are the results from 10,000 simulations.
More informationTitle: Powerful SNP Set Analysis for Case-Control Genome Wide Association Studies. Running Title: Powerful SNP Set Analysis. Hill, NC. MD.
Title: Powerful SNP Set Analysis for Case-Control Genome Wide Association Studies Running Title: Powerful SNP Set Analysis Michael C. Wu 1, Peter Kraft 2,3, Michael P. Epstein 4, Deanne M. Taylor 2, Stephen
More informationAmapofhumangenomevariationfrom population-scale sequencing
doi:.38/nature9534 Amapofhumangenomevariationfrom population-scale sequencing The Genomes Project Consortium* The Genomes Project aims to provide a deep characterization of human genome sequence variation
More informationGenotyping requirements for complex disease studies
Genotyping requirements for complex disease studies Grant Montgomery Molecular Epidemiology, Queensland Institute of Medical Research, Australia Queensland Institute of Medical Research Outline Background
More informationData Sources and Biobanks in the Asia-Pacific Region. Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014
Data Sources and Biobanks in the Asia-Pacific Region Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014 1 Disclosures Wei Zhou is currently an employee of Merck
More informationConcepts and relevance of genome-wide association studies
Science Progress (2016), 99(1), 59 67 Paper 1500149 doi:10.3184/003685016x14558068452913 Concepts and relevance of genome-wide association studies ANDREAS SCHERER and G. BRYCE CHRISTENSEN Dr Andreas Scherer
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationDesigning Genome-Wide Association Studies: Sample Size, Power, Imputation, and the Choice of Genotyping Chip
: Sample Size, Power, Imputation, and the Choice of Genotyping Chip Chris C. A. Spencer., Zhan Su., Peter Donnelly ", Jonathan Marchini " * Department of Statistics, University of Oxford, Oxford, United
More informationHaplotypes Personalized Medicine: Understanding Your Own Genome Fall 2014
Haplotypes 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Terminology Review llele: different forms of genecc variacons at a given gene or genecc locus Locus 1 has two alleles, and
More informationPopula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on Computa.onal Genomics Seyoung Kim
Popula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on 02-710 Computa.onal Genomics Seyoung Kim Overview Two fundamental forces that shape genome sequences Recombina.on Muta.on, gene.c
More informationMeasures of human population structure show heterogeneity among genomic regions
Measures of human population structure show heterogeneity among genomic regions Bruce S. Weir, Lon R. Cardon, Amy D. Anderson, et al. Genome Res. 2005 15: 1468-1476 Access the most recent version at doi:10.1101/gr.4398405
More informationAdvanced Introduction to Machine Learning
Advanced Introduction to Machine Learning 10715, Fall 2014 Structured Sparsity, with application in Computational Genomics Eric Xing Lecture 3, September 15, 2014 Reading: Eric Xing @ CMU, 2014 1 Structured
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationUniversity of Groningen. The value of haplotypes Vries, Anne René de
University of Groningen The value of haplotypes Vries, Anne René de IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document
More informationABSTRACT : 162 IQUIRA E & BELZILE F*
ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département
More informationLecture 6: Association Mapping. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013
Lecture 6: Association Mapping Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Association Pipeline Phenotypic Outliers Outliers are unusual data points that substantially deviate
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationProbabilistic Graphical Models
School of Computer Science Probabilistic Graphical Models Graph-induced structured input/output models - Case Study: Disease Association Analysis Eric Xing Lecture 25, April 16, 2014 Reading: See class
More informationData quality control in genetic case-control association studies
Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Protoc. 2010 September ; 5(9): 1564 1573. doi:10.1038/nprot.2010.116. Data quality control in genetic case-control association
More informationGap hunting to characterize clustered probe signals in Illumina methylation array data
DOI 10.1186/s13072-016-0107-z Epigenetics & Chromatin RESEARCH Gap hunting to characterize clustered probe signals in Illumina methylation array data Shan V. Andrews 1,2, Christine Ladd Acosta 1,2,3, Andrew
More informationACCEPTED. Victoria J. Wright Corresponding author.
The Pediatric Infectious Disease Journal Publish Ahead of Print DOI: 10.1097/INF.0000000000001183 Genome-wide association studies in infectious diseases Eleanor G. Seaby 1, Victoria J. Wright 1, Michael
More informationPetar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.
The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo
More informationStatistical challenges to genome-wide association study
1 Statistical challenges to genome-wide association study Naoyuki Kamatani, M.D., Ph.D. 1. Director and Professor, Institute of Rheumatology, Tokyo Women s Medical University 2. Director, Medical Informatics
More informationData quality control in genetic case-control association studies
Data quality control in genetic case-control association studies Carl A Anderson 1,2, Fredrik H Pettersson 1, Geraldine M Clarke 1, Lon R Cardon 3, Andrew P Morris 1 & Krina T Zondervan 1 1 Genetic and
More informationComputational methods for the analysis of rare variants
Computational methods for the analysis of rare variants Shamil Sunyaev Harvard-M.I.T. Health Sciences & Technology Division Combine all non-synonymous variants in a single test Theory: 1) Most new missense
More informationRuns of Homozygosity Analysis Tutorial
Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................
More informationLinkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationARTICLE Leveraging Multi-ethnic Evidence for Mapping Complex Traits in Minority Populations: An Empirical Bayes Approach
ARTICLE Leveraging Multi-ethnic Evidence for Mapping Complex Traits in Minority Populations: An Empirical Bayes Approach Marc A. Coram, 1,8,9 Sophie I. Candille, 2,8 Qing Duan, 3 Kei Hang K. Chan, 4 Yun
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationUsing the Association Workflow in Partek Genomics Suite
Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 3: Genome-wide Association Studies 1 Setting
More informationUpdate on the Genomics Data in the Health and Re4rement Study. Sharon Kardia Jennifer A. Smith University of Michigan April 2013
Update on the Genomics Data in the Health and Re4rement Study Sharon Kardia Jennifer A. Smith University of Michigan April 2013 Genetic variation in SNPs (Single Nucleotide Polymorphisms) ATTGCAATCCGTGG...ATCGAGCCA.TACGATTGCACGCCG
More informationMMAP Genomic Matrix Calculations
Last Update: 9/28/2014 MMAP Genomic Matrix Calculations MMAP has options to compute relationship matrices using genetic markers. The markers may be genotypes or dosages. Additive and dominant covariance
More informationGenomic Research: Issues to Consider. IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC
Genomic Research: Issues to Consider IRB Brown Bag August 28, 2014 Sharon Aufox, MS, LGC Outline Key genomic terms and concepts Issues in genomic research Consent models Types of findings Returning results
More informationCornell Probability Summer School 2006 Ancestral Recombination Graph
Cornell Probability Summer School 200 Ancestral Recombination Graph Simon Tavaré Lecture 3 Why recombination? In the era of genomic polymorphism data, the need for models that include recombination is
More informationRoadmap: genotyping studies in the post-1kgp era. Alex Helm Product Manager Genotyping Applications
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era Alex Helm Product Manager Genotyping Applications 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa,
More informationComputations with Markers
Computations with Markers Paulino Pérez 1 José Crossa 1 1 ColPos-México 2 CIMMyT-México September, 2014. SLU, Sweden Computations with Markers 1/20 Contents 1 Genomic relationship matrix 2 Examples 3 Big
More informationS SG. Metabolomics meets Genomics. Hemant K. Tiwari, Ph.D. Professor and Head. Metabolomics: Bench to Bedside. ection ON tatistical.
S SG ection ON tatistical enetics Metabolomics meets Genomics Hemant K. Tiwari, Ph.D. Professor and Head Section on Statistical Genetics Department of Biostatistics School of Public Health Metabolomics:
More informationExploring the Genetic Basis of Congenital Heart Defects
Exploring the Genetic Basis of Congenital Heart Defects Sanjay Siddhanti Jordan Hannel Vineeth Gangaram szsiddh@stanford.edu jfhannel@stanford.edu vineethg@stanford.edu 1 Introduction The Human Genome
More informationAuthor's response to reviews
Author's response to reviews Title: A pooling-based genome-wide analysis identifies new potential candidate genes for atopy in the European Community Respiratory Health Survey (ECRHS) Authors: Francesc
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationExperimental Design and Sample Size Requirement for QTL Mapping
Experimental Design and Sample Size Requirement for QTL Mapping Zhao-Bang Zeng Bioinformatics Research Center Departments of Statistics and Genetics North Carolina State University zeng@stat.ncsu.edu 1
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationMeasurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions
Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure
More informationGap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
More informationJoint Study of Genetic Regulators for Expression
Joint Study of Genetic Regulators for Expression Traits Related to Breast Cancer Tian Zheng 1, Shuang Wang 2, Lei Cong 1, Yuejing Ding 1, Iuliana Ionita-Laza 3, and Shaw-Hwa Lo 1 1 Department of Statistics,
More informationApplying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding. Peter Bradbury USDA/Cornell University
Applying Genotyping by Sequencing (GBS) to Corn Genetics and Breeding Peter Bradbury USDA/Cornell University Genotyping by sequencing (GBS) makes use of high through-put, short-read sequencing to provide
More informationCharacterization of Allele-Specific Copy Number in Tumor Genomes
Characterization of Allele-Specific Copy Number in Tumor Genomes Hao Chen 2 Haipeng Xing 1 Nancy R. Zhang 2 1 Department of Statistics Stonybrook University of New York 2 Department of Statistics Stanford
More informationAfter the association: Functional and Biological Validation of Variants
After the association: Functional and Biological Validation of Variants Jason L. Stein Geschwind Laboratory / Imaging Genetics Center University of California, Los Angeles (but soon to be at UNC-Chapel
More informationWhole-Genome Genetic Data Simulation Based on Mutation-Drift Equilibrium Model
2012 4th International Conference on Computer Modeling and Simulation (ICCMS 2012) IPCSIT vol.22 (2012) (2012) IACSIT Press, Singapore Whole-Genome Genetic Data Simulation Based on Mutation-Drift Equilibrium
More informationA Bayesian Graphical Model for Genome-wide Association Studies (GWAS)
A Bayesian Graphical Model for Genome-wide Association Studies (GWAS) Laurent Briollais 1,2, Adrian Dobra 3, Jinnan Liu 1, Hilmi Ozcelik 1 and Hélène Massam 4 Prosserman Centre for Health Research, Samuel
More informationEffects of cis and trans Genetic Ancestry on Gene Expression in African Americans
Effects of cis and trans Genetic Ancestry on Gene Expression in African Americans Alkes L. Price 1,2 *, Nick Patterson 3, Dustin C. Hancks 4, Simon Myers 5, David Reich 3,6, Vivian G. Cheung 4,7,8,9, Richard
More informationIntroduction to statistics for Genome- Wide Association Studies (GWAS) Day 2 Section 8
Introduction to statistics for Genome- Wide Association Studies (GWAS) 1 Outline Background on GWAS Presentation of GenABEL Data checking with GenABEL Data analysis with GenABEL Display of results 2 R
More informationIllumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era Anthony Green Sr. Genotyping Sales Specialist North America 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx,
More informationLees J.A., Vehkala M. et al., 2016 In Review
Sequence element enrichment analysis to determine the genetic basis of bacterial phenotypes Lees J.A., Vehkala M. et al., 2016 In Review Journal Club Triinu Kõressaar 16.03.2016 Introduction Bacterial
More informationKNN-MDR: a learning approach for improving interactions mapping performances in genome wide association studies
Abo Alchamlat and Farnir BMC Bioinformatics (2017) 18:184 DOI 10.1186/s12859-017-1599-7 METHODOLOGY ARTICLE Open Access KNN-MDR: a learning approach for improving interactions mapping performances in genome
More informationOn detecting incomplete soft or hard selective sweeps using haplotype structure
MBE Advance Access published February 18, 2014 On detecting incomplete soft or hard selective sweeps using haplotype structure Anna Ferrer-Admetlla, 1,2,3,4, Mason Liang, 1, Thorfinn Korneliussen, 5 and
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplementary Table 1: RT-qPCR primer sequences. Sequences are shown from 5 to 3 direction; all primers are designed using mouse genome as reference. 36B4-F; TGAAGCAAAGGAAGAGTCGGAGGA
More informationA A T A C G T G A G T G A G G C C T T A A
Living in a Genomic World: Unraveling the Complexity of GWAS Studies by Rivka L. Glaser, Department of Biology, Stevenson University, Stevenson, MD Erin L. Zimmer, Department of Biology, Lewis University,
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationStatistical Tests for Admixture Mapping with Case-Control and Cases-Only Data
Am. J. Hum. Genet. 75:771 789, 2004 Statistical Tests for Admixture Mapping with Case-Control and Cases-Only Data Giovanni Montana and Jonathan K. Pritchard Department of Human Genetics, University of
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationMAPPING BY ADMIXTURE LINKAGE DISEQUILIBRIUM: ADVANCES, LIMITATIONS AND GUIDELINES
Nature Reviews Genetics AOP, published online 12 July 25; doi:1.138/nrg1657 REVIEWS MAPPING BY ADMIXTURE LINKAGE DISEQUILIBRIUM: ADVANCES, LIMITATIONS AND GUIDELINES Michael W. Smith* and Stephen J. O
More informationGenetics and Psychiatric Disorders Lecture 1: Introduction
Genetics and Psychiatric Disorders Lecture 1: Introduction Amanda J. Myers LABORATORY OF FUNCTIONAL NEUROGENOMICS All slides available @: http://labs.med.miami.edu/myers Click on courses First two links
More informationIdentifying Selected Regions from Heterozygosity and Divergence Using a Light-Coverage Genomic Dataset from Two Human Populations
Nova Southeastern University NSUWorks Biology Faculty Articles Department of Biological Sciences 3-5-2008 Identifying Selected Regions from Heterozygosity and Divergence Using a Light-Coverage Genomic
More informationStrengthening genomic studies of cardiometabolic diseases in Africa the AWI-Gen experience
Strengthening genomic studies of cardiometabolic diseases in Africa the AWI-Gen experience Human Heredity and Health in Africa ASHG - October 2015 Inaugural H3Africa meeting Addis Ababa - October 2012
More informationGene-centric Genomewide Association Study via Entropy
Gene-centric Genomewide Association Study via Entropy Yuehua Cui 1,, Guolian Kang 1, Kelian Sun 2, Minping Qian 2, Roberto Romero 3, and Wenjiang Fu 2 1 Department of Statistics and Probability, 2 Department
More information