Petar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.
|
|
|
- Augustine Bell
- 6 years ago
- Views:
Transcription
1 The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY. *The authors contributed equally to this work Corresponding Author Omer Gokcumen Department of Biological Sciences University at Buffalo Cooke 639 Buffalo, NY omergokc@buffalo.edu KEYWORDS: Copy number variation, genomic structural variants, atopic dermatitis, HLA, defensins, Neanderthal, LCE3A, Human Evolution
2 SUPPLEMENTARY FILES Figure S1. Integrative Genome Viewer (IGV) screenshot shows the sequence alignments in Neanderthal, Denisovan and 45k Siberian genomes for the LCE3BC locus. The bottom blue boxes represent the genes in the LCE3 region. The green line shows the breakpoints of the variable LCE3BC deletion among humans. The small grey lines are individual reads from Altai Neanderthal (Top), Denisovan (Middle), and the 45,000 year old Siberian Human (Bottom) genomes mapping to the human reference genome (Hg19). The histogram above each sample indicates the read depth at that location.
3 Figure S2. Linkage Disequilibrium (LD) scores within and around the LCE3BC deletion. The X axis represents the chromosomal location, while the y axis is the R 2 score. The blue arrows represent the location of the LCE3BC deletion. The single nucleotide variants with high level (R 2 >0.9) are shown in red dots and found to range from 5.5kb upstream to 6.6kb downstream of the LCE3BC deletion. The 5.6kb target region indicated by the red bracket was used for majority of the population genetic analyses. This target region also harbors the SNP that was used for interrogating ancient genomes, rs
4 Figure S3. (a) Maximum likelihood haplotype tree constructed using 1000 Genomes Phase 3 dataset. This input file for the tree is the same as the one used to create Figure 2c, with the addition of the Chimpanzee ( Pan troglodytes). The Chimp grouped with the non deleted haplotype group, represented by the blue circle. (b) Rooted maximum likelihood haplotype tree constructed using a select 24 haplotypes from 1000 Genomes Phase 3 dataset, representing major branches. Rhesus Macaque (rhemac3) was used as an outgroup. The blue haplotypes, Altai Neanderthal, and Chimpanzee grouped together as non deleted. The red haplotypes and Denisovan cluster with the deleted haplogroup. Parametric bootstrap branch support values were included on the primary branches. a. b.
5 Figure S4. (a) Pairwise population differentiation (F ST, y axis) between 3 populations; CEU vs. YRI; CHB vs. CEU; and YRI vs. CHB. The populations considered here are CEU: Central Europeans from Utah; CHB: Han Chinese from Beijing; and YRI: Yoruba from Ibadan Nigeria (x axis). The red box represents the neutral regions on chromosome 1 with the blue representing the previously consistent target region. This is consistent with balancing selection acting on this locus. (b) Integrated haplotype homozygosity (ΔiHH) (y axis) for the populations considered here; CEU: Central Europeans from Utah; CHB: Han Chinese from Beijing; and YRI: Yoruba from Ibadan Nigeria (x axis). Data was taken from 1000 Genomes Dataset. a. b.
6 Figure S5. Location of the L1 (LINE) element (chr1: 152,587, ,590,051) within the target haplotype block (red), with respect to the LCE3BC deletion (blue). The original target region (152,587, ,593,549; green), has been reconstructed for analysis, avoiding the LINE element (152,590, ,593,549; purple).
7 Figure S6. Re constructed maximum likelihood haplotype tree using 1000 Genomes Phase 3 dataset to avoid the L1 element. This tree compares to the one previously constructed in Figure 2, with no changes other than branch swapping. The same haplotypes group with the same haplogroups as expected.
8 Figure S7. (a) Tajima s D score in three different populations (CEU: Central Europeans from Utah; CHB: Han Chinese from Beijing; and YRI: Yoruba from Ibadan Nigeria). The red boxes represent all regions of the genome that are predicted to be evolving under neutrality, whereas the blue boxes represent the data points from the re constructed LCE3BC haplotype block omitting the region harboring the LINE element. (b) Pi score in three different populations (CEU: Central Europeans from Utah; CHB: Han Chinese from Beijing; and YRI: Yoruba from Ibadan Nigeria). The red boxes represent all regions of the genome that are predicted to be evolving under neutrality. The blue boxes represent the data points from the re constructed LCE3BC haplotype block omitting the region harboring the LINE element. The green boxes represent π and Tajima s D scores calculated for the size matched downstream regions of non exonic ancient deletions. TajD P values: ( YRI; Target:Neutral; 1.6e 2, Target: NonExon; 3.8e 2, Neutral:NonExon; 1.032e 5) ( CEU; Target:Neutral; 7.5e 3, Target: NonExon; 8.9e 3, Neutral:NonExon; 1.6e 3) ( CHB; Target:Neutral; 7.8e 3, Target: NonExon; 9.3e 3, Neutral:NonExon;.5713) Pi P values: ( YRI; Target:Neutral; 2.0e 3, Target: NonExon; 5.2e 3, Neutral:NonExon; 2.0e 2) ( CEU; Target:Neutral; 7.8e 3, Target: NonExon; 1.2e 2, Neutral:NonExon; ) ( CHB; Target:Neutral; 1.4e 3, Target: NonExon; 3.1e 3, Neutral:NonExon; 7.1e 2) a. b.
9 Figure S8. The regulatory potential in the LCE3BC haplotype block. The UCSC genome browser screenshot depicts the chromosomal location of the LCE3BC deletion (red bracket). The grey circle shows the deletion overlapping with multiple transcription factor binding sites. The blue arrow show peaks of conservation among vertebrates that coincides with LCE3C and LCE3B.
10 Figure S9. Gene expression levels (y axis) of LCE3A, in sun exposed skin in the lower leg, for individuals Homozygous for no deletion, Heterozygous, and Homozygous with the deletion. Data was displayed from GTex Portal. The SNP rs (high LD w/ deletion) was used to for this analysis. The effect size= 0.4, p=6.4x10 10
Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplementary Table 1: RT-qPCR primer sequences. Sequences are shown from 5 to 3 direction; all primers are designed using mouse genome as reference. 36B4-F; TGAAGCAAAGGAAGAGTCGGAGGA
Analysis of large deletions in human-chimp genomic alignments. Erika Kvikstad BioInformatics I December 14, 2004
Analysis of large deletions in human-chimp genomic alignments Erika Kvikstad BioInformatics I December 14, 2004 Outline Mutations, mutations, mutations Project overview Strategy: finding, classifying indels
Detecting ancient admixture using DNA sequence data
Detecting ancient admixture using DNA sequence data October 10, 2008 Jeff Wall Institute for Human Genetics UCSF Background Origin of genus Homo 2 2.5 Mya Out of Africa (part I)?? 1.6 1.8 Mya Further spread
Phasing of 2-SNP Genotypes based on Non-Random Mating Model
Phasing of 2-SNP Genotypes based on Non-Random Mating Model Dumitru Brinza and Alexander Zelikovsky Department of Computer Science, Georgia State University, Atlanta, GA 30303 {dima,alexz}@cs.gsu.edu Abstract.
Amapofhumangenomevariationfrom population-scale sequencing
doi:.38/nature9534 Amapofhumangenomevariationfrom population-scale sequencing The Genomes Project Consortium* The Genomes Project aims to provide a deep characterization of human genome sequence variation
Axiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
Supplementary Figures
Supplementary Figures 1 Supplementary Figure 1. Analyses of present-day population differentiation. (A, B) Enrichment of strongly differentiated genic alleles for all present-day population comparisons
Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions. Supplementary Material
Chromosome-scale scaffolding of de novo genome assemblies based on chromatin interactions Joshua N. Burton 1, Andrew Adey 1, Rupali P. Patwardhan 1, Ruolan Qiu 1, Jacob O. Kitzman 1, Jay Shendure 1 1 Department
Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
Detecting selection on nucleotide polymorphisms
Detecting selection on nucleotide polymorphisms Introduction At this point, we ve refined the neutral theory quite a bit. Our understanding of how molecules evolve now recognizes that some substitutions
This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.
MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than
Human SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
Gap Filling for a Human MHC Haplotype Sequence
American Journal of Life Sciences 2016; 4(6): 146-151 http://www.sciencepublishinggroup.com/j/ajls doi: 10.11648/j.ajls.20160406.12 ISSN: 2328-5702 (Print); ISSN: 2328-5737 (Online) Gap Filling for a Human
Haplotypes Personalized Medicine: Understanding Your Own Genome Fall 2014
Haplotypes 02-223 Personalized Medicine: Understanding Your Own Genome Fall 2014 Terminology Review llele: different forms of genecc variacons at a given gene or genecc locus Locus 1 has two alleles, and
A haplotype map of the human genome
Vol 437 27 October 2005 doi:10.1038/nature04226 A haplotype map of the human genome The International HapMap Consortium* ARTICLES Inherited genetic variation has a critical but as yet largely uncharacterized
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Number and length distributions of the inferred fosmids.
Supplementary Figure 1 Number and length distributions of the inferred fosmids. Fosmid were inferred by mapping each pool s sequence reads to hg19. We retained only those reads that mapped to within a
Runs of Homozygosity Analysis Tutorial
Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................
Why can GBS be complicated? Tools for filtering, error correction and imputation.
Why can GBS be complicated? Tools for filtering, error correction and imputation. Edward Buckler USDA-ARS Cornell University http://www.maizegenetics.net Many Organisms Are Diverse Humans are at the lower
UK Biobank Axiom Array
DATA SHEET Advancing human health studies with powerful genotyping technology Array highlights The Applied Biosystems UK Biobank Axiom Array is a powerful array for translational research. Designed using
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html UCSC
The Red Queen Model of Recombination Hotspots Evolution in the Light of Archaic and Modern Human Genomes
The Red Queen Model of Recombination Hotspots Evolution in the Light of Archaic and Modern Human Genomes Yann Lesecque 1, Sylvain Glémin 2, Nicolas Lartillot 1, Dominique Mouchiroud 1, Laurent Duret 1
Appendix - I. Primer and Probe Sequences. MTUS1 gene
- I Primer and Probe Sequences MTUS1 gene MDel-F: 5' TGCATTTTTCTTCCTGTTTGG 3' (21 bases) MDel-R: 5' ATATCCTGTGCTCCTCACTGC 3' (21 bases) MEx4-F: 5' CCTTGAAAACTGCACAGTCG 3' (20 bases) MEx4-R: 5' CTCAGCTCACTGTGGGTGCT
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions
Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure
RareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data.
RareVariantVis 2: R suite for analysis of rare variants in whole genome sequencing data. Adam Gudyś and Tomasz Stokowy October 30, 2017 Introduction The search for causative genetic variants in rare diseases
PLINK gplink Haploview
PLINK gplink Haploview Whole genome association software tutorial Shaun Purcell Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA Broad Institute of Harvard & MIT, Cambridge,
Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of. Autosomal Recessive Retinitis Pigmentosa
Identification of the Photoreceptor Transcriptional Co-Repressor SAMD11 as Novel Cause of Autosomal Recessive Retinitis Pigmentosa Corton M 1,2 *, Avila-Fernández A 1,2, Campello L 3, Sánchez M 1,2, Benavides
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Measures of human population structure show heterogeneity among genomic regions
Measures of human population structure show heterogeneity among genomic regions Bruce S. Weir, Lon R. Cardon, Amy D. Anderson, et al. Genome Res. 2005 15: 1468-1476 Access the most recent version at doi:10.1101/gr.4398405
Introns early. Introns late
Introns early Introns late Self splicing RNA are an example for catalytic RNA that could have been present in RNA world. There is little reason to assume that the RNA world was not plagued by self-splicing
Guided tour to Ensembl
Guided tour to Ensembl Introduction Introduction to the Ensembl project Walk-through of the browser Variations and Functional Genomics Comparative Genomics BioMart Ensembl Genome browser http://www.ensembl.org
Genome variation - part 1
Genome variation - part 1 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 21 th January 2016 Aims of the session Introduce major
Autozygosity by difference a method for locating autosomal recessive mutations. Geoff Pollott
Autozygosity by difference a method for locating autosomal recessive mutations Geoff Pollott Background Mutations occur regularly in all species Autosomal recessive conditions arise in most breeds from
DOI: /journal.pgen Publication date: Document Version Publisher's PDF, also known as Version of record
university of copenhagen Natural selection affects multiple aspects of genetic variation at putatively peutral sites across the human genome Lohmueller, Kirk E; Albrechtsen, Anders; Li, Yingrui; Kim, Su
It s not a fundamental force like mutation, selection, and drift.
What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing
Hands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
Psoriasis genome-wide association study identifies susceptibility variants within LCE gene cluster at 1q21
Psoriasis genome-wide association study identifies susceptibility variants within LCE gene cluster at 1q21 Xue-Jun Zhang 1 3, Wei Huang 4,5, Sen Yang 1 3, Liang-Dan Sun 1 3, Feng-Yu Zhang 1 3, Qi-Xing
Inconsistencies in Neanderthal Genomic DNA Sequences
Inconsistencies in Neanderthal Genomic DNA Sequences Jeffrey D. Wall *, Sung K. Kim Institute for Human Genetics, University of California San Francisco, San Francisco, California, United States of America
I/O Suite, VCF (1000 Genome) and HapMap
I/O Suite, VCF (1000 Genome) and HapMap Hin-Tak Leung April 13, 2013 Contents 1 Introduction 1 1.1 Ethnic Composition of 1000G vs HapMap........................ 2 2 1000 Genome vs HapMap YRI (Africans)
The human noncoding genome defined by genetic diversity
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41588-018-0062-7 In the format provided by the authors and unedited. The human noncoding genome defined by genetic diversity Julia di Iulio 1,5,
Variant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
Data Mining and Applications in Genomics
Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications
An introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
You use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence
Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader
Nature Genetics: doi: /ng Supplementary Figure 1. Analysis of DHS STARR-seq in the P5424 cell line.
Supplementary Figure 1 Analysis of DHS STARR-seq in the P5424 cell line. (a) Luciferase enhancer assays of proximal DHSs defined as active or inactive enhancers by STARR-seq in P5424 cells. For each candidate,
Walk Through The Y Project. FTDNA Conference 2010 Houston TX Dipl.- Ing. Thomas Krahn
Walk Through The Y Project FTDNA Conference 2010 Houston TX Dipl.- Ing. Thomas Krahn Participants - Origin Austria 1 Basque 2 Belarus 2 Belgium 2 Czech Republic 1 Egypt 1 Finland 3 France 7 Georgia 3 Germany
Using the Association Workflow in Partek Genomics Suite
Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within
Genes with monoallelic expression contribute disproportionately to genetic diversity in humans
Genes with monoallelic expression contribute disproportionately to genetic diversity in humans The Harvard community has made this article openly available. Please share how this access benefits you. Your
Efficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation
Efficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation Asif Javed 1,2, Petros Drineas 2, Michael W. Mahoney 3 and Peristera Paschou 4 1 Computational Biology Center, IBM T. J. Watson
Training materials.
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation
By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
Introduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
Gap hunting to characterize clustered probe signals in Illumina methylation array data
DOI 10.1186/s13072-016-0107-z Epigenetics & Chromatin RESEARCH Gap hunting to characterize clustered probe signals in Illumina methylation array data Shan V. Andrews 1,2, Christine Ladd Acosta 1,2,3, Andrew
Overview One of the promises of studies of human genetic variation is to learn about human history and also to learn about natural selection.
Technical design document for a SNP array that is optimized for population genetics Yontao Lu, Nick Patterson, Yiping Zhan, Swapan Mallick and David Reich Overview One of the promises of studies of human
Chapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6
Chapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6 Overview ChIP-Sequencing technology (ChIP-Seq) uses high-throughput DNA sequencing to map protein-dna interactions across the entire genome.
VCGDB: A Virtual and Dynamic Genome Database of the Chinese Population
VCGDB: A Virtual and Dynamic Genome Database of the Chinese Population Jiayan Wu Associate Professor Director of Science and Technology Department Director of Core Facility Beijing Institute of Genomics,
Detecting copy-neutral LOH in cancer using Agilent SurePrint G3 Cancer CGH+SNP Microarrays
Detecting copy-neutral LOH in cancer using Agilent SurePrint G3 Cancer CGH+SNP Microarrays Application Note Authors Paula Costa Anniek De Witte Jayati Ghosh Agilent Technologies, Inc. Santa Clara, CA USA
Ensembl Tools. EBI is an Outstation of the European Molecular Biology Laboratory.
Ensembl Tools EBI is an Outstation of the European Molecular Biology Laboratory. Questions? We ve muted all the mics Ask questions in the Chat box in the webinar interface I will check the Chat box periodically
Recurring exon deletions in the haptoglobin (HP) gene associate with lower blood cholesterol levels
Recurring exon deletions in the haptoglobin (HP) gene associate with lower blood cholesterol levels The Harvard community has made this article openly available. Please share how this access benefits you.
Derrek Paul Hibar
Derrek Paul Hibar derrek.hibar@ini.usc.edu Obtain the ADNI Genetic Data Quality Control Procedures Missingness Testing for relatedness Minor allele frequency (MAF) Hardy-Weinberg Equilibrium (HWE) Testing
File S1 Technical details of a SNP array optimized for population genetics
File S1 Technical details of a SNP array optimized for population genetics Yontao Lu, Nick Patterson, Yiping Zhan, Swapan Mallick and David Reich Overview One of the promises of studies of human genetic
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION?
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? A. COLLINS Department of Human Genetics University of Southampton Duthie Building (808) Southampton General Hospital
Release Notes for Genomes Processed Using Complete Genomics Software
Release Notes for Genomes Processed Using Complete Genomics Software Version 1.11.0 Related Documents... 1 Changes to Version 1.11.0... 2 Changes to Version 1.10.0... 6 Changes to Version 1.9.0... 10 Changes
Mutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
Browsing Genomes with Ensembl
Browsing Genomes with Ensembl www.ensembl.org www.ensemblgenomes.org Exercise Answers v73 http://tinyurl.com/washu171013 Washington University 17 th October 2013 1 TABLE OF CONTENTS Exploring the Ensembl
MoGUL: Detecting Common Insertions and Deletions in a Population
MoGUL: Detecting Common Insertions and Deletions in a Population Seunghak Lee 1,2, Eric Xing 2, and Michael Brudno 1,3, 1 Department of Computer Science, University of Toronto, Canada 2 School of Computer
BIOSTATISTICS FOR TRANSLATIONAL & CLINICAL RESEARCH. Genetic Variation & CANCERS
BIOSTATISTICS FOR TRANSLATIONAL & CLINICAL RESEARCH Genetic Variation & CANCERS One man who drinks alcohol and smokes cigarettes lives to age 90 without getting liver or lung cancer; another man who smokes
Detection of Fusion Genes by Targeted Roche 454 Sequencing
Detection of Fusion Genes by Targeted Roche 454 Sequencing Hans-Ulrich Klein 1, Christoph Bartenhagen 1, Alexander Kohlmann 2, Vera Grossmann 2, Christian Ruckert 1, Torsten Haferlach 2, Martin Dugas 1
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Initial sequence of the chimpanzee genome and comparison with the human genome
Vol 437 1 September 2005 doi:10.1038/nature04072 Initial sequence of the chimpanzee genome and comparison with the human genome The Chimpanzee Sequencing and Analysis Consortium* Here we present a draft
Linkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
Introduction. The American Journal of Human Genetics 88, , June 10,
ARTICLE Effects of Natural Selection and Gene Conversion on the Evolution of Human Glycophorins Coding for MNS Blood Polymorphisms in Malaria-Endemic African Populations Wen-Ya Ko, 1 Kristin A. Kaercher,
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era
Illumina s GWAS Roadmap: next-generation genotyping studies in the post-1kgp era Anthony Green Sr. Genotyping Sales Specialist North America 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx,
PERSPECTIVES. A gene-centric approach to genome-wide association studies
PERSPECTIVES O P I N I O N A gene-centric approach to genome-wide association studies Eric Jorgenson and John S. Witte Abstract Genic variants are more likely to alter gene function and affect disease
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE?
MODULE 1: INTRODUCTION TO THE GENOME BROWSER: WHAT IS A GENE? Lesson Plan: Title Introduction to the Genome Browser: what is a gene? JOYCE STAMM Objectives Demonstrate basic skills in using the UCSC Genome
SALSA MLPA probemix P155-D1 Ehlers-Danlos syndrome III & IV
SALSA MLPA probemix P155-D1 Ehlers-Danlos syndrome III & IV Lot D1-1114. As compared to previous version (lot C1-0811), one reference probe and one COL3A1 target probe have been removed, and the length
Genome Patterns of Selection and Introgression of Haplotypes in Natural Populations of the House Mouse (Mus musculus)
Genome Patterns of Selection and Introgression of Haplotypes in Natural Populations of the House Mouse (Mus musculus) Fabian Staubach 1,2, Anna Lorenc 1, Philipp W. Messer 2, Kun Tang 3, Dmitri A. Petrov
ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas
ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
Genomes summary. Bacterial genome sizes
Genomes summary 1. >930 bacterial genomes sequenced. 2. Circular. Genes densely packed. 3. 2-10 Mbases, 470-7,000 genes 4. Genomes of >200 eukaryotes (45 higher ) sequenced. 5. Linear chromosomes 6. On
l e t t e r s Haplotype-resolved genome sequencing of a Gujarati Indian individual
Haplotype-resolved genome sequencing of a Gujarati Indian individual Jacob O Kitzman 1, Alexandra P MacKenzie 1, Andrew Adey 1, Joseph B Hiatt 1, Rupali P Patwardhan 1, Peter H Sudmant 1, Sarah B Ng 1,
Research Article The Influence of 3 UTRs on MicroRNA Function Inferred from Human SNP Data
Comparative and Functional Genomics Volume, Article ID 9769, 9 pages doi:.55//9769 Research Article The Influence of 3 UTRs on MicroRNA Function Inferred from Human SNP Data Zihua Hu, and Andrew E. Bruno
A high resolution HLA and SNP haplotype map for disease association studies in the extended human MHC
Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Genet. 2006 October ; 38(10): 1166 1172. doi:10.1038/ng1885. A high resolution HLA and SNP haplotype map for disease association
Designing Genome-Wide Association Studies: Sample Size, Power, Imputation, and the Choice of Genotyping Chip
: Sample Size, Power, Imputation, and the Choice of Genotyping Chip Chris C. A. Spencer., Zhan Su., Peter Donnelly ", Jonathan Marchini " * Department of Statistics, University of Oxford, Oxford, United
Data Sources and Biobanks in the Asia-Pacific Region. Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014
Data Sources and Biobanks in the Asia-Pacific Region Wei Zhou, MD, Ph.D. Department of Epidemiology, Merck Research Laboratories October 23, 2014 1 Disclosures Wei Zhou is currently an employee of Merck
Basic Concepts of Human Genetics
Basic oncepts of Human enetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. ne pair is called sex chromosomes
Genome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
SNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
Bioinformatics small variants Data Analysis. Guidelines. genomescan.nl
Next Generation Sequencing Bioinformatics small variants Data Analysis Guidelines genomescan.nl GenomeScan s Guidelines for Small Variant Analysis on NGS Data Using our own proprietary data analysis pipelines
Title: Genome-wide signals of positive selection in human evolution. Authors: David Enard*, Philipp W. Messer, and Dmitri A.
Title: Genome-wide signals of positive selection in human evolution Authors: David Enard*, Philipp W. Messer, and Dmitri A. Petrov* Affiliations: Department of Biology, Stanford University, Stanford, CA
Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
Conifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
Custom TaqMan Assays DESIGN AND ORDERING GUIDE. For SNP Genotyping and Gene Expression Assays. Publication Number Revision G
Custom TaqMan Assays DESIGN AND ORDERING GUIDE For SNP Genotyping and Gene Expression Assays Publication Number 4367671 Revision G For Research Use Only. Not for use in diagnostic procedures. Manufacturer: