Haplotypes Personalized Medicine: Understanding Your Own Genome Fall 2014
|
|
- Cory Lester
- 6 years ago
- Views:
Transcription
1 Haplotypes Personalized Medicine: Understanding Your Own Genome Fall 2014
2 Terminology Review llele: different forms of genecc variacons at a given gene or genecc locus Locus 1 has two alleles, and C, and Locus 2 has two alleles, T and G Individual 1 T G Locus 2 Genotype: specific allelic make- up of an individual s genome Individual 1 has genotype at Locus 1 and genotype TG at Locus 2 Locus 1 Individual 2 T T Heterozygous/Homozygous Locus 1 of Individual 1 is homozygous, and Locus 2 is heterozygous C Locus 1 Locus 2
3 Single Nucleo<de Polymorphism (SNP) GTCTTCGTCTGGT GTCTTCGTCTGGT GTTTTCGTCGGT C p GTTTTCGTCTGGT C m GTCTTCGTCTGT GTTTTCGTCGGT a diploid individual GTTTTCGTCGGT GTCTTCGTCTGT SNP: Binary nucleotide sustitutions at a single locus on a chromosome" each variant is called an "allele "
4 From SNPs to Haplotypes GTTTTCGTCGGT C p GTTTTCGTCTGGT C m GTCTTCGTCTGT GTTTTCGTCGGT a diploid individual GTTTTCGTCGGT GTCTTCGTCTGT chromosome" Haplotype: a stretch of consecutive nucleotides that lie on the same chromosome" What are the alleles here? " GTCTTCGTCTGGT GTCTTCGTCTGGT
5 Haplotypes from SNP rray? C m C p T G C T TGC sequencing Heterozygous diploid individual TC TG Genotype g pairs of alleles with association of alleles to chromosomes unknown T G C T T T C G haplotype h (h 1, h 2 ) possile associations of alleles to chromosome
6 Why Haplotypes? Haplotypes have a greater power for discriminacng genomic regions Consider J inary markers (e.g., SNPs) in a genomic region There are 2 J possile haplotypes SNPs have only two alleles, whereas haplotypes have a larger numer of alleles Good genecc marker for populacon, evolucon and hereditary diseases
7 Haplotypes and SNPs GTCTTCGTCTGGT GTCTTCGTCTGGT GTTTTCGTCGGT GTTTTCGTCTGGT GTCTTCGTCTGT GTTTTCGTCGGT GTTTTCGTCGGT GTCTTCGTCTGT chromosome" Haplotype CTG 3/8 TG 3/8 CT 2/8 SNPs can discnguish etween two groups of individuals (a group with C, another group with T) Haplotypes can discnguish etween three groups of individuals (each group with CTG, TG, and CT)
8 Haplotypes and SNPs GTCTTCGTCTGGT GTCTTCGTCTGGT GTTTTCGTCGGT GTTTTCGTCTGGT GTCTTCGTCTGT GTTTTCGTCGGT GTTTTCGTCGGT GTCTTCGTCTGT chromosome" Haplotype CTG 3/8 TG 3/8 CT 2/8 healthy healthy disease X Haplotypes can have a greater power to detect disease- related genome region
9 Inferring Haplotypes from SNP rray Data Genotype: C////TG Maternal genotype: C////TT Paternal genotype: CC////TG Then the haplotype is C/TG. Genotype: C////TG Maternal genotype: C////TG Paternal genotype: C////TG Cannot determine unique haplotype Prolem: How can we determine haplotypes without parental genotypes
10 Phasing: Inferring Haplotypes from SNP Data Given mulclocus genotypes at a set of SNPs for many individuals, phasing means Reconstruct haplotypes for all individuals EsCmate frequencies of all possile haplotypes Haplotype reconstruccon algorithm Clark s parsimony algorithm (Clark, Mol. Biol. Evol. 1990)
11 Iden<fiaility Genotypes of 14 individual Genotype representations 0/0! 0 1/1! 1 0/1!
12 Iden<fiaility " 10" 7" Parsimonious solution" " 1" 1" 1" 8" 1" 1" 6" 1"
13 Haplotype Reconstruc<on lgorithm y Clark (1990) Choose individuals that are homozygous at every locus (e.g. TT////CC) Haplotype: TC Choose individuals that are heterozygous at just one locus (e.g. TT//// CG) Haplotypes: TC or TG Tally the resulcng known haplotypes. For each known haplotype, look at all remaining unresolved cases: is there a cominacon to make this haplotype? Known haplotype: TC Unresolved pa`ern: T////CG Inferred haplotype: TC/G. dd to list. Known haplotype: TC and TG Unresolved pa`ern: T////CG Inferred haplotypes: TC and TG. dd oth to list. ConCnue uncl all haplotypes have een recovered or no new haplotypes can e found this way.
14 Prolems: Clark (1990) Many unresolved haplotypes at the end Ignores recominacon Error in haplotype inference if a crossover of two actual haplotypes is idenccal to another true haplotype Frequency of such errors depends on recominacon rate Clark (1990): algorithm "performs well" even with small sample sizes.
15 RECOMBINTION & LINKGE DISEQUILIBRIUM
16 Morgan s FruiYly Experiment Morgan s frui.ly data (1909): 2,839 flies Eye color : red a: purple Wing length B: normal : vescgial BB x aa" ab x aa" ab a aab aa" Exp " Os 1, ,195"
17 Linked Genes When two genes lies on the same chromosome, they are transmi`ed to offspring in a non independent manner B a
18 Morgan s Explana<on: Recomina<on B B a a F1: a B a a F2:" B a a a a a B a Recomination has taken place"
19 Recomina<on Parental types: ab, aa Recominants: a, aab The proporcon of recominants etween the two genes (or characters) is called the recomina*on frac*on etween these two genes.
20 Review: Correla<on GP and TV in hours per week are negacvely correlated Mean How can we quancfy the level of correlacon?
21 Covariance and Correla<on Degree of associacon etween two variales x and y Given oservacons x 1,, x n and y 1,, y n Covariance CorrelaCon coefficient: (Variance of x i s) x (n- 1) (Variance of y i s) x (n- 1) Falls etween - 1 and +1, with sign indicacng direccon of associacon
22 Correla<on etween X 1 and X 2 X1 X 2
23 Basic Concepts B a B a High LD -> No Recomination (r 2 = 1) SNP1 tags SNP2 B B B a a a Low LD -> Recomination Many possiilities a B a B B a B etc B B X OR Parent 1 Parent 2
24 Linkage Disequilirium (LD) LD reflects the relaconship etween alleles at different loci. Omen, r 2 (squared correlacon coefficient) is used as a measure of LD. Locus Locus B
25 How to Compute r 2 on SNP Data Individuals SNP1 SNP2 SNP r 2 =1.0 SNP1 SNP2 SNP3 r 2 matrix SNP1 SNP2 SNP r 2 =0.0 R 2 =0.0
26 Linkage Disequilirium in SNP Data r 2 in SNP data from a populacon of individuals (Black: r 2 =1, white: r 2 =0) genome PopulaCon 2 PopulaCon 2 genome PopulaCon 1 PopulaCon 1
27 Reducing Genotyping Costs with Tag SNPs Neary SNPs in the genome are in linkage disequilirium (LD), and thus contain redundant informacon. If we knew which SNPs are in LD, we can pre- select the representacve SNPs for each LD lock of chromosome, and genotype only for those SNPs. r 2 values (lack: r 2 =1, white: r 2 =0) Genome These two SNPs are in high LD and thus are redundant
28 Reducing Genotyping Costs with Tag SNPs Two- stage data colleccon process Stage 1: Collect genotype data for a dense set of SNPs for mulcple individuals Select a non- redundant set of tag SNPs y examining the LD pa`ern Stage 2: Collect genotype data only for the tagsnps for a large numer of individuals
29 lgorithm for Selec<ng Tag SNPs Greedy algorithm Genome Randomly select a tag SNP Iterate uncl the set of candidate tag SNPs is empty Genome Find the SNPs with a high LD with the previously selected tag SNP (r 2 >0.8) and remove those SNPs from the set of candidate tag SNPs
30 Recomina<on and Haplotypes Rememer Clark s method does not take into account recominacon How can we find haplotypes from SNP data collected for a populacon of individuals under recominacon? ssume haplotypes of ancestor chromosomes and treat modern individuals chromosomes as a mosaic of ancestor chromosomes However, ancestor chromosomes cannot e oserved! Key idea: Haplotype of each individual is a mosaic of other individuals haplotypes unresolved haplotypes are similar to known haplotypes
31 Recomina<on and Haplotypes h 1, h 2, h 3 : unoserved ancestral haplotypes we have no SNP data h 4, h 4B : unoserved haplotypes for modern individuals Haplotypes are unoserved, however, we have SNP data Circles: mutacons TCGTTTTCGTTCGTGTGTTTCTGTTCTGTGTCGTTC TCGTTTTTTCTTTTGCGTGTTTCTGCTGCTTCTGTGTCGTTC Mosaic of ancestor chromosomes
32 PHSE Model as an HMM Inferring the unoserved state laels for each of the oserved SNP amounts to haplotype reconstruccon TCGTTTTCGTTCGTGTGTTTCTGTTCTGTGTCGTTC h3h3h3h3h3h3h3h3h3h3h3h3h2h2h2h2h2h2h2 TCGTTTTTTCTTTTGCGTGTTTCTGCTGCTTCTGTGTCGTTC h3h3h3h3h3h1h1h1h1h2h2h2h2h2h2h2h2h2h3h3h3.
33 PHSE Model as an HMM States: h 1, h 2, h 3, unoserved ancestral haplotypes State space with possile transicons h 1 h 2 h 3 TransiCon proailices (from SNP X l to X l+1 ) are dependent on distance etween adjacent SNPs d l RecominaCon rate etween adjacent SNPs ρ l Emission proailices: mutacon model Task: infer hidden state laels for each locus of each individual (h 4, h 4B )
34 INTERNTIONL HPMP PROJECT (HPMP.ORG)
35 HapMap Phase 3 Samples lael population sample # samples QC+ Draft 1 SW* frican ancestry in Southwest US CEU* Utah residents with Northern and Western European ancestry from the CEPH collection CHB Han Chinese in Beijing, China CHD Chinese in Metropolitan Denver, Colorado GIH Gujarati Indians in Houston, Texas JPT Japanese in Tokyo, Japan LWK Luhya in Weuye, Kenya MEX* Mexican ancestry in Los ngeles, California MKK* Maasai in Kinyawa, Kenya TSI Toscans in Italy YRI* Yorua in Iadan, Nigeria ,301 1,115 * Population is made of family trios
36 Haplotype Structure and Recomina<on Rate Es<mates: HapMap I vs. HapMap II
37 HapMap: llele Frequencies in Different Popula<ons Comparison of allele frequencies for individuals from pairs of populacons The red regions show that there are many SNPs that have similar low frequencies in each pair of analysis panels/ populacons. CHB (Chinese) and JPT (Japanese) have similar allele frequencies
38 Why Haplotypes? Haplotypes have a greater power for discriminacng genomic regions Consider J inary markers (e.g., SNPs) in a genomic region There are 2 J possile haplotypes ut in fact, far fewer are seen in human popula<on SNPs have only two alleles, whereas haplotypes have a larger numer of alleles Good genecc marker for populacon, evolucon and hereditary diseases
39 Summary Haplotype: a set of genecc markers that lie on the same chromosome How can we find haplotypes from SNPs? RecominaCon, linkage disequilirium, and how to take advantage of them Haplotypes as a set of linked SNPs with a greater discriminacve power Tag SNPs for saving the genotyping cost HapMap Project
Genotyping Technology How to Analyze Your Own Genome Fall 2013
Genotyping Technology 02-223 How to nalyze Your Own Genome Fall 2013 HapMap Project Phase 1 Phase 2 Phase 3 Samples & POP panels Genotyping centers Unique QC+ SNPs 269 samples (4 populations) HapMap International
More informationHaplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
More informationPopula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on Computa.onal Genomics Seyoung Kim
Popula'on Gene'cs I: Gene'c Polymorphisms, Haplotype Inference, Recombina'on 02-710 Computa.onal Genomics Seyoung Kim Overview Two fundamental forces that shape genome sequences Recombina.on Muta.on, gene.c
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationResources at HapMap.Org
Resources at HapMap.Org HapMap Phase II Dataset Release #21a, January 2007 (NCBI build 35) 3.8 M genotyped SNPs => 1 SNP/700 bp # polymorphic SNPs/kb in consensus dataset International HapMap Consortium
More informationGenotype Prediction with SVMs
Genotype Prediction with SVMs Nicholas Johnson December 12, 2008 1 Summary A tuned SVM appears competitive with the FastPhase HMM (Stephens and Scheet, 2006), which is the current state of the art in genotype
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplementary Table 1: RT-qPCR primer sequences. Sequences are shown from 5 to 3 direction; all primers are designed using mouse genome as reference. 36B4-F; TGAAGCAAAGGAAGAGTCGGAGGA
More informationThe Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm
The Whole Genome TagSNP Selection and Transferability Among HapMap Populations Reedik Magi, Lauris Kaplinski, and Maido Remm Pacific Symposium on Biocomputing 11:535-543(2006) THE WHOLE GENOME TAGSNP SELECTION
More informationI/O Suite, VCF (1000 Genome) and HapMap
I/O Suite, VCF (1000 Genome) and HapMap Hin-Tak Leung April 13, 2013 Contents 1 Introduction 1 1.1 Ethnic Composition of 1000G vs HapMap........................ 2 2 1000 Genome vs HapMap YRI (Africans)
More informationGENOME-WIDE data sets from worldwide panels of
Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.116681 Population Structure With Localized Haplotype Clusters Sharon R. Browning*,1 and Bruce S. Weir *Department of Statistics,
More informationSupplementary Figure 1 a
Supplementary Figure 1 a b GWAS second stage log 10 observed P 0 2 4 6 8 10 12 0 1 2 3 4 log 10 expected P rs3077 (P hetero =0.84) GWAS second stage (BBJ, Japan) First replication (BBJ, Japan) Second replication
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationPopulation description. 103 CHB Han Chinese in Beijing, China East Asian EAS. 104 JPT Japanese in Tokyo, Japan East Asian EAS
1 Supplementary Table 1 Description of the 1000 Genomes Project Phase 3 representing 2504 individuals from 26 different global populations that are assigned to five super-populations Number of individuals
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationOffice Hours. We will try to find a time
Office Hours We will try to find a time If you haven t done so yet, please mark times when you are available at: https://tinyurl.com/666-office-hours Thanks! Hardy Weinberg Equilibrium Biostatistics 666
More informationHuman Populations: History and Structure
Human Populations: History and Structure In the paper Novembre J, Johnson, Bryc K, Kutalik Z, Boyko AR, Auton A, Indap A, King KS, Bergmann A, Nelson MB, Stephens M, Bustamante CD. 2008. Genes mirror geography
More informationHuman Population Differentiation Is Strongly Correlated with Local Recombination Rate
Human Population Differentiation Is Strongly Correlated with Local Recombination Rate Alon Keinan 1,2,3 *, David Reich 1,2 1 Department of Genetics, Harvard Medical School, Boston, Massachusetts, United
More informationHuman Population Differentiation is Strongly Correlated With Local Recombination Rate
Human Population Differentiation is Strongly Correlated With Local Recombination Rate The Harvard community has made this article openly available. Please share how this access benefits you. Your story
More informationNews. The International HapMap Project
HapMap News A Publication of the Coriell Institute for Medical Research, V olume 1, 2004 The International HapMap Project Excitement is building as scientists begin to construct a resource called the haplotype
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationPopulation Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
More informationDe novo human genome assemblies reveal spectrum of alternative haplotypes in diverse
SUPPLEMENTARY INFORMATION De novo human genome assemblies reveal spectrum of alternative haplotypes in diverse populations Wong et al. The Supplementary Information contains 4 Supplementary Figures, 3
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationSNP Selection. Outline of Tutorial. Why Do We Need tagsnps? Concepts of tagsnps. LD and haplotype definitions. Haplotype blocks and definitions
SNP Selection Outline of Tutorial Concepts of tagsnps University of Louisville Center for Genetics and Molecular Medicine January 10, 2008 Dana Crawford, PhD Vanderbilt University Center for Human Genetics
More informationThe HapMap Project and Haploview
The HapMap Project and Haploview David Evans Ben Neale University of Oxford Wellcome Trust Centre for Human Genetics Human Haplotype Map General Idea: Characterize the distribution of Linkage Disequilibrium
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationCUMACH - A Fast GPU-based Genotype Imputation Tool. Agatha Hu
CUMACH - A Fast GPU-based Genotype Imputation Tool Agatha Hu ahu@nvidia.com Term explanation Figure resource: http://en.wikipedia.org/wiki/genotype Allele: one of two or more forms of a gene or a genetic
More informationAlkes Price Harvard School of Public Health January 24 & January 26, 2017
EPI 511, Advanced Population and Medical Genetics Week 1: Intro + HapMap / 1000 Genomes Linkage Disequilibrium Alkes Price Harvard School of Public Health January 24 & January 26, 2017 EPI 511: Course
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationIL1B-CGTC haplotype is associated with colorectal cancer in. admixed individuals with increased African ancestry
IL1B-CGTC haplotype is associated with colorectal cancer in admixed individuals with increased African ancestry María Carolina Sanabria-Salas 1, 2,*, Gustavo Hernández-Suárez 1, Adriana Umaña- Pérez 2,
More informationHaplotype phasing in large cohorts: Modeling, search, or both?
Haplotype phasing in large cohorts: Modeling, search, or both? Po-Ru Loh Harvard T.H. Chan School of Public Health Department of Epidemiology Broad MIA Seminar, 3/9/16 Overview Background: Haplotype phasing
More informationGenome variation - part 1
Genome variation - part 1 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 2 Friday 21 th January 2016 Aims of the session Introduce major
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationEvaluation of a multipoint method for imputing genotypes using HapMap III
Mathematical Statistics Stockholm University Evaluation of a multipoint method for imputing genotypes using HapMap III Emil Rehnberg Examensarbete 2009:5 Postal address: Mathematical Statistics Dept. of
More informationHISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY
Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université
More informationComputational Haplotype Analysis: An overview of computational methods in genetic variation study
Computational Haplotype Analysis: An overview of computational methods in genetic variation study Phil Hyoun Lee Advisor: Dr. Hagit Shatkay A depth paper submitted to the School of Computing conforming
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationGenome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma. Supplementary Information
Genome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma Vinod Kumar 1,2, Naoya Kato 3, Yuji Urabe 1, Atsushi Takahashi 2, Ryosuke Muroyama 3, Naoya Hosono
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationOverview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat
Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,
More informationLinkage Analysis Computa.onal Genomics Seyoung Kim
Linkage Analysis 02-710 Computa.onal Genomics Seyoung Kim Genome Polymorphisms Gene.c Varia.on Phenotypic Varia.on A Human Genealogy TCGAGGTATTAAC The ancestral chromosome SNPs and Human Genealogy A->G
More informationGenotype quality control with plinkqc Hannah Meyer
Genotype quality control with plinkqc Hannah Meyer 219-3-1 Contents Introduction 1 Per-individual quality control....................................... 2 Per-marker quality control.........................................
More informationPhasing of 2-SNP Genotypes based on Non-Random Mating Model
Phasing of 2-SNP Genotypes based on Non-Random Mating Model Dumitru Brinza and Alexander Zelikovsky Department of Computer Science, Georgia State University, Atlanta, GA 30303 {dima,alexz}@cs.gsu.edu Abstract.
More informationPetar Pajic 1 *, Yen Lung Lin 1 *, Duo Xu 1, Omer Gokcumen 1 Department of Biological Sciences, University at Buffalo, Buffalo, NY.
The psoriasis associated deletion of late cornified envelope genes LCE3B and LCE3C has been maintained under balancing selection since Human Denisovan divergence Petar Pajic 1 *, Yen Lung Lin 1 *, Duo
More informationPolymorphisms in Population
Computational Biology Lecture #5: Haplotypes Bud Mishra Professor of Computer Science, Mathematics, & Cell Biology Oct 17 2005 L4-1 Polymorphisms in Population Why do we care about variations? Underlie
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationStatistical Tools for Predicting Ancestry from Genetic Data
Statistical Tools for Predicting Ancestry from Genetic Data Timothy Thornton Department of Biostatistics University of Washington March 1, 2015 1 / 33 Basic Genetic Terminology A gene is the most fundamental
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Victoria Newman Ensembl Outreach Officer EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationNature Genetics: doi: /ng.3143
Supplementary Figure 1 Quantile-quantile plot of the association P values obtained in the discovery sample collection. The two clear outlying SNPs indicated for follow-up assessment are rs6841458 and rs7765379.
More informationB) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
More informationThe Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationEfficient Association Study Design Via Power-Optimized Tag SNP Selection
doi: 10.1111/j.1469-1809.2008.00469.x Efficient Association Study Design Via Power-Optimized Tag SNP Selection B. Han 1,H.M.Kang 1,M.S.Seo 2, N. Zaitlen 3 and E. Eskin 4, 1 Department of Computer Science
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationStructure, Measurement & Analysis of Genetic Variation
Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine
More informationIntroduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationBasics in Genetics Analysis
Genetics an Diseases Basics in Genetics nalysis Heping Zhang Environment 9/24/2007 Dr. Doug Brutlag Lecture Syllaus central paraigm //www.s-star.org/ 2 Diseases Progression How oes the Breast Cancer grows
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationPopulation differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia
Population differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia Kevin Galinsky Harvard T. H. Chan School of Public Health American Society
More informationOn the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study
On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)
More informationSummary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
More informationChapter 7. Linkage and Chromosome Mapping
Chapter 7. Linkage and Chromosome Mapping Outline of Linkage, Recombination, and the Mapping of Genes on Chromosomes Linkage and Meiotic Recombination Genes linked together on the same chromosome usually
More informationObserving Patterns in Inherited Traits. Chapter 11
Observing Patterns in Inherited Traits Chapter 11 Impacts, Issues: The Color of Skin Like most human traits, skin color has a genetic basis; more than 100 gene products affect the synthesis and deposition
More informationAnalysing Alu inserts detected from high-throughput sequencing data
Analysing Alu inserts detected from high-throughput sequencing data Harun Mustafa Mentor: Matei David Supervisor: Michael Brudno July 3, 2013 Before we begin... Even though I'll only present the minimal
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here
More informationStatistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
More informationARTICLE Population-Genetic Properties of Differentiated Human Copy-Number Polymorphisms
ARTICLE Population-Genetic Properties of Differentiated Human Copy-Number Polymorphisms Catarina D. Campbell, 1 Nick Sampas, 2 Anya Tsalenko, 2 Peter H. Sudmant, 1 Jeffrey M. Kidd, 1,3 Maika Malig, 1 Tiffany
More informationPUBH 8445: Lecture 1. Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota
PUBH 8445: Lecture 1 Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota saonli@umn.edu Statistical Genetics It can broadly be classified into three sub categories:
More informationThis is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.
MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than
More informationSUPPLEMENTARY INFORMATION
Contents De novo assembly... 2 Assembly statistics for all 150 individuals... 2 HHV6b integration... 2 Comparison of assemblers... 4 Variant calling and genotyping... 4 Protein truncating variants (PTV)...
More informationLINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES
LINKAGE AND CHROMOSOME MAPPING IN EUKARYOTES Objectives: Upon completion of this lab, the students should be able to: Understand the different stages of meiosis. Describe the events during each phase of
More informationEfficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation
Efficient Genomewide Selection of PCA-Correlated tsnps for Genotype Imputation Asif Javed 1,2, Petros Drineas 2, Michael W. Mahoney 3 and Peristera Paschou 4 1 Computational Biology Center, IBM T. J. Watson
More information2014 Pearson Education, Inc. Mapping Gene Linkage
Mapping Gene Linkage Dihybrid Cross - a cross showing two traits e.g pea shape and pea color The farther apart the genes are to one another the more likely a break between them happens and there will
More informationUpdate on the Genomics Data in the Health and Re4rement Study. Sharon Kardia Jennifer A. Smith University of Michigan April 2013
Update on the Genomics Data in the Health and Re4rement Study Sharon Kardia Jennifer A. Smith University of Michigan April 2013 Genetic variation in SNPs (Single Nucleotide Polymorphisms) ATTGCAATCCGTGG...ATCGAGCCA.TACGATTGCACGCCG
More informationCS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
More informationLinkage & Crossing over
Linkage & Crossing over Linkage Hereditary units or genes which determine the characters of an individual are carried in the chromosomes and an individual usually has many genes for the determination of
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationContent Objectives Write these down!
Content Objectives Write these down! I will be able to identify: Key terms associated with Mendelian Genetics The patterns of heredity explained by Mendel The law of segregation The relationship between
More informationIntroducCon to Experimental Design of Sequencing Based Studies. Michael C. Zody Workshop on Genomics Cesky Krumlov January 15, 2014
IntroducCon to Experimental Design of Sequencing Based Studies Michael C. Zody Workshop on Genomics Cesky Krumlov January 15, 2014 LogisCcs IntroducCon Please feel free to ask quescons at any point Slides
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationChapter 14: Mendel and the Gene Idea
Chapter 4: Mendel and the Gene Idea. The Experiments of Gregor Mendel 2. Beyond Mendelian Genetics 3. Human Genetics . The Experiments of Gregor Mendel Chapter Reading pp. 268-276 TECHNIQUE Parental generation
More informationGenome Scanning by Composite Likelihood Prof. Andrew Collins
Andrew Collins and Newton Morton University of Southampton Frequency by effect Frequency Effect 2 Classes of causal alleles Allelic Usual Penetrance Linkage Association class frequency analysis Maj or
More informationOur motivation for a NGS/MPS SNP panel
Increasing the power in paternity and relationship testing utilizing MPS for the analysis of a large SNP panel Ida Grandell 1, Andreas Tillmar 1,2 1 Department of Forensic Genetics and Forensic Toxicology,
More informationQTL Mapping, MAS, and Genomic Selection
QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationSupplementary Materials
Supplementary Materials Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers Hongxing Zhang 1, Yun Zhai 1, Zhibin
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationSAMPLE MIDTERM QUESTIONS (Prof. Schoen s lectures) Use the information below to answer the next two questions:
SAMPLE MIDTERM QUESTIONS (Prof. Schoen s lectures) Use the information below to answer the next two questions: Assume that high blood pressure is inherited as an autosomal dominant trait. You genotype
More informationLinkage Disequilibrium. Biostatistics 666
Linkage Disequilibrium iostatistics 666 Logistics: Office Hours Office hours on Mondays at 4 m. Room 4614 School of Public Health Tower Previously asic roerties of a locus llele Frequencies Genotye Frequencies
More informationCh. 14 Reminder: Unlinked Genes & Independent Assortment. 1. Cross: F1 dihybrid test cross: DO the Punnett Square
Ch. 14 Reminder: Unlinked Genes & Independent Assortment 1. Cross: F1 dihybrid test cross: DO the Punnett Square b + b vg + vg (gray body, normal wings) with bb vgvg (black body vestigial wings) 2. Results
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationCourse Announcements
Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)
More informationDan Geiger. Many slides were prepared by Ma ayan Fishelson, some are due to Nir Friedman, and some are mine. I have slightly edited many slides.
Dan Geiger Many slides were prepared by Ma ayan Fishelson, some are due to Nir Friedman, and some are mine. I have slightly edited many slides. Genetic Linkage Analysis A statistical method that is used
More information