Bioprinting living biofilms through optogenetic manipulation
|
|
- Nathan Merritt
- 5 years ago
- Views:
Transcription
1 Supporting Information Bioprinting living biofilms through optogenetic manipulation Yajia Huang,, Aiguo Xia,, Guang Yang, *, and Fan Jin *, Department of Biomedical Engineering, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, , PR China Hefei National Laboratory for Physical Sciences at the Microscale, Department of Polymer Science and Engineering, CAS Key Laboratory of Soft Matter Chemistry, University of Science and Technology of China, Hefei , PR China; * Corresponding author yang_sunny@yahoo.com or fjinustc@ustc.edu.cn. These authors contributed equally to this work. Table of Contents Additional Methods Page 2 Figure S1-S7 Page 3 9 Movie S1-S2 Page Table S1 Page 12 Reference Page 13 1 / 13
2 Additional Method Construction of Optogenetic and c-di-gmp Reporter Strain in P. aeruginosa Insertion mutant bphs with bpho or blrp1was constructed by mini-ctx or mini-tn7 system using a modified procedures for P. aeruginosa. 1, 2 We constructed unmarked insertion mutants by Flp-mediated excision of the antibiotic resistance marker. 3 First, bphs with bpho fragment obtained from the plasmid pind4-bphs 4 was cloned into the vector mini-ctx2 with the P A1/O4/O3 promoter in the upstream of MCS via a two-piece ligation, while blrp1 fragment obtained from gene synthesis in Sangon Biotech was cloned into the vector mini-tn7 with the constitutive promoter J23100 in the upstream of MCS via overlap PCR. The constructed plasmids were electroporated into PAO1 and constructed strain respectively and the corresponding recombinant strains via mini-ctx2 or mini-tn7 were identified by screening on LB agar plates containing 1mM IPTG and 100 μg ml -1 tetracycline or 30 μg ml -1 gentamycin. Then the strains were electroporated with a pflp2 plasmid and distinguished on LB agar plates containing 5% (w/v) sucrose for the excision of the resistance marker. The c-di-gmp reporter plasmid was constructed as the same procedures mentioned above. The c-di-gmp reporter plasmid was electroporated into bphs-blrp1 insertion mutant to monitor the intercellular c-di-gmp levels. The constructed plasmids and strains are listed on the Table S1. 2 / 13
3 Figure S1. Schematical showing the setup used in the bioprinting. Strain PAO1-bphS-blrP1-reporter was continuously cultured in a flow cell with a constant flow rate of 3.0 ml h -1. Meanwhile, four letters U S T C are microprojected onto the cover glass through a 20x oil objective, where 632 nm illuminations elevate the c-di-gmp levels that allows cells to attach to the surface, whereas 434 nm illuminations decrease the c-di-gmp levels that allows cells to detach from the surface. 3 / 13
4 Figure S2. Optimization of blue-illunimations for the bioprinting. Representative fluorescent images show how the strain PAO1-bphS-blrP1-reporter self-organized to form the T -pattern at the first 6 h using different power densities of blue illuminations ((a-d): 36.0 µw cm -2, 12.8 µw cm -2, 1.6 µw cm -2, 0 µw cm -2 ), where the red-illumination remain a constant power density (10.1µw cm -2 ). (e) Representative fluorescent images show how the strain PAO1-bphS-reporter self-organized to form the T -pattern at the first 6 h in the presence of a constant illumination of red-light (10.1 µw cm -2 ). Images with green or red color represent the images arising from sfgfp or CyOFP1 channel, respectively. Scale bar is 100 μm. 4 / 13
5 Figure S3. Optimization of red-illunimations for the bioprinting. Representative fluorescent images show how the strain PAO1-bphS-blrP1-reporter self-organized to form the T -pattern at the first 6 h using different power densities of red illuminations ((a-e): 26.6 µw cm -2, 10.1 µw cm -2, 5.0 µw cm -2, 2.7 µw cm -2, 0 µw cm -2 ), where the blue-illumination remained a constant power density (6.4 µw cm -2 ). Images with green or red color represent the images arising from sfgfp or CyOFP1 channel, respectively. Scale bar is 100 μm. 5 / 13
6 Figure S4. Optimization of projected pattern for the bioprinting. (a) Representative fluorescent images show how the strain PAO1-bphS-blrP1-reporter self-organized to form the T -pattern at the first 6 h using an inverted illumination, where blue-light ( 6.4 µw cm -2 ) was projected onto the letter and red-light was (10.1 µw cm -2 ) projected onto the complementary area. Representative fluorescent images show that the strain PAO1-reporter cannot self-organized to form the T -pattern at the first 6 h (b) in the presence of the illumination (red: 26.6 µw cm -2 and blue: 36 µw cm -2 ) or in the dark (c). Images with green or red color represent the images arising from sfgfp or CyOFP1 channel, respectively. Scale bar is 100 μm. 6 / 13
7 Figure S5. Representative bright-field images show the illuminated patterns of (a) red-light (632nm) or (b) blue-light (434nm) on a cover glass, where color maps indicated the averaged illumination densities used in the bioprinting. Scale bars in both panel a and b are 100 μm. 7 / 13
8 Figure S6. Optimization of inoculation cell densites for the bioprinting. Representative fluorescent images show how the strain PAO1-bphS-blrP1-reporter self-organized to form the T -pattern at the first 6 h using different inoculation cell densities ((a): cells cm 2, (b): cells cm 2, (c): cells cm 2 respectively), where the blue- and red-illumination remain a constant power density (blue: 6.4 µw cm -2 and red: 10.1 µw cm -2 ). Images with green or red color represent the images arising from sfgfp or CyOFP1 channel, respectively. Scale bar is 100 μm. 8 / 13
9 Figure S7. Optimization of circulating rate and carbron source for the bioprinting. Representative fluorescent images show how the strain PAO1-bphS-blrP1-reporter self-organized to form the T -pattern at the first 6 h using different circulating rate ((a): 3 ml h -1, (b): 5mL h -1 ) or different carbon source ((a,b): glutamate 0.6 mm, (c): succinate 0.6 mm), where the blue- and red-illumination remained a constant power density (blue: 6.4 µw cm -2 and red: 10.1 µw cm -2 ). Images with green or red color represent the images arising from sfgfp or CyOFP1 channel, respectively. Scale bar is 100 μm. 9 / 13
10 Movie S1. P. aeruginosa cells self-organized to form patterned biofilms in the presence of prescribed illuminations of U S T C during 6 h. Scale bar here is 100 μm. 10 / 13
11 Movie S2. 3D reconstructed image shows the successful bioprinting of living P. aeruginosa biofilms accorded to the prescribed illumination of T during 20 h. 11 / 13
12 Table S1. (Strains, plasmids, and primers used in this study) Description Source Strains PAO1 PAO1-reporter Wild type P. aeruginosa strain PAO1 with c-di-gmp reporter plasmid J.D. Shrout This study PAO1-bphS-blrP1 bphs and blrp1 derivative of PAO1 This study PAO1-bphS-blrP1-reporte r PAO1-bphS-reporter bphs and blrp1 derivative of PAO1 with c-di-gmp reporter plasmid bphs derivative of PAO1 with c-di-gmp reporter plasmid This study This study Plasmids mini-ctx2-bphs mini-tn7-blrp1 pucp20-pcdra-gfp-t-c yofp1 ptns2 pind4-bphs mini-ctx2 puc18t-mini-tn7t-gm pflp2 Tet r ; insertion of bphs with PA1/O4/O3 promoter constructed by PCR and cloned to HindIII/SpeI sites of mini-ctx2 Ap r, Gm r ; insertion of blrp1 with J23100 promoter constructed by PCR and cloned to HindIII/SpeI sites of mini-tn7 Gm r ; c-di-gmp reporter plasmid with an internal control based on pucp20 Ap r ; a helper plasmid for mini-tn7 site-specific transposition system plasmid carrying the bphs gene Tet r ; tet-frt-attp- MCS, ori, int, and orit Ap r, Gm r ; on mini-tn7t; orit on puc18 Ap r ; source of Flp recombinase This study This study 5 6, 7 4, 8, 9 1 2, 7 3 Primers Sequence bphs-hindiii-for 5 -GCCAAGCTTATGGCTAGAGGGTGCCTCAT-3 This study bphs-spei-rev 5 -GCCACTAGTTCCTTCATACCCGCCGGG-3 This study blrp1-hindiii-for 5 -GAGATAAGCTTTTGACGGCTAGCTCAGTCCT-3 This study blrp1-spei-rev 5 -GAGATACTAGTTTACAGGTCCATGGCCTGGC-3 This study sfgfp-hindiii-for 5 -GAGATAAGCTTTGGAAGGTTCCTTGGCGGCA-3 This study sfgfp-kpni-rev 5 -GAGATGGTACCTTATTTGTATAGTTCATCCATGCCATGTG- This study 3 CyOFP1-SacI-For 5 -GAGATGAGCTCGTATTAAAGAGGGGCGTGGG-3 This study CyOFP1-EcoRI-Rev 5 -GAGATCGAATTCAGGAAACAGCTATGACATGATTAC-3 This study 12 / 13
13 References [1] Hoang, T. T., Kutchma, A. J., Becher, A., and Schweizer, H. P. (2000) Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains, Plasmid 43, [2] Choi, K.-H., and Schweizer, H. P. (2006) mini-tn7 insertion in bacteria with single atttn7 sites: example Pseudomonas aeruginosa, Nat. Protoc. 1, 153. [3] Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J., and Schweizer, H. P. (1998) A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants, Gene 212, [4] Ryu, M. H., and Gomelsky, M. (2014) Near-infrared light responsive synthetic c-di-gmp module for optogenetic applications, ACS Synth. Biol. 3, [5] Rybtke, M. T., Borlee, B. R., Murakami, K., Irie, Y., Hentzer, M., Nielsen, T. E., Givskov, M., Parsek, M. R., and Tolker-Nielsen, T. (2012) Fluorescence-based reporter for gauging cyclic di-gmp levels in Pseudomonas aeruginosa, Appl. Environ. Microbiol. 78, [6] Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C., Bosio, C. M., Karkhoff-Schweizer, R. R., and Schweizer, H. P. (2005) A Tn7-based broad-range bacterial cloning and expression system, Nat. Methods 2, 443. [7] Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C., Bosio, C. M., Karkhoff-Schweizer, R. R., and Schweizer, H. P. (2005) A Tn7-based broad-range bacterial cloning and expression system, Nat. Methods 2, [8] Hu, Y., Wu, Y., Mukherjee, M., and Cao, B. (2017) A near-infrared light responsive c-di-gmp module-based AND logic gate in Shewanella oneidensis, Chem. Commun. 53, [9] Ind, A. C., Porter, S. L., Brown, M. T., Byles, E. D., de Beyer, J. A., Godfrey, S. A., and Armitage, J. P. (2009) Inducible-Expression Plasmid for Rhodobacter sphaeroides and Paracoccus denitrificans, Appl. Environ. Microbiol. 75, / 13
Near-infrared light responsive c-di-gmp module-based AND logic gate in Shewanella oneidensis
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Near-infrared light responsive c-di-gmp module-based AND logic gate in Shewanella oneidensis Yidan
More informationSupplementary Methods. Derivation of new FRT cassette and Flp expression vectors. The FRT cassette vector pfrt2
Supplementary Methods Derivation of new FRT cassette and Flp expression vectors. The FRT cassette vector pfrt2 (for a listing of most plasmids constructed in this study and GenBank accession numbers see
More informationConstruction of a Broad-Host Range Tn7-based Vector for Single Copy P BAD Controlled
1 2 Construction of a Broad-Host Range Tn7-based Vector for Single Copy P BAD Controlled Gene Expression in Gram-Negative Bacteria 3 4 5 6 7 8 9 10 11 12 13 14 15 F. Heath Damron 1, Elizabeth S. McKenney
More informationReading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
More informationCompetent cells formation &Transformation of competent cells with recombinant plasmid DNA. BCH462- Practical
Competent cells formation &Transformation of competent cells with recombinant plasmid DNA BCH462- Practical Cell-based technique used to create copies of certain DNA fragments using a vector carrying the
More informationA-PG hydrolysis by PA0919
SUPPORTING INFORMATION Identification and characterization of a periplasmic Aminoacyl-Phosphatidylglycerol Hydrolase responsible for Pseudomonas aeruginosa lipid homeostasis* Wiebke Arendt 1, Maike K.
More informationFigure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
More informationSupporting information
Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),
More informationΔsig. ywa. yjbm. rela -re. rela
A wt A. A, P rela -re la A/Δ yjbm A/Δ ywa C A, P hy-s igd, D (A, P IPTG hy-s igd, ) D D (+ IPTG ) D/Δ rela Figure S1 SigD B. Figure S1. SigD levels and swimming motility in (p)ppgpp synthetase mutants.
More informationGenetics Lecture Notes Lectures 13 16
Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/315/5819/1709/dc1 Supporting Online Material for RISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, Christophe Fremaux, Hélène Deveau,
More informationAP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants
What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics
More informationCLONING AND EXPRESSION OF PSEUDOMONAS AERUGINOSA PA01 GENES IN E.COLI DH5Α FOR THE DETECTION OF ARSENIC IN CONTAMINATED WATER SAMPLE
CLONING AND EXPRESSION OF PSEUDOMONAS AERUGINOSA PA01 GENES IN E.COLI DH5Α FOR THE DETECTION OF ARSENIC IN CONTAMINATED WATER SAMPLE A report Submitted to KSCST for 40 th series of SPP 2017 Project Proposal
More informationpget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl
www.smobio.com Product Information GetClone PCR Cloning Vector CV1000 20 RXN pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl Storage -20 C for 24 months Features
More informationHetero-Stagger PCR Cloning Kit
Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationProduct Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months
www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationChapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRecombinant DNA. Lesson Overview. Lesson Overview Recombinant DNA
Lesson Overview 15.2 Finding Genes In 1987, Douglas Prasher, a biologist at Woods Hole Oceanographic Institute in Massachusetts, wanted to find a specific gene in a jellyfish that codes for a molecule
More informationHiPer Plasmid DNA Cloning Teaching Kit
HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationBroad-Host-Range cre-lox System for Antibiotic Marker Recycling in Gram-Negative Bacteria INTRODUCTION
Research Report Broad-Host-Range cre-lox System for Antibiotic Marker Recycling in Gram-Negative Bacteria BioTechniques 33:1062-1067 (November 2002) Christopher J. Marx and Mary E. Lidstrom University
More informationContents. 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA Introduction Principle...
Contents 1 Basic Molecular Microbiology of Bacteria... 1 Exp. 1.1 Isolation of Genomic DNA... 1 Introduction... 1 Principle... 1 Reagents Required and Their Role... 2 Procedure... 3 Observation... 4 Result
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationHE Swift Cloning Kit
HE Swift Cloning Kit For high-efficient cloning of PCR products either blunt or sticky-end Kit Contents Contents VTT-BB05 phe Vector (35 ng/µl) 20 µl T4 DNA Ligase (3 U/µl) 20 µl 2 Reaction Buffer 100
More informationGenome engineering and direct cloning of antibiotic gene clusters via phage BT1
Genome engineering and direct cloning of antibiotic gene clusters via phage BT1 integrase-mediated site-specific recombination in Streptomyces Deyao Du a,b#, Lu Wang a,c#, Yuqing Tian a, Hao Liu c, Huarong
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationMolecular Biology Techniques Supporting IBBE
Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning
More informationSupplementary Material. Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological
Supplementary Material Increased heterocyst frequency by patn disruption in Anabaena leads to enhanced photobiological hydrogen production at high light intensity and high cell density Applied Microbiology
More informationBIO440 Genetics Laboratory Transformation
BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920
More informationSupporting Information
Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct
More informationSupporting Information. Sequence Independent Cloning and Posttranslational. Enzymatic Ligation
Supporting Information Sequence Independent Cloning and Posttranslational Modification of Repetitive Protein Polymers through Sortase and Sfp-mediated Enzymatic Ligation Wolfgang Ott,,, Thomas Nicolaus,,
More information7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More information7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I
7.03, 2005, Lecture 20 EUKARYOTIC GENES AND GENOMES I For the last several lectures we have been looking at how one can manipulate prokaryotic genomes and how prokaryotic genes are regulated. In the next
More informationOrthogonal Ribosome Biofirewall
1 2 3 4 5 Supporting Information Orthogonal Ribosome Biofirewall Bin Jia,, Hao Qi,, Bing-Zhi Li,, Shuo pan,, Duo Liu,, Hong Liu,, Yizhi Cai, and Ying-Jin Yuan*, 6 7 8 9 10 11 12 Key Laboratory of Systems
More informationSTANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).
STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat
More informationSCREENING AND PRESERVATION OF DNA LIBRARIES
MODULE 4 LECTURE 5 SCREENING AND PRESERVATION OF DNA LIBRARIES 4-5.1. Introduction Library screening is the process of identification of the clones carrying the gene of interest. Screening relies on a
More informationSynthetic Biology for
Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids
More informationA universal chassis plasmid pwh34 was first constructed to facilitate the
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction
More informationBiofilm-forming bacteria are increasingly recognized as a serious
Fluorescence-Based Reporter for Gauging Cyclic Di-GMP Levels in Pseudomonas aeruginosa Morten T. Rybtke, a Bradley R. Borlee, b * Keiji Murakami, b Yasuhiko Irie, b Morten Hentzer, c Thomas E. Nielsen,
More informationThe GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationChapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationIntroduction to pglo lab
Please take these notes carefully. You do not need to write anything in RED Introduction to pglo lab Bacteria Transformation What is a plasmid? A plasmid is a small circular piece of DNA (about 2,000 to
More informationThe demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationChapter 10 (Part I) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part I) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. From which types of organisms were most restriction
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationComputational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
More informationMucin Biopolymers Prevent Bacterial Aggregation by Retaining Cells in the Free-Swimming State
Current Biology, Volume 22 Supplemental Information Mucin Biopolymers Prevent Bacterial Aggregation by Retaining Cells in the Free-Swimming State Marina Caldara, Ronn S. Friedlander, Nicole L. Kavanaugh,
More informationBiotechnology and Energy Conservation. Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman
Biotechnology and Energy Conservation Prof. Dr.oec.troph. Ir. Krishna Purnawan Candra, M.S. Program Magister Ilmu Lingkungan Universitas Mulawarman 12 th Lecture Genetic Engineering The Aim: Students can
More informationStep 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:
Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)
More informationA subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationUse of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
More informationThe PA14 Non-Redundant Set of Pseudomonas aeruginosa Transposon Insertion Mutants. USERS MANUAL (version 1.0)
The PA14 Non-Redundant Set of Pseudomonas aeruginosa Transposon Insertion Mutants USERS MANUAL (version 1.0) Nicole T. Liberati, Tara K. Holmes*, Eliana Drenkard, Frederick M. Ausubel Department of Molecular
More informationStrain, plasmid, primer or dsdna fragment Relevant genotype, description, or sequence
Supplemental Tables Table S1. Strains, Plasmids, Primers and dsdna fragments used in this study Strain, plasmid, primer or dsdna fragment Relevant genotype, description, or sequence Reference or Source
More informationBiotechnology. Biotechnology is difficult to define but in general it s the use of biological systems to solve problems.
MITE 2 S Biology Biotechnology Summer 2004 Austin Che Biotechnology is difficult to define but in general it s the use of biological systems to solve problems. Recombinant DNA consists of DNA assembled
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More informationmod-1::mcherry unc-47::gfp RME ser-4::gfp vm2 vm2 vm2 vm2 VNC
A mod-1::mcherry unc-47::gfp RME B ser-4::gfp vm2 vm2 VNC vm2 vm2 VN Figure S1 Further details of mod- 1 and ser- 4 reporter expression patterns. (A) Adult head region showing mod- 1::mCherry and unc-
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationExploring STEAM with Transformation
Exploring STEAM with Transformation Thomas Cynkar Edvotek www.edvotek.com Follow @Edvotek EDVOTEK Biotech The Biotechnology Education Company Celebrating 30 years of science education! EDVOTEK Educatio
More informationExperimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
More informationAntibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)
G01066 pfbaavmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 860-955 mcs 956-1542 wtires 1543-2253 mcherry 2268-2481 BgHpA
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationMaterials and methods. by University of Washington Yeast Resource Center) from several promoters, including
Supporting online material for Elowitz et al. report Materials and methods Strains and plasmids. Plasmids expressing CFP or YFP (wild-type codons, developed by University of Washington Yeast Resource Center)
More informationSupporting Information
Supporting Information Gómez-Marín et al. 10.1073/pnas.1505463112 SI Materials and Methods Generation of BAC DK74B2-six2a::GFP-six3a::mCherry-iTol2. BAC clone (number 74B2) from DanioKey zebrafish BAC
More informationUnit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
More informationBCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA.
Lab#2 BCH 462 Competent Cells Formation and Transformation of Competent Cells with plasmid DNA. Outlines: 1-Insertion of foreign gene to the plasmid. 2-Competent cell. 3-Transformation of bacterial cell.
More informationFROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE
Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND
More informationAntibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)
G01067 pfbaavcagmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 938-2607 CAG 2600-2685 mcs 2687-3273 wtires 3274-3984 mcherry
More informationGene Cloning & DNA Analysis
CSS451 CSS/HRT 451 Gene Cloning & DNA Analysis Chapter 4-5 T-DNA LB auxin cytokin opine Oncogenic genes RB vir genes ori opine catabolism Guo-qing Song Part 1 Basic principles Gene Cloning & DNA Analysis
More informationCHE.167 Genetics. Bacterial Plasmids
1 Bacterial Plasmids Open circular form Covalently closed circles (ccc-form) 2 Bacterial plasmids Replication, Maintenance Genes for specific functions Replication - Origin of replication (oriv) - Regulatory
More informationChapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
More informationBring a Molecular Cell Biology Laboratory into the Classroom of HKUST
Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Prof. Kathy Q. Luo and Prof. Donald C. Chang Dept. of Chemical Engineering, Bioengineering Graduate Program and Dept. of Biology HK
More informationCloning a Fluorescent Gene
Cloning a Fluorescent Gene Laboratory Protocols Handout v1.10 Table of Contents Lab 1: Pipettes and Pipetting... 2 Lab 2: Polymerase Chain Reaction... 5 Lab 3: Ligation... 7 Lab 4: Transformation... 9
More informationTABLE S1. Sequences of the primers used for RT-PCR and PCR
TABLE S1. Sequences of the primers used for RT-PCR and PCR Primer Sequence (5 to 3 ) Purpose Cloning: posuprtid-1 & posuprtid-2 deletion plasmids DM01 AGCTCCAGCGGGTCGCCGGGGTTGGCC DM02 CCAGCGGGTCGCCGGGGTTGGCC
More informationChapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
More informationPackaging of P22 DNA requires a pac site while packaging of lambda DNA requires a cos site. Briefly describe:
1). (12 Points) Packaging of P22 DNA requires a pac site while packaging of lambda DNA requires a cos site. Briefly describe: 1. The mechanisms used by P22 and lambda to package DNA. P22 uses a headfull
More information- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
More informationRestriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.
Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs
More informationONTARIO SCIENCE CENTRE. Teacher Guide. Way to Glow Program
ONTARIO SCIENCE CENTRE Teacher Guide Way to Glow Program Table of Contents Bacterial transformation background information 3 Experimental procedure 5 Expected results 7 Post-program activity sheet 8 Post-program
More informationHigh-Frequency Flp Recombinase-Mediated Inversions of the oric-containing Region of the Pseudomonas aeruginosa Genome
JOURNAL OF BACTERIOLOGY, Dec. 2000, p. 7070 7074 Vol. 182, No. 24 0021-9193/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. High-Frequency Flp Recombinase-Mediated Inversions
More informationDNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
More informationb) Is it possible for females to get hemophilia? If yes, explain how. If no, explain why not.
Question 3, continued a) What is the mode of inheritance of hemophilia? b) Is it possible for females to get hemophilia? If yes, explain how. If no, explain why not. All four of Alexei s sisters are depicted
More informationA) (5 points) As the starting step isolate genomic DNA from
GS Final Exam Spring 00 NAME. bub ts is a recessive temperature sensitive mutation in yeast. At º C bub ts cells grow normally, but at º C they die. Use the information below to clone the wild-type BUB
More informationSupplementary figures
Supplementary figures A ΔrelAΔlon ΔrelA ΔrelAΔlon Δlon ppgpp 0 Δlon B ΔrelAΔlon ΔrelA ΔrelAΔlon Δlon ppgpp 0 Δlon Fig. S1. Growth defect of strains in LB medium. Strains whose relevant genotypes are indicated
More information7.02/ RECOMBINANT DNA METHODS EXAM KEY
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the
More informationCopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution
CopyCutter EPI400 Electrocompetent E. coli CopyCutter EPI400 Chemically Competent E. coli CopyCutter Induction Solution Cat. Nos. C400EL10, C400CH10, and CIS40025 Available exclusively thru Lucigen. lucigen.com/epibio
More informationArsenite oxidation regulator AioR regulates bacterial chemotaxis towards. arsenite in Agrobacterium tumefaciens GW4
1 2 Arsenite oxidation regulator AioR regulates bacterial chemotaxis towards arsenite in Agrobacterium tumefaciens GW4 3 4 5 Kaixiang Shi 1, Xia Fan 1, Zixu Qiao 1, Yushan Han 1, Timothy R. McDermott 2,
More informationCombinatorial Evolution of Enzymes and Synthetic pathways Using
Supplementary data Combinatorial Evolution of Enzymes and Synthetic pathways Using One-Step PCR Peng Jin,, Zhen Kang,,, *, Junli Zhang,, Linpei Zhang,, Guocheng Du,, and Jian Chen, The Key Laboratory of
More information