Applying CRISPR in Environmental Health Research: From Cells to Human Populations Luoping Zhang
|
|
|
- April Horn
- 5 years ago
- Views:
Transcription
1 NASEM Workshop: The Promise of Genome Editing Tools in EHR Washington, D.C. January 10-11, 2018 Applying CRISPR in Environmental Health Research: From Cells to Human Populations Luoping Zhang School of Public Health University of California, Berkeley
2 Major Genome Editing Tools ZFNs (Zinc Finger Nucleases) nuclease TALENs (Transcription Activator- Like Effector Nucleases) CRISPR/Cas Systems Gaj T, et al. Trends in Biotech, 31: , /can-the-cas9involved-on-the-crisprcas9-mechanism-be-considered-as-a-restric
3 CRISPR Applications: CRISPR Screening Technique Identifies 100 Genes Essential for Cancer Immunotherapy Patel SJ et al., Nature 548: , Develop new cancer treatments Precision medicine Destroy viruses Gene silencing and amplification CRISPR Engineer plants to improve food security Toxicity testing Reduce reliance on petrochemicals CRISPR gene editing applied in a yeast strain or an alga that can produce new or more precursors for sustainable biofuels. Schwartz CM et al., ACS Synth Biol, 5: , Ajjawi I et al., Nature Biotechnology, 35: , 2017.
4 The 21 st Century Toxicity Testing New emerging technologies such as array-based toxicogenomics are indeed needed to better predict chemical toxicity.
5 Blooming CRISPR Applications CRISPR Publication Growth from CRISPR CRISPR and Environmental Health Keywords Used: CRISPR; CRISPR and Environmental Health, by 1/5/2018
6 CRISPR in Environmental Health Research
7 Individual susceptibility can be modified by genetic variation Variations contained in genes could make some people more susceptible than others Toxicant Exposure More Susceptible Superfund Research Program at UC Berkeley: Project 2: Functional profiling of susceptibility genes Less Susceptible
8 Progress of Chemical Toxicity Testing Put Genome Editing into the Toxicogenomics Functional Genomic Screening: - Parallel deletion analysis in yeast (with RNAi) - Haploid human cell line (KBM7) - CRISPR in human cells Novel CRISPR Approach: from cells to humans Shen H, et al. Mut Res Rev, 764: 31-42, 2015.
9 Approach of Toxicity Testing by CRISPR in EHS
10 Genome-wide CRISPR Screening CRISPRi: interference loss-of-function CRISPRa: activation gain-of-function Identify responsive candidate genes Kampmann M, Trends in Mol Med, 23: , 2017 ChemComm, DOI: /c7cc02349a, 2017
11 Strategies for Pooled Genome Screens by CRISPRi/a Kampmann M, ACS Chem Biol, 2018 (epub ahead of print)
12 Genome-Scale CRISPRi/a Screens in Human Cells Kampmann M, ACS Chem Biol, 2017 (epub ahead of print)
13 CRISPRi/a Sub-Libraries Available at UC Berkeley IGI (Innovative Genomics Institute: The total of 7 paired subsets of CRISPRi and CRISPRa libraries are currently available to all researchers. For further information, please contact Mary West: mwest@berkeley.edu
14 Targeted Approach: ToxCRISPR Target on a single gene (e.g. FANCD2) Target on a group of genes (specific pathways or cell functions, e.g. IGI s 7 sets) ToxCRISPR: Tox-related 3675 genes - NIEHS_NTP_Tox21 (prioritized S1500+ genes) - Environmental Genome Project (~650 genes) - Selected toxicant-response focused genes Targeted approach for screening or validation
15 Validate Candidate Genes in Human Cells Importance to confirm response genes to toxin exposures Multiple means to validate candidate genes: - Repeat genome-wide screens (?) - Look for multiple hits on the same gene - Targeted screens (single, multi-gene, subsets as ToxCRISPR) Biostatistic and bioinformatic analysis: Gene selection Pathway analysis: New discovery of Mechanisms of action Functional and mechanistic validation: How?
16 Functional and Mechanistic Validation Test in vitro Examine specific biological function in a targeted CRISPRi/a cell line; Explore the potential mechanisms involved; and Develop new biomarkers for future human studies. Confirm in vivo Functional SNPs analysis in humans; Examine the biological roles of the genes identified; and Explore the new mechanistic biomarkers.
17 Applying CRISPR in Environmental Health Research Promises The approach (from cells to humans) has been tested previously; Multiple approaches (genome-scale or targeted, and, in vitro or in vivo) are available; and CRISPR technology is feasible and approved as an effective, flexible and readily applied genome-editing tool. Challenges Infancy stage: Need to explore more ways in more areas of EHR OTE: Need to increase the fidelity of CRISPR/Cas system Data quality controls and better bioinformatic method development Limited funding source
18 Summary of CRISPR Application in EHR Genome-Wide CRISPRi/a Screens in Human Cells Targeted Approach to Screen or Validate Candidate Genes ToxCRISPR Biostatistics & Bioinformatics: Gene and Pathway Analyses Test Functional Roles and Mechanisms in Human Cells Examine SNPs of Validated Genes and their Functions in Human Studies
19 Thanks Chris Vulpe Jacob Corn Martyn Smith Hua Shen Amin Sobh Pamela Chew Cliona McHale Quan Lu
20 Remaining Questions for CRISPR Application in EHR What are critical knowledge gaps about these genome-editing tools that need to be addressed? - Do we know any? What are other potential applications of CRISPR (method & data) in human studies? - Besides SNPs and functional role clarification, CRISPR will help to discover more new biomarkers and relevant mechanisms of action What is our ultimate goal to apply CRISPR in EHR? - Increase the accuracy/speed of toxicity testing - Enhance our understanding of mechanisms of action - Explore how to improve risk assessment
21 How to Apply CRISPR into Risk Assessment?
22 PDA quantifies relative abundance of each strain in pool Deletion strains Growth with test compound for defined number of generations Probe Affymetrix TAG4 microarray with amplified barcodes Copies of genomic DNA Hybridization signal intensity is proportional to growth Quantify and determine sensitivity of strains by comparing to untreated controls PDA reviewed in North and Vulpe Int. J. Mol. Sci. 11(12):
23 Near Haploid Genetic Screens: Human Leukemia Cell Line (KBM7) Originally from a patient with leukemia (CML) Unique with haploid karyotype except for chromosome 8 Insertional mutagenesis by gene trap virus to inactivate most of nonessential genes null mutants Tested for drugs, influenza Limitation: near genome-wide, karyotype unstable Carette et al. Science. 326(5957):1231-5, 2009.
24 CRISPR in Environmental Health
25 CRISPR in Environmental Health Sciences
Barley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services
Genome Editing Technology - Principle -
Effective Date: 31.10.2017 Doc ID: 20290213 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Genome Editing Technology - Principle - Rationale Genome editing is
New Plant Breeding Technologies
New Plant Breeding Technologies Ricarda A. Steinbrecher, PhD EcoNexus / ENSSER Berlin, 07 May 2015 r.steinbrecher@econexus.info distributed by EuropaBio What are the NPBTs? *RNAi *Epigenetic alterations
Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.
Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred
Research techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
Challenges for the Governance of Synthetic Biology and Implications for UN Security Council resolution 1540 (2004)
Challenges for the Governance of Synthetic Biology and Implications for UN Security Council resolution 1540 (2004) Nancy Connell, PhD Johns Hopkins Center for Health Security US-NAS Board on Life Sciences
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms
Bayer Pharma s High Tech Platform integrates technology experts worldwide establishing one of the leading drug discovery research platforms Genomics Bioinformatics HTS Combinatorial chemistry Protein drugs
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products
Introduction to CRISPR/Cas9 Background DNA Cleavage and Repair (NHEJ and HDR) Alternative Cas9 Variants Delivery of Cas9 and sgrna Library Products which one is right for you? CRISPR Workflow abm s Toolbox
Introduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
Introduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
Genome Editing Inventive Energy
Genome Editing Inventive Energy Top 10 Patent Classes Genome Editing Inventive Energy JUNE 2018 Crafitti Consulting Pvt Ltd www.crafitti.com 1 GENOME EDITING INVENTIVE ENERGY 2018 INTERNATIONAL PATENT
CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava
CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava Dr Patience Chatukuta Post-doctoral Fellow Plant Biotechnology Research Program, Wits University ACGT Forum, Wits Professional
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
Deoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform
This presentation contains forward-looking statements within the meaning of the "safe harbor" provisions of the Private Securities Litigation Reform Act of 1995, as amended. These forward-looking statements
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Integration of FDSS7000 into a modular robotic system for Open Innovation drug discovery
Integration of FDSS7000 into a modular robotic system for Open Innovation drug discovery José Manuel Brea & María Isabel Loza BioFarma, Santiago de Compostela DRUG DISCOVERY OPEN INNOVATION CLOSED innovation
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS
IMPROVEMENT OF CRISPR GENE EDITING EFFICIENCY AND BEYONDS YONGLUN LUO (ALUN) ALUN@BIOMED.AU.DK VIB, NOV. 21. 2017 Associate Professor, Department of Biomedicine, Aarhus University, Denmark Executive Director,
Introduction and History of Genome Modification. Adam Clore, PhD Director, Synthetic Biology Design
Introduction and History of Genome Modification Adam Clore, PhD Director, Synthetic Biology Design Early Non-site Directed Genome Modification Homologous recombination in yeast TARGET GENE 5 Arm URA3 3
Chapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
Pharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
ACHIEVING THE POTENTIAL OF GENOME EDITING. The perspective of the European Biotech Industry
ACHIEVING THE POTENTIAL OF GENOME EDITING The perspective of the European Biotech Industry JANUARY 2018 The European Union faces an opportunity to create headroom for innovation and continued investment
Introduction to Bioinformatics and Gene Expression Technology
Vocabulary Introduction to Bioinformatics and Gene Expression Technology Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 1.1 Gene: Genetics: Genome: Genomics: hereditary DNA
Image adapted from: National Human Genome Research Institute
Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An
Frumkin, 2e Part 1: Methods and Paradigms. Chapter 6: Genetics and Environmental Health
Frumkin, 2e Part 1: Methods and Paradigms Chapter 6: Genetics and Environmental Health Genetics Genetics, the study of individual genes, has expanded to include genomics, which is the study of all the
Personalized Human Genome Sequencing
Personalized Human Genome Sequencing Dr. Stefan Platz DABT, Global Head Drug Safety & Metabolism Biomedical research: strengths & limitations of non-animal alternatives 06 December 2016 The Human Genome
Genome editing: Principles, Current and Future Uses
enome editing: Principles, urrent and Future Uses Dr ndrew Wood University of Edinburgh alton Institute dvance in enetics onference June 28 th 2017 enome editing defined: a type of genetic engineering
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Expression Profiling for
RNAi Screen, NGS and Expression Profiling for Biomarker Discovery Namjin Chung Applied Genomics Bristol-Myers Squibb 2012 DOT Oct 2, 2012 Boston, MA Pharmacogenomics Study of the role of inheritance in
How Targets Are Chosen. Chris Wayman 12 th April 2012
How Targets Are Chosen Chris Wayman 12 th April 2012 A few questions How many ideas does it take to make a medicine? 10 20 20-50 50-100 A few questions How long does it take to bring a product from bench
Introduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
SUREGUIDE CRISPR LIBRARIES
SUREGUIDE CRISPR LIBRARIES Fidelity The Agilent Advantage Guide Representation Customization The Agilent Advantage Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be
Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology
Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions
SureGuide CRISPR Libraries
SureGuide CRISPR Libraries Fidelity The Agilent Advantage Guide Representation Customization Fidelity What is fidelity? Fidelity in DNA synthesis is simple to understand but can be difficult to achieve.
Biological Research Registration Form
Biological Research Registration Form The University of Oregon requires Institutional Biosafety Committee review and approval of research involving recombinant or synthetic nucleic acids (rsna), organisms
Genomics And Pharmacogenomics In Anticancer Drug Development And Clinical Response (Cancer Drug Discovery And Development)
Genomics And Pharmacogenomics In Anticancer Drug Development And Clinical Response (Cancer Drug Discovery And Development) Strategies for modern biomarker and drug - Oct 3, 2014 Sequencing the cancer genome
Reviewers' Comments: Reviewer #1 (Remarks to the Author)
Reviewers' Comments: Reviewer #1 (Remarks to the Author) In this study, Rosenbluh et al reported direct comparison of two screening approaches: one is genome editing-based method using CRISPR-Cas9 (cutting,
EC decision on gene editing and other new biotechnologies; what does it mean for researchers and plant breeders?
EC decision on gene editing and other new biotechnologies; what does it mean for researchers and plant breeders? Huw Jones PhD, FRSB Professor of Translational Genomics for Plant Breeding Institute of
Could benefit organic: High use in Hawaii has lowered virus levels to allow organic production. Herd immunity
Advances in Crop Biotechnology- Cisgenics and Genome Editing Michael M. Neff Ph.D. Thoughts from previous talk Many examples of GMO bacteria in medicine (e.g. insulin, taxol) and food (vitamins, chymosin
Unit 8: Genomics Guided Reading Questions (150 pts total)
Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 18 The Genetics of Viruses and Bacteria Unit 8: Genomics Guided
evaluate risk / benefit implications ascertain applicability of existing legislation
1 Scope & purpose Regulatory implications of NBTs evaluate risk / benefit implications ascertain applicability of existing legislation assess robustness of current regulatory framework and risk analysis
PROCEEDINGS 2017 Crop Pest Management Short Course & Minnesota Crop Production Retailers Association Trade Show
PROCEEDINGS 2017 Crop Pest Management Short Course & Minnesota Crop Production Retailers Association Trade Show Institute for Ag Professionals http://www.extension.umn.edu/agriculture/ag-professionals/
PS VI: Harvesting Innovation in Agriculture Patents & More
PS VI: Harvesting Innovation in Agriculture Patents & More Monday, 24 September 2018 14:00-15:30 g Moderator: Peter C. Schechter, Osha Liang LLP (Houston, Texas, USA) Roundtable Panelists: Dr. Eyal Bressler,
Dr. Gideon Coster. Cancer Biology Genome Replication
The Institute of Cancer Research PHD STUDENTSHIP PROJECT PROPOSAL: PROJECT DETAILS Project Title: When DNA becomes its own enemy - formation and resolution of toxic DNA structures during genome repeat
Yale University Biological Safety Committee
EHS Use Only Protocol#: Yale University Biological Safety Committee Send original to: Yale Environmental Health and Safety Occupational Health and Safety Section 135 College Street, Suite 100 New Haven,
PLNT2530 (2018) Unit 9. Genome Editing
PLNT2530 (2018) Unit 9 Genome Editing Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License Attribution Share-Alike 2.5 Canada 1 Genome Editing
Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
Course Agenda. Day One
Course Agenda BioImmersion: Biotech for the Non-Scientist A three-day, in-depth course that provides the background required for understanding today s fast-paced biotech marketplace. Beginning with an
Our website:
Biomedical Informatics Summer Internship Program (BMI SIP) The Department of Biomedical Informatics hosts an annual internship program each summer which provides high school, undergraduate, and graduate
Mayo Clinic Arizona/Rochester and U. Minnesota
Mayo Clinic Arizona/Rochester and U. Minnesota Overcoming Drug Resistance in Multiple Myeloma Project 1: Develop high throughput drug screening platform for myeloma cell lines and >500 primary patient
NIEHS and Data Integration
NIEHS and Data Integration Where We ve Been and Where We re Going Linda Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program Informing
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision
BIOHAZARD RISK ASSESSMENT
BIOHAZARD RISK ASSESSMENT NAME: DATE: TITLE OF ACTIVITY OR PROJECT: BRIEF DESCRIPTION OF THE BIOLOGICAL AND ITS TREATMENT: DURATION OF ACTIVITY OR PROJECT: FACILITY TO BE USED (Campus, Building and Room
Drosophila White Paper 2003 August 13, 2003
Drosophila White Paper 2003 August 13, 2003 Explanatory Note: The first Drosophila White Paper was written in 1999. Revisions to this document were made in 2000 and the final version was published as the
CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
Loomis/CBC Joint Symposium and Workshop Genome Editing Putting Together the Pieces Innovation and USDA Regulation of the Products of Biotechnology
Loomis/CBC Joint Symposium and Workshop Genome Editing Putting Together the Pieces Innovation and USDA Regulation of the Products of Biotechnology May 9, 2018 Sally L. McCammon Science Advisor Biotechnology
Challenges for biosafety in the rapid changing field of biotechnology
Challenges for biosafety in the rapid changing field of biotechnology Gijsbert van Willigen, PhD Coordinator CBRN Safety & Security LEIDEN UNIVERSITY MEDICAL HOSPITAL 1Insert > Header & footer 14-Apr-17
(Practical) Bioinformatics for CRISPR/Cas9
(Practical) Bioinformatics for CRISPR/Cas9 Jacob Corn IGI Workshop 2016 Bioinformatics is (mostly) things you could do yourself Just done very fast What makes these guides different? GAGTCCGAGCAGAAGAAGAA
Genome editing as a new powerful tool for wheat breeding
Genome editing as a new powerful tool for wheat breeding Vladimir Nekrasov 15 th WGIN Stakeholders Meeting Applying CRISPR Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana
Bi Lecture 3 Loss-of-function (Ch. 4A) Monday, April 8, 13
Bi190-2013 Lecture 3 Loss-of-function (Ch. 4A) Infer Gene activity from type of allele Loss-of-Function alleles are Gold Standard If organism deficient in gene A fails to accomplish process B, then gene
Genome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
Bio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
Genetics and Genomics in Medicine Chapter 9 Questions
Genetics and Genomics in Medicine Chapter 9 Questions Multiple Choice Questions Question 9.1 Which, if any, of the following can be classified as a type of augmentation therapy? a) Treatment using a small
CRISPR ways to understand gene-environment interactions
CHE Partnership call - April 2017 Gene Editing: Where Genomic Technologies Meet Environmental Health CRISPR ways to understand gene-environment interactions O O Mark Hahn with Neel Aluru, Sibel Karchner,
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE
MICROARRAYS: CHIPPING AWAY AT THE MYSTERIES OF SCIENCE AND MEDICINE National Center for Biotechnology Information With only a few exceptions, every
INTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS. Guy Cavet
INTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS Guy Cavet g.cavet@atreca.com PRECISION THERAPIES FROM THE ACTIVE IMMUNE RESPONSE Patient/Animal with Immune Response Immune Repertoire Capture
DNA METHYLATION RESEARCH TOOLS
SeqCap Epi Enrichment System Revolutionize your epigenomic research DNA METHYLATION RESEARCH TOOLS Methylated DNA The SeqCap Epi System is a set of target enrichment tools for DNA methylation assessment
Human Genomics. Higher Human Biology
Human Genomics Higher Human Biology Learning Intentions Explain what is meant by human genomics State that bioinformatics can be used to identify DNA sequences Human Genomics The genome is the whole hereditary
Systematic comparison of CRISPR/Cas9 and RNAi screens for essential genes
CORRECTION NOTICE Nat. Biotechnol. doi:10.1038/nbt. 3567 Systematic comparison of CRISPR/Cas9 and RNAi screens for essential genes David W Morgens, Richard M Deans, Amy Li & Michael C Bassik In the version
DNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
Genetic Engineering in Agriculture
Details Utah State University Engineering in This is a project resulting from the Engineering Workshop for Teachers to provide teaching materials for genetic engineering topics. Please direct any feedback
TECHNOLOGIES. 3/19/18 Kayla Nygaard. https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg
TECHNOLOGIES 3/19/18 Kayla Nygaard https://i.ytimg.com/vi/pxw5yya-kh0/maxresdefault.jpg CRISPR IN THE NEWS CRISPR in 2018: Coming to a Human Near You Sickle-cell treatment clinical trials CRISPR Therapeutics
Genomics Research Center: Current Status & Future Development
Genomics Research Center: Current Status & Future Development Introduction Research in the life sciences has entered a new era after completion of the human genome project and the sequencing of the genomes
New Plant Breeding Techniques: Zn Finger Nucleases and Transcription Factors
New Plant Breeding Techniques: Zn Finger Nucleases and Transcription Factors Andrew F. Roberts, Ph.D. Deputy Director, CERA September 19, 2013 Contents of the talk Old Plant Breeding Techniques and Biosafety
Genetic Engineering in Plants and the New Breeding Techniques (NBTs) Inherent risks and the need to regulate. Dr. Ricarda A.
info@econexus.info www.econexus.info Briefing December 2015 Genetic Engineering in Plants and the New Breeding Techniques (NBTs) Inherent risks and the need to regulate Dr. Ricarda A. Steinbrecher Summary
Introduction to Bioinformatics
Introduction to Bioinformatics Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com
Pioneering Clinical Omics
Pioneering Clinical Omics Clinical Genomics Strand NGS An analysis tool for data generated by cutting-edge Next Generation Sequencing(NGS) instruments. Strand NGS enables read alignment and analysis of
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms
Unit 2: Metabolism and Survival Sub-Topic (2.7) Genetic Control of Metabolism (2.8) Ethical considerations in the use of microorganisms Duncanrig Secondary JHM&MHC 2015 Page 1 of 18 On completion of this
RNA genes. Functional non-coding RNAs (ncrna) Jan 31 st 2018.
RNA genes Functional non-coding RNAs (ncrna) Jan 31 st 2018. After human genome sequencing it became obvious that human genome consists of many non-protein coding genes, genes that code for different RNAs
A universal chassis plasmid pwh34 was first constructed to facilitate the
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction
Investigating Compound Mechanism of Action
Investigating Compound Mechanism of Action Using Genetic Interaction Screens Lisa Marshall, Priya Mitty, Michael Ollmann, and Paul Kassner Michael Ollmann, Ph.D. Principal Scientist, Therapeutic Discovery
Authors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
Precision engineering of the plant genome. Sjef Smeekens Institute of Environmental Biology Utrecht University
Precision engineering of the plant genome Sjef Smeekens Institute of Environmental Biology Utrecht University Mutation breeding Molecular basis of traits, the Zea mays TGA1 example Mutation breeding using
RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS SUMMER
Project Code: MGY 1S RESEARCH OPPORTUNITY PROGRAM 299Y/399Y PROJECT DESCRIPTIONS 2018 2019 SUMMER Name and Title: Department: Amy A. Caudy, Associate Professor Molecular Genetics TITLE OF RESEARCH PROJECT:
CRISPR: hot, hot, hot
CRISPR: hot, hot, hot 166 CRISPR is the latest technique for genome engineering and is generating tons of excitement due to its versatility, high specificity, and ease of use. CRISPR stands for clustered
Department of Genetics
Department of Genetics Program Specific Outcomes (PSO) Program- MSc. Genetics (404) The course prepares students for pursuing further research and teaching. Key features: Students have high success rate
a previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite
SUPPLEMENTARY INFORMATION doi:1.138/nature9496 a 1 Relative RNA levels D12 female ES cells 24h Control sirna 24h sirna Oct4 5 b,4 Oct4 Xist (wt) Xist (mut) Tsix 3' (wt) Tsix 5' (wt) Beads Oct4,2 c,2 Xist
SureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
Overview and Summary of NABC 26 New DNA-Editing Approaches: Methods, Applications and Policy for Agriculture
Overview and Summary of NABC 26 New DNA-Editing Approaches: Methods, Applications and Policy for Agriculture OVERVIEW Recently developed technologies zinc finger nucleases (ZFNs), meganucleases (MNs),
Genomics and drug discovery. John Whittaker
Genomics and drug discovery John Whittaker Outline Background Motivation: success and failure in drug discovery Direction of travel Examples Genetics Genome scale experimentation 2 Background Supporting
Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
earray 5.0 Create your own Custom Microarray Design
earray 5.0 Create your own Custom Microarray Design http://earray.chem.agilent.com earray 5.x Overview Session Summary Session Summary Agilent Genomics Microarray Solution earray Functional Overview Gene
A Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
The Human Toxome Project a test case for pathway identification by multiomics. Thomas Hartung
The Human Toxome Project a test case for pathway identification by multiomics integration Thomas Hartung Mechanistic & evidence-based toxicology 2 Level of resolution Current state of the art Perturbed
Advances in Crop BiotechnologyCisgenics and Genome Editing
Advances in Crop BiotechnologyCisgenics and Genome Editing Michael M. Neff Ph.D. mmneff@wsu.edu Washington State University Department of Crop and Soil Sciences Molecular Plant Sciences Graduate Program
Synthetic Biological Systems
Synthetic Biological Systems 2. Synthetic Life and Genome Engineering 27/05/2010 Dr Tom Ellis 1 The construction of synthetic organisms Synthesising biological life will be a 21 st Century Grand Challenge