Resources and applications of TRC RNAi reagents in National RNAi Core Facility

Transcription

1 Resources and applications of TRC RNAi reagents in National RNAi Core Facility Lecturer: 林志隆 ( IMB&RNAi Core) 05/14/2009/AS

2 The Nobel Prize in physiology /medicine 2006 Goes to Professor Andrew Z Fire, Ph.D. Stanford University School of Medicine Stanford, CA. USA Professor Craig C. Mello, Ph.D. University of Massachusetts Medical School Worcester, MA, USA RNAi: A gene silencing by dsrna

3 RNA interference (RNAi) A form of post-transcriptional transcriptional gene silencing, mimicking the effect of loss-of of-gene-function. RNAi does not result in stable genetic changes; but in lower animal or plants, RNAi effects can be inherited for one or two generations.

4 Timeline of RNAi achievements Adapted from:

5 Dr. R Jorgensen s Experiment C Napoli, C Lemieux, and R Jorgensen Plant Cell April; 2(4): 279. Attempts to overexpress chalcone synthase by inserting multiple copies of that gene into the plant s genome. Purple plants should become purpler... Co-suppression: both endogenous and introduced genes silenced. PTGS but what is the causative factor? PTGS= Post-Transcriptional Gene ene Silencingilencing

6 PTGS in plants is due to small dsrna dsrna hypothesis explained this plant phenomenon Andrew J. Hamilton and David C. Baulcombe Science :

7 Nature 391, (19 February 1998)

8 Long dsrnas trigger non-specific silencing in mammalian dsrna C. elegans Drosophila In mammal? IFN response in mammalian system global gene silencing

9 dsrna-induced translation inhibition in mammalian Cytokine Growth Factor Rev :

10 How to Apply RNAi to Mammalian System?

11 Effector of RNAi 長雙股 RNA (long dsrna) cytosol Gregory Hannon identified the Dicer an enzyme that chops double-stranded RNA into little pieces. sirna small-interfering RNA; sirna Length of sirna: : 21 nts to 23 nts. - Nature. 2000;404:293-6; Nature. 2001;409:363-6

12 Nature 411, (24 May 2001)

13 What Does sirna Do

14 Biogenesis of RNAi DRCR8 Long dsrna sirna

15 RISC: RNAi-induced induced silencing complex Guide/ antisense strand

16 Rational sirna design P A U xg A 3 - OH 3 - OH High thermal stability of the 5 sense strand (SS) blocks incorporation of SS into RISC G or C is preferred. P- 5 Low thermal stability of the 5 anti-sense strand (AS) promotes Incorporation of AS into RISC. AU rich is suggested. Low stability in this region enhances RISC/AS-mediated cleavage of mrna and promote RISC complex release. U at position 10 at SS is recommended. Sense strand Antisense strand Reynolds et al. 2003

17 Other considerations no high GC content (35-65%); no inverted repeat sequence; no consecutive 3 Gs or 3 Cs; no consecutive 4 Ts if use poliii promoter; mrna secondary structure?

18 Phases of TRC Program The RNAi Consortium (TRC) Phase I (May/2004 to Apr/2007) Phase II (Oct/2007 to Sept/2011) The RNAi Core Jun/2005 to Apr/2008 May/2008 to Apr/2011

19 Vector Used by RNAi Core

20 Name Description U6 Promoter RNA generated with four uridine overhangs at each 3' end Cppt/CTE Central polypurine tract /constitutive transport element hpgk Human phosphoglycerate kinase eukaryotic promoter puror Puromycin resistance gene for mammalian selection SIN/LTR f1 ori ampr 3' self inactivating long terminal repeat f1 origin of replication Ampicillin resistance gene for bacterial selection puc ori puc origin of replication 5' LTR 5' long terminal repeat Psi RNA packaging signal RRE Rev response element

21 Configuration of TRC shrna construct

22 Materials Received from TRC shrna constructs and knockdown information: TRC-I TRC-II Clone # Gene # Clone # Gene # Knockdown Information Human 80,249 16,020 17, ,861 #1 Mouse 78,017 15, ,045 #2 Total 158,351 31,940 18, ,416 #1 Targeting 5,534 genes #2 Targeting 4,335 genes 35 shrna expression vectors (some are intermediates). with different selection/ fluorescence markers

23 Library performance-i (11,466 TRC shrnas targeting 1,956 genes) 5, % % # clones 4,000 3,000 2,000 1,000 44% 80% 60% 40% 20% Cumulative % clones # genes % 75% 80% 60% 40% 20% Cumulative % genes 0 <10% <20% <30% <50% no KD 0% Clone Performance (% Expression) 0 100% 80% 5/5 4/5 60% 3/5 40% 2/5 20% 1/5 <20% 0/5 % "good" clones/gene 0% TRC report

24 Library performance-ii # shrnas A549 MCF7 Jurkat Hepa (11,466 TRC shrnas targeting 1,956 genes) 10% 20% 30% 40% 50% >50% KD bin (% remaining) 100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0% cumulative % shrnas TRC report

25 Available Lentivirus Item (arrayed, pooled, individual) human kinase and phosphatase (hkp)) subset Mouse kinase subset / Mouse phosphatase subset Human/ Mouse tumor suppressor subset Human / Mouse transcription Factor subset Human deubiqutinating enzymes subset Control viruses Pooled hkp Pooled mouse kinase / Pooled mouse phosphatase Pooled Human/ Mouse tumor suppressor set Pooled Human / Mouse transcription Factor subset Pooled Human deubiqutinating enzymes subset GFP and shrna-luc viruses

26 Expression of Hairpin RNA (shrna( shrna) Using Pol III Promoters Transcription initiation of DNA-dependent RNApol III promoters (U6 or H1) are well characterized. RNApol III transcription uses a well-defined termination signal (TTTTT) and the products have no extra sequence. Transcription from these promoters is very efficient in various tissues.

27 Configuration/Structure of hu6 Promoter -23 DSE 250bp PSE TATATAT

28 Structure of VSV-G-Pseudotyped Lentivirus Modified from

29 Replication of Retrovirus

30 Genome Organization of Lentiviral Vector (Improved biosafety by eliminating non-essential genes or sequences) plko.1-puro: RSV promoter R-U5 Psi signal AgeI EcoRI hpgk promoter U3-R SIN pbs RRE U6 promoter Puro PPT SV40 PolyA pcmvδr8.91: SD Gag Pol SA SD RRE SA CMV promoter ΔΨ Tat Rev SV40 PolyA pmd.g: VSV-G CMV promoter SV40 PolyA

31 HEK293T as Packaging Cells Procedures: Day1: seeding cells Day2: co-transfection Day3: re-fresh media Day4: harvest viruses/ re-add media Day5: harvest viruses

32 From genome sequence to gene function Function Genomics What does the gene mean?

33 Forward and reverse genetics Forward Genetics: start with a phenotype, find the gene. naturally occurring mutants can be used. Reverse Genetics: start with a gene, determine its phenotype. identify the phenotypes resulting from the disruption of a particular gene.

34 Applications of RNAi libraries RNA Interference Cancer Basic Research Viral Infection Gene functions Tumor biology Host factors required for viral replication Biological pathways And more

35 Approaches to large-scale RNAi screen/selection Arrayed RNAi library/screen sirna Plasmid Vector Viral Vector Pooled RNAi library /Selection Viral Vector Transfection Transduction Transduction High Throughput Assay for for Altered Phenotype(s) Selective screen for Altered Phenotype(s) 2 nd assay to validate hits Hits identification: Barcode microarray/ RT-PCR sequencing

36 RNAi pooled screening: positive selection

37 R&D in RNAi Core Search for cellular factors that support primary human small airway epithelial cell (SAEC) growth using RNAi pooled selection,, 17 genes that support SAEC growing in soft agar are identified. SAEC/ Control SAEC/ RNAi > 0.45 mm Anchorage-dependent growth assay

38 RNAi pooled screening: negative selection

39 How to ensure that hits aren't off-target Off-Target: How/ Criterion: Phenotype change is caused by two or more independent shrnas that target the same gene Why:

40 Degradation of mrna can occur by two separate pathways in RNAi Khvorova A. RNA (2008),14:

41 Configuration of TRC shrna construct

42 3 UTR hexamer frequency in human genome SCF: seed complementary frequency high(>3800), medium (z ), or low (<350) SCFs in the HeLa transcriptome Khvorova A. RNA (2008),14:

43 Microarray signatures of GAPDH- and PPIB-targeting sirnas One nt shift in seed sequence: GAPDH M1 sense: 5- GGCUCACAACGG GAAGCUU GAPDH M8 sense: 5- GCUCACAACGGG AAGCUUG Seed region not static Same seed sequences in different target genes: GAPDH H15 sense: 5-GAAGUAUGACAACAGCCUC PPIB H17 sense: 5-CGACAGUCAAGACAGCCUG Khvorova A. RNA (2008),14:

44 Seed sequence plays major role in off-target GAPDH high(>3800), medium (z ), or low (<350) SCFs in the HeLa transcriptome (z10 sirnas for each group) Khvorova A. RNA (2008),14:

45 shrna processing How are the TRC library shrnas processed into short dsrnas? Implications: hairpin design, off-target effects poliii transcription start and stop; evidence for DROSHA processing? Where does DICER cut? GGGTCGAGCTGGACGGCGACGTAC T C TTTTTCAGCTCGACCTGCCGCTGCATG A G 22 nts Which strand goes into RISC? (Strand that goes into RISC is more stable/abundant) TRC: Jen Grenier, Andrew Grimson, Ozan Alkan

46 Small RNA sequencing: all 26 shrnas GG GG GG GG GG21merSenseStrandSeqncC Length#reads % shrna % strand 23mer 5,217 1% 11% 22mer 32,279 7% 67% 21mer 8,029 2% 17% 20mer 1,029 <1% 2% T C G21merAntisenseStrandSTTTTT r 3Ts r 4Ts r 5Ts (5) e 3Ts e 4Ts e 5Ts (4) m 4Ts (3) A G 22mer 18,285 4% 5% 21mer 39,095 9% 10% 20mer 6,760 2% 2% 23mer 45,610 10% 11% 22mer 205,249 46% 51% 21mer 40,444 9% 10% 23mer 23,263 5% 6% } 17% } 72%

47 Highly parallel identification of essential genes in cancer cells Biao Luo etc, Proc Natl Acad Sci U S A, 2008, 105:

48 Pooled RNAi screening (45K lentiviruses)

49 Screens for essential genes in 12 cancer cell lines NSCLC glioblastoma SCLC leukemia

50 Time course analysis for the top 100 essential genes in K562 cells

51 Integration of functional and structural genomics (Case in NSCLC)

52 Integration of functional and structural genomics (Case in NSCLC)

53 Integration of functional and structural genomics (Case in NSCLC)

54 References: Review paper & original paper 1. Oncogene (2004) 23: ; ; ; ; Moffat J & Sabatini DM Building mammalian signaling pathways with RNAi screens. Nature Rev. 7: Focus on RNA interference (a user guide). Nature Methods 2006 Sep 3(9): Paddison PJ (2008) RNA interference in mammalian cell systems. Curr Top Microbiol Immunol. 2008;320: Recent reviews on RNAi. Curr Top Microbiol Immunol 2008, volume 320: Luo Biao et al Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A. 105(51): National RNAi Core website