Resources and applications of TRC RNAi reagents in National RNAi Core Facility. Lecturer: 林志隆 ( IMB&RNAi Core)

Transcription

1 Resources and applications of TRC RNAi reagents in National RNAi Core Facility Lecturer: 林志隆 ( IMB&RNAi Core) 04/13/2010

2 The Nobel Prize in physiology /medicine 2006 Goes to Professor Andrew Z Fire, Ph.D. Stanford University School of Medicine Stanford, CA. USA Professor Craig C. Mello, Ph.D. University of Massachusetts Medical School Worcester, MA, USA RNAi: A gene silencing by dsrna

3 RNA interference (RNAi) A form of post-transcriptional transcriptional gene silencing, mimicking the effect of loss-of of-gene-function. RNAi does not result in stable genetic changes; but in lower animal or plants, RNAi effects can be inherited for one or two generations.

4 Timeline of RNAi achievements Adapted from: Thing/Data/Diagram.Par Image gif

5 Dr. R Jorgensen s Experiment C Napoli, C Lemieux, and R Jorgensen Plant Cell April; 2(4): 279. Attempts to overexpress chalcone synthase by inserting multiple copies of that gene into the plant s genome. Purple plants should become purpler... Co-suppression: both endogenous and introduced genes silenced. PTGS but what is the causative factor? PTGS= Post-Transcriptional Gene ene Silencingilencing

6 PTGS in plants is due to small dsrna dsrna hypothesis explained this phenomenon Andrew J. Hamilton and David C. Baulcombe Science :

7 Nature 391, (19 February 1998)

8

9 Long dsrnas trigger non-specific silencing in mammalian dsrna C. elegans Drosophila In mammal? Long dsrna initiate IFN response in mammalian ---global gene silencing

10 dsrna-induced translation inhibition in mammalian Cytokine Growth Factor Rev :

11 How to Apply RNAi to Mammalian System?

12 Effector of RNAi 長雙股 RNA (long dsrna) cytosol Gregory Hannon identified the Dicer an enzyme that chops double-stranded RNA into little pieces. sirna small-interfering RNA; sirna Length of sirna: : 21 nts to 23 nts. - Nature. 2000;404:293-6; Nature. 2001;409:363-6

13 Nature 411, (24 May 2001)

14 What Does sirna Do

15 RISC: RNAi-induced induced silencing complex Guide/ antisense strand

16 Mechanism of RNAi in mammalian cells Antonin et. al., 2007 Nature Reviews Drug Discovery 6,

17 Rational sirna design P A U xg A 3 - OH 3 - OH High thermal stability of the 5 sense strand (SS) blocks incorporation of SS into RISC G or C is preferred. P- 5 Low thermal stability of the 5 anti-sense strand (AS) promotes Incorporation of AS into RISC. AU rich is suggested. Low stability in this region enhances RISC/AS-mediated cleavage of mrna and promote RISC complex release. U at position 10 at SS is recommended. Sense strand Antisense strand Reynolds et al. 2004

18 Other considerations no high GC content (35-65%); no inverted repeat sequence; no consecutive 3 Gs or 3 Cs; no consecutive 4 Ts if use poliii promoter;

19 Rational sirna design Crite Description Score ria Yes 1 Moderate to low (30%-52%) GC Content 1 point No 2 At least 3 A/Us at positions (sense) 1 point /per A or U 3 Lack of internal repeats (Tm*<20 ãc) 1 point 4 A at position 19 (sense) 1 point 5 A at position 3 (sense) 1 point 6 U at position 10 (sense) 1 point 7 No G/C at position 19 (sense) -1 point 8 No G at position 13 (sense) -1 point These characteristics are used by rational sirna design algorithm to evaluate potential targeted sequences and assign scores to them. Sequences with higher scores will have higher chance of success in RNAi. Reynolds et al. 2004

20 Phases of TRC Program The RNAi Consortium (TRC) Phase I (May/2004 to Apr/2007) Phase II (Oct/2007 to Sept/2011) The RNAi Core Jun/2005 to Apr/2008 May/2008 to Apr/2011

21 Vector Used by RNAi Core

22 Name Description U6 Promoter RNA generated with four uridine overhangs at each 3' end Cppt/CTE Central polypurine tract /constitutive transport element hpgk Human phosphoglycerate kinase eukaryotic promoter puror Puromycin resistance gene for mammalian selection SIN/LTR f1 ori ampr 3' self inactivating long terminal repeat f1 origin of replication Ampicillin resistance gene for bacterial selection puc ori puc origin of replication 5' LTR 5' long terminal repeat Psi RNA packaging signal RRE Rev response element

23 Configuration of TRC shrna construct

24 Materials Received from TRC shrna constructs and knockdown information: TRC-I TRC-II Clone # Gene # Clone # Gene # Knockdown Information Human 83,117 16,026 53,070 10,149 41,774 #1 Mouse 79,200 15,976 44,042 9,027 34,325 #2 Total 162,317 32,002 97,112 19,176 76,099 #1 Targeting 7,074 genes #2 Targeting 6,738 genes 35 shrna expression vectors (some are intermediates). with different selection/ fluorescence markers updated

25 TRC library performance Highest quality data: 10,711 genes Good hairpins/gene coverage % % #shrna % genes 15% 10% % % No KD %KD all HPS ~4/5 ~3/5 ~2/5 "good" clones/gene ~1/5 ~0/5 TRC report

26 35,000 30,000 25,000 20,000 15,000 10,000 5,000 0 TRC validation (QRT-PCR) Tests on 30,000 hairpin panels (~150,000 tests) Released data on 14K distinct genes successful attempted Process upgrade Resume 1,200 Genes / month (6,000 shrnas) September February April May June July August September October November December January February March April May June July August September October November December January February March April May June July August September October November December January Throughput: 1,200 2,000 genes/month TRC report # genes (cumulative)

27 Available Lentivirus Item (arrayed, pooled, individual) human kinase and phosphatase (hkp)) subset Mouse kinase subset / Mouse phosphatase subset Human/ Mouse tumor suppressor subset Human / Mouse transcription Factor subset Human deubiqutinating enzymes subset Control viruses Pooled hkp Pooled mouse kinase / Pooled mouse phosphatase Pooled Human/ Mouse tumor suppressor set Pooled Human / Mouse transcription Factor subset Pooled Human deubiqutinating enzymes subset Customized VSV-G pseudotyped lentivirus 80K Human shrna Pool (16,026 genes)

28 Migration Profile of htrc1 Pooled pdna Pool # Ctl M M 10K 6K 4K 3K 2K Clones Genes TRC1 Human Clones TRC1 Human Genes 4713 TRC1 Mouse Clones 1377 TRC1 Mouse Genes 1661 TRC2 New Human Clones 342 TRC2 New Human Genes 85 Control Clones

29 Expression of Hairpin RNA (shrna( shrna) Using Pol III Promoters Transcription initiation of DNA-dependent RNApol III promoters (U6 or H1) are well characterized. RNApol III transcription uses a well-defined termination signal (TTTTT) and the products have no extra sequence. Transcription from these promoters is very efficient in various tissues.

30 Configuration/Structure of hu6 Promoter -23 DSE 250bp PSE TATATAT

31 Structure of VSV-G-Pseudotyped Lentivirus Modified from

32 Replication of Retrovirus

33 Genome Organization of Lentiviral Vector (Improved biosafety by eliminating non-essential genes or sequences) plko.1-puro: RSV promoter R-U5 Psi signal AgeI EcoRI hpgk promoter U3-R SIN pbs RRE U6 promoter Puro PPT SV40 PolyA pcmvδr8.91: SD Gag Pol SA SD RRE SA CMV promoter ΔΨ Tat Rev SV40 PolyA pmd.g: VSV-G CMV promoter SV40 PolyA

34 HEK293T as Packaging Cells Procedures: Day1: seeding cells Day2: co-transfection Day3: re-fresh media Day4: harvest viruses/ re-add media Day5: harvest viruses

35 From genome sequence to gene function Function Genomics What does the gene mean?

36 Forward and reverse genetics approach to study gene function Forward Genetics: start with a phenotype, find the gene. naturally occurring mutants can be used. Reverse Genetics: start with a gene, determine its phenotype. identify the phenotypes resulting from the disruption of a particular gene.

37 Applications of RNAi libraries RNA Interference Cancer Basic Research Viral Infection Gene functions Tumor biology Host factors required for viral replication Biological pathways And more

38 Approaches to large-scale RNAi screen/selection Arrayed RNAi library/screen sirna Plasmid Vector Viral Vector Pooled RNAi library /Selection Viral Vector Transfection Transduction Transduction High Throughput Assay for for Altered Phenotype(s) Selective screen for Altered Phenotype(s) 2 nd assay to validate hits Hits identification: Barcode microarray/ RT-PCR sequencing

39 RNAi pooled screening: positive selection

40 R&D in RNAi Core Search for cellular factors that support primary human small airway epithelial cell (SAEC) growth using RNAi pooled selection,, 17 genes that support SAEC growing in soft agar are identified. SAEC/ Control SAEC/ RNAi > 0.45 mm Anchorage-dependent growth assay

41 RNAi pooled screening: negative selection

42 How to ensure that hits aren't off-target Off-Target: How/ Criterion: Phenotype change is caused by two or more independent shrnas that target the same gene Why:

43 Degradation of mrna can occur by two separate pathways in RNAi Khvorova A. RNA (2008),14:

44 3 UTR hexamer frequency in human genome SCF: seed complementary frequency high(>3800), medium (z ), or low (<350) SCFs in the HeLa transcriptome Khvorova A. RNA (2008),14:

45 Microarray signatures of GAPDH- and PPIB-targeting sirnas One nt shift in seed sequence: GAPDH M1 sense: 5- GGCUCACAACGG GAAGCUU GAPDH M8 sense: 5- GCUCACAACGGG AAGCUUG Seed region not static Same seed sequences in different target genes: GAPDH H15 sense: 5-GAAGUAUGACAACAGCCUC PPIB H17 sense: 5-CGACAGUCAAGACAGCCUG Khvorova A. RNA (2008),14:

46 Seed sequence plays major role in off-target Khvorova A. RNA (2008),14:

47 Configuration of TRC shrna construct

48 shrna processing How are the TRC library shrnas processed into short dsrnas? Implications: hairpin design, off-target effects poliii transcription start and stop; evidence for DROSHA processing? Where does DICER cut? GGGTCGAGCTGGACGGCGACGTAC T C TTTTTCAGCTCGACCTGCCGCTGCATG A G 22 nts Which strand goes into RISC? (Strand that goes into RISC is more stable/abundant) TRC: Jen Grenier, Andrew Grimson, Ozan Alkan

49 Small RNA sequencing: all 26 shrnas GG GG GG GG GG21merSenseStrandSeqncC Length#reads % shrna % strand 23mer 5,217 1% 11% 22mer 32,279 7% 67% 21mer 8,029 2% 17% 20mer 1,029 <1% 2% T C G21merAntisenseStrandSTTTTT r 3Ts r 4Ts r 5Ts (5) e 3Ts e 4Ts e 5Ts (4) m 4Ts (3) A G 22mer 18,285 4% 5% 21mer 39,095 9% 10% 20mer 6,760 2% 2% 23mer 45,610 10% 11% 22mer 205,249 46% 51% 21mer 40,444 9% 10% 23mer 23,263 5% 6% } 17% } 72%

50 Highly parallel identification of essential genes in cancer cells Biao Luo etc, Proc Natl Acad Sci U S A, 2008, 105:

51 Pooled RNAi screening (45K lentiviruses)

52 Pooled RNAi screening (45K lentiviruses) Involed in FAS induced apoptosis

53 Screens for essential genes in 12 cancer cell lines Commonly essential gene NSCLC glioblastoma SCLC leukemia Cell lineage-specific essential gene Cell line-specific essential gene (Cancer specific gene dependency)

54 Time course analysis for the top 100 essential genes in K562 cells

55 Integration of functional and structural genomics (Case in NSCLC)

56 Integration of functional and structural genomics (Case in NSCLC)

57 Integration of functional and structural genomics (Case in NSCLC)

58 References: Review paper & original paper 1. Oncogene (2004) 23: ; ; ; ; Moffat J & Sabatini DM Building mammalian signaling pathways with RNAi screens. Nature Rev. 7: Focus on RNA interference (a user guide). Nature Methods 2006 Sep 3(9): Paddison PJ (2008) RNA interference in mammalian cell systems. Curr Top Microbiol Immunol. 2008;320: Recent reviews on RNAi. Curr Top Microbiol Immunol 2008, volume 320: Luo Biao et al Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A. 105(51): National RNAi Core website