Resources and applications of TRC RNAi reagents in National RNAi Core Facility. Lecturer: 林志隆 ( IMB&RNAi Core)
|
|
- Janice May
- 5 years ago
- Views:
Transcription
1 Resources and applications of TRC RNAi reagents in National RNAi Core Facility Lecturer: 林志隆 ( IMB&RNAi Core) 04/13/2010
2 The Nobel Prize in physiology /medicine 2006 Goes to Professor Andrew Z Fire, Ph.D. Stanford University School of Medicine Stanford, CA. USA Professor Craig C. Mello, Ph.D. University of Massachusetts Medical School Worcester, MA, USA RNAi: A gene silencing by dsrna
3 RNA interference (RNAi) A form of post-transcriptional transcriptional gene silencing, mimicking the effect of loss-of of-gene-function. RNAi does not result in stable genetic changes; but in lower animal or plants, RNAi effects can be inherited for one or two generations.
4 Timeline of RNAi achievements Adapted from: Thing/Data/Diagram.Par Image gif
5 Dr. R Jorgensen s Experiment C Napoli, C Lemieux, and R Jorgensen Plant Cell April; 2(4): 279. Attempts to overexpress chalcone synthase by inserting multiple copies of that gene into the plant s genome. Purple plants should become purpler... Co-suppression: both endogenous and introduced genes silenced. PTGS but what is the causative factor? PTGS= Post-Transcriptional Gene ene Silencingilencing
6 PTGS in plants is due to small dsrna dsrna hypothesis explained this phenomenon Andrew J. Hamilton and David C. Baulcombe Science :
7 Nature 391, (19 February 1998)
8
9 Long dsrnas trigger non-specific silencing in mammalian dsrna C. elegans Drosophila In mammal? Long dsrna initiate IFN response in mammalian ---global gene silencing
10 dsrna-induced translation inhibition in mammalian Cytokine Growth Factor Rev :
11 How to Apply RNAi to Mammalian System?
12 Effector of RNAi 長雙股 RNA (long dsrna) cytosol Gregory Hannon identified the Dicer an enzyme that chops double-stranded RNA into little pieces. sirna small-interfering RNA; sirna Length of sirna: : 21 nts to 23 nts. - Nature. 2000;404:293-6; Nature. 2001;409:363-6
13 Nature 411, (24 May 2001)
14 What Does sirna Do
15 RISC: RNAi-induced induced silencing complex Guide/ antisense strand
16 Mechanism of RNAi in mammalian cells Antonin et. al., 2007 Nature Reviews Drug Discovery 6,
17 Rational sirna design P A U xg A 3 - OH 3 - OH High thermal stability of the 5 sense strand (SS) blocks incorporation of SS into RISC G or C is preferred. P- 5 Low thermal stability of the 5 anti-sense strand (AS) promotes Incorporation of AS into RISC. AU rich is suggested. Low stability in this region enhances RISC/AS-mediated cleavage of mrna and promote RISC complex release. U at position 10 at SS is recommended. Sense strand Antisense strand Reynolds et al. 2004
18 Other considerations no high GC content (35-65%); no inverted repeat sequence; no consecutive 3 Gs or 3 Cs; no consecutive 4 Ts if use poliii promoter;
19 Rational sirna design Crite Description Score ria Yes 1 Moderate to low (30%-52%) GC Content 1 point No 2 At least 3 A/Us at positions (sense) 1 point /per A or U 3 Lack of internal repeats (Tm*<20 ãc) 1 point 4 A at position 19 (sense) 1 point 5 A at position 3 (sense) 1 point 6 U at position 10 (sense) 1 point 7 No G/C at position 19 (sense) -1 point 8 No G at position 13 (sense) -1 point These characteristics are used by rational sirna design algorithm to evaluate potential targeted sequences and assign scores to them. Sequences with higher scores will have higher chance of success in RNAi. Reynolds et al. 2004
20 Phases of TRC Program The RNAi Consortium (TRC) Phase I (May/2004 to Apr/2007) Phase II (Oct/2007 to Sept/2011) The RNAi Core Jun/2005 to Apr/2008 May/2008 to Apr/2011
21 Vector Used by RNAi Core
22 Name Description U6 Promoter RNA generated with four uridine overhangs at each 3' end Cppt/CTE Central polypurine tract /constitutive transport element hpgk Human phosphoglycerate kinase eukaryotic promoter puror Puromycin resistance gene for mammalian selection SIN/LTR f1 ori ampr 3' self inactivating long terminal repeat f1 origin of replication Ampicillin resistance gene for bacterial selection puc ori puc origin of replication 5' LTR 5' long terminal repeat Psi RNA packaging signal RRE Rev response element
23 Configuration of TRC shrna construct
24 Materials Received from TRC shrna constructs and knockdown information: TRC-I TRC-II Clone # Gene # Clone # Gene # Knockdown Information Human 83,117 16,026 53,070 10,149 41,774 #1 Mouse 79,200 15,976 44,042 9,027 34,325 #2 Total 162,317 32,002 97,112 19,176 76,099 #1 Targeting 7,074 genes #2 Targeting 6,738 genes 35 shrna expression vectors (some are intermediates). with different selection/ fluorescence markers updated
25 TRC library performance Highest quality data: 10,711 genes Good hairpins/gene coverage % % #shrna % genes 15% 10% % % No KD %KD all HPS ~4/5 ~3/5 ~2/5 "good" clones/gene ~1/5 ~0/5 TRC report
26 35,000 30,000 25,000 20,000 15,000 10,000 5,000 0 TRC validation (QRT-PCR) Tests on 30,000 hairpin panels (~150,000 tests) Released data on 14K distinct genes successful attempted Process upgrade Resume 1,200 Genes / month (6,000 shrnas) September February April May June July August September October November December January February March April May June July August September October November December January February March April May June July August September October November December January Throughput: 1,200 2,000 genes/month TRC report # genes (cumulative)
27 Available Lentivirus Item (arrayed, pooled, individual) human kinase and phosphatase (hkp)) subset Mouse kinase subset / Mouse phosphatase subset Human/ Mouse tumor suppressor subset Human / Mouse transcription Factor subset Human deubiqutinating enzymes subset Control viruses Pooled hkp Pooled mouse kinase / Pooled mouse phosphatase Pooled Human/ Mouse tumor suppressor set Pooled Human / Mouse transcription Factor subset Pooled Human deubiqutinating enzymes subset Customized VSV-G pseudotyped lentivirus 80K Human shrna Pool (16,026 genes)
28 Migration Profile of htrc1 Pooled pdna Pool # Ctl M M 10K 6K 4K 3K 2K Clones Genes TRC1 Human Clones TRC1 Human Genes 4713 TRC1 Mouse Clones 1377 TRC1 Mouse Genes 1661 TRC2 New Human Clones 342 TRC2 New Human Genes 85 Control Clones
29 Expression of Hairpin RNA (shrna( shrna) Using Pol III Promoters Transcription initiation of DNA-dependent RNApol III promoters (U6 or H1) are well characterized. RNApol III transcription uses a well-defined termination signal (TTTTT) and the products have no extra sequence. Transcription from these promoters is very efficient in various tissues.
30 Configuration/Structure of hu6 Promoter -23 DSE 250bp PSE TATATAT
31 Structure of VSV-G-Pseudotyped Lentivirus Modified from
32 Replication of Retrovirus
33 Genome Organization of Lentiviral Vector (Improved biosafety by eliminating non-essential genes or sequences) plko.1-puro: RSV promoter R-U5 Psi signal AgeI EcoRI hpgk promoter U3-R SIN pbs RRE U6 promoter Puro PPT SV40 PolyA pcmvδr8.91: SD Gag Pol SA SD RRE SA CMV promoter ΔΨ Tat Rev SV40 PolyA pmd.g: VSV-G CMV promoter SV40 PolyA
34 HEK293T as Packaging Cells Procedures: Day1: seeding cells Day2: co-transfection Day3: re-fresh media Day4: harvest viruses/ re-add media Day5: harvest viruses
35 From genome sequence to gene function Function Genomics What does the gene mean?
36 Forward and reverse genetics approach to study gene function Forward Genetics: start with a phenotype, find the gene. naturally occurring mutants can be used. Reverse Genetics: start with a gene, determine its phenotype. identify the phenotypes resulting from the disruption of a particular gene.
37 Applications of RNAi libraries RNA Interference Cancer Basic Research Viral Infection Gene functions Tumor biology Host factors required for viral replication Biological pathways And more
38 Approaches to large-scale RNAi screen/selection Arrayed RNAi library/screen sirna Plasmid Vector Viral Vector Pooled RNAi library /Selection Viral Vector Transfection Transduction Transduction High Throughput Assay for for Altered Phenotype(s) Selective screen for Altered Phenotype(s) 2 nd assay to validate hits Hits identification: Barcode microarray/ RT-PCR sequencing
39 RNAi pooled screening: positive selection
40 R&D in RNAi Core Search for cellular factors that support primary human small airway epithelial cell (SAEC) growth using RNAi pooled selection,, 17 genes that support SAEC growing in soft agar are identified. SAEC/ Control SAEC/ RNAi > 0.45 mm Anchorage-dependent growth assay
41 RNAi pooled screening: negative selection
42 How to ensure that hits aren't off-target Off-Target: How/ Criterion: Phenotype change is caused by two or more independent shrnas that target the same gene Why:
43 Degradation of mrna can occur by two separate pathways in RNAi Khvorova A. RNA (2008),14:
44 3 UTR hexamer frequency in human genome SCF: seed complementary frequency high(>3800), medium (z ), or low (<350) SCFs in the HeLa transcriptome Khvorova A. RNA (2008),14:
45 Microarray signatures of GAPDH- and PPIB-targeting sirnas One nt shift in seed sequence: GAPDH M1 sense: 5- GGCUCACAACGG GAAGCUU GAPDH M8 sense: 5- GCUCACAACGGG AAGCUUG Seed region not static Same seed sequences in different target genes: GAPDH H15 sense: 5-GAAGUAUGACAACAGCCUC PPIB H17 sense: 5-CGACAGUCAAGACAGCCUG Khvorova A. RNA (2008),14:
46 Seed sequence plays major role in off-target Khvorova A. RNA (2008),14:
47 Configuration of TRC shrna construct
48 shrna processing How are the TRC library shrnas processed into short dsrnas? Implications: hairpin design, off-target effects poliii transcription start and stop; evidence for DROSHA processing? Where does DICER cut? GGGTCGAGCTGGACGGCGACGTAC T C TTTTTCAGCTCGACCTGCCGCTGCATG A G 22 nts Which strand goes into RISC? (Strand that goes into RISC is more stable/abundant) TRC: Jen Grenier, Andrew Grimson, Ozan Alkan
49 Small RNA sequencing: all 26 shrnas GG GG GG GG GG21merSenseStrandSeqncC Length#reads % shrna % strand 23mer 5,217 1% 11% 22mer 32,279 7% 67% 21mer 8,029 2% 17% 20mer 1,029 <1% 2% T C G21merAntisenseStrandSTTTTT r 3Ts r 4Ts r 5Ts (5) e 3Ts e 4Ts e 5Ts (4) m 4Ts (3) A G 22mer 18,285 4% 5% 21mer 39,095 9% 10% 20mer 6,760 2% 2% 23mer 45,610 10% 11% 22mer 205,249 46% 51% 21mer 40,444 9% 10% 23mer 23,263 5% 6% } 17% } 72%
50 Highly parallel identification of essential genes in cancer cells Biao Luo etc, Proc Natl Acad Sci U S A, 2008, 105:
51 Pooled RNAi screening (45K lentiviruses)
52 Pooled RNAi screening (45K lentiviruses) Involed in FAS induced apoptosis
53 Screens for essential genes in 12 cancer cell lines Commonly essential gene NSCLC glioblastoma SCLC leukemia Cell lineage-specific essential gene Cell line-specific essential gene (Cancer specific gene dependency)
54 Time course analysis for the top 100 essential genes in K562 cells
55 Integration of functional and structural genomics (Case in NSCLC)
56 Integration of functional and structural genomics (Case in NSCLC)
57 Integration of functional and structural genomics (Case in NSCLC)
58 References: Review paper & original paper 1. Oncogene (2004) 23: ; ; ; ; Moffat J & Sabatini DM Building mammalian signaling pathways with RNAi screens. Nature Rev. 7: Focus on RNA interference (a user guide). Nature Methods 2006 Sep 3(9): Paddison PJ (2008) RNA interference in mammalian cell systems. Curr Top Microbiol Immunol. 2008;320: Recent reviews on RNAi. Curr Top Microbiol Immunol 2008, volume 320: Luo Biao et al Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A. 105(51): National RNAi Core website
Resources and applications of TRC RNAi reagents in National RNAi Core Facility
Resources and applications of TRC RNAi reagents in National RNAi Core Facility Lecturer: 林志隆 ( IMB&RNAi Core) 05/14/2009/AS The Nobel Prize in physiology /medicine 2006 Goes to Professor Andrew Z Fire,
More informationshrna experiment design
97-06-20 shrna experiment design 鄭金松 Core Manager Comparison of sirna and shrna Structure sirna (19-27 nts) shrna (19-27 nts) Advantage vs. disadvantage cost delivery efficiency duration of knockdown renewability
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationPROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG
PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen Jason Moffat,1,2,4,10 Dorre A. Grueneberg,1,10
More informationEinstein Presentation Title
An Introduction to the shrna Core Facility Einstein Presentation Title John Reidhaar-Olson, Ph.D. January Albert Einstein 25, 2012 College of Medicine RNAi Presentation User Group Subtitle Meeting shrna
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationCell type-specific delivery of sirnas with aptamer-sirna chimeras
Cell type-specific delivery of sirnas with aptamer-sirna chimeras Sullenger, B. A. et al Duke Center for Translational Research, Duke University Nature Biotechnology, 2006, 24, 1005 Julia Vargas November
More informationTrends in Medical Research -
RNA Interference Tel : 02-2267-1740 / E-mail : kimys@inje.ac.kr, RNAi (RNA or RNA silencing) ( ) DNA small RNA (srnas) mrna,. DNA small RNA. DNA RNA small RNA. small RNA mirna (microrna), RNA RNAi. 1993
More informationRNAi minilecture and Using Genetics to Explore Complex Biological Processes
RNAi minilecture and Using Genetics to Explore Complex Biological Processes 2 American Worm People Win Nobel for RNA Work New York Times Oct. 2, 2006 The 2006 Nobel Prize in Physiology or Medicine was
More informationRNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 4, 2006 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
More informationRNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also mirna, sirna, micrna, shrna, etc.) April 8, 2008 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationLearning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance
Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationRNA Interference (RNAi) (see also sirna, micrna, shrna, etc.)
Biochemistry 412 RNA Interference (RNAi) (see also sirna, micrna, shrna, etc.) April 3, 2007 The Discovery of the RNA Interference (RNAi) Phenomenon 1. Gene-specific inhibition of expression by anti-sense
More informationDOWNLOAD OR READ : RNA INTERFERENCE CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : RNA INTERFERENCE CURRENT TOPICS IN MICROBIOLOGY AND IMMUNOLOGY PDF EBOOK EPUB MOBI Page 1 Page 2 rna interference current topics in microbiology and immunology rna interference current
More informationDNA Microarrays & RNAi
Biochemistry 412 DNA Microarrays & RNAi April 7, 2009 DNA Microarrays The development of DNA microarrays led to an explosion in mrna profiling studies. Stolovitky (2003) Curr. Opin. Struct. Biol. 13, 370.
More informationGE Healthcare. DharmaconTM. Gene Editing, RNAi & Gene Expression. RNAi Application Guide 2016/17
GE Healthcare DharmaconTM Gene Editing, RNAi & Gene Expression RNAi Application Guide 2016/17 Every discovery is a stepping stone toward clarity, firm conclusions, and ultimately an amazing breakthrough.
More informationsherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
More informationBCH Graduate Survey of Biochemistry
BCH 5045 Graduate Survey of Biochemistry Instructor: Charles Guy Producer: Ron Thomas Director: Glen Graham Lecture 30 Slide sets available at: http://hort.ifas.ufl.edu/teach/guyweb/bch5045/index.html
More informationPlants Fight it out Intrinsic defence mechanism The magic world of Gene silencing
I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect
More informationRNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationThe first experiments
RNA interference So that I don t get myself into any trouble, most of the following text is verbatim from the Ambion website, which nicely summarizes a lot of what I will talk about in class. I ve edited
More informationA Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
More informationLecture 9. RNA interference and micrornas. 3rd December
Lecture 9 RNA interference and micrornas 3rd December 2012 1 Therapeutic nucleic acids DNA RNA Genes (delivered by DNA vectors) Non-coding sequences Genes (delivered by RNA vectors) Non-coding sequences
More informationTranscription Regulation And Gene Expression in Eukaryotes (Cycle G2# )
Transcription Regulation And Gene Expression in Eukaryotes (Cycle G2#13709-01) SMALL RNA REGULATORS OF GENE EXPRESSION RG. Clerc May 05, 2010 www.fmi.ch/training/teaching RNAi for RNA interference : discovered
More informationRNA folding and its importance. Mitesh Shrestha
RNA folding and its importance Mitesh Shrestha Diseases Caused due to Protein Misfolding Alzheimer s Disease Parkinson s Disease Cataracts Sickle Cell Disease Prion Diseases Cystic Fibrosis Ribozymes Ribonucleic
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationshrna vector storage The vector DNA is shipped in a microfuge tube at room temperature and should be stored at -20 C or -80 C.
Product: Expression Arrest TM Non-silencing vector Catalog #: RHS1703 Product Description The laboratory of Dr. Greg Hannon at Cold Spring Harbor Laboratory (CSHL) has created an RNAi Clone Library comprised
More informationWhat goes into my Biological Inventory?
What goes into my Biological Inventory? What Information is Required for an Effective Risk Assessment? According to the Laboratory Biosafety Guidelines (2004), the risk group of an organism is determined
More informationAntibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies
G0656 pfiv3.2rsvmcs Coordinates Plasmid Features 1-682 CMV/5 LTR hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1695-2075 RSV Promoter 2104-2222 Multiple Cloning Sites 2244-2839 WPRE 2868-3009
More informationTechnology Overview. Figure 1. asirna structure
BMT, Inc. Technology Overview Small interfering RNAs (sirnas) are short, double-stranded RNAs (dsrnas) that mediate efficient gene silencing in a sequence-specific manner. The specific cleavage of mrna
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationCertificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer
More informationRNAi HTS and Data Analysis
Part I RNAi HTS and Data Analysis 1 Introduction to Genome-Scale RNAi Research 1.1 RNAi: An Effective Tool for Elucidating Gene Functions and a New Class of Drugs RNAi is a mechanism in living cells that
More informationIntroduction to C. elegans and RNA interference
Introduction to C. elegans and RNA interference Why study model organisms? The problem: In order to understand biology, we need to learn about the function of the underlying genes How can we find out what
More informationTranscriptional Regulation (Gene Regulation)
Experimental Techniques in Biomedical Sciences 의생명과학실험기법 Transcriptional Regulation (Gene Regulation) 4/17/13 Jeong Hoon Kim (jeongkim@skku.edu) Department of Health Sciences and Technology, SKKU Graduate
More informationThe Ups & Downs of Gene Expression:
The Ups & Downs of Gene Expression: Using Lipid-Based Transfection and RT-qPCR to Deliver Perfect Knockdown and Achieve Optimal Expression Results Hilary Srere, Ph.D. Topics What is RNAi? Methods of Delivery
More informationOriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify
More informationPre-made Reporter Lentivirus for p53 Signal Pathway
Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:
More informationCatalog Number. Mouse Unique & Validated TRC 2.0 SHPM2 Pooled shrna Library. Pooled shrna Library SHPHLIBR
MISSION LentiPlex Human and Mouse Pooled shrna Libraries Catalog Number Product Description Catalog Number Product Description SHPH01 Human TRC 1.0 Pooled shrna Library SHPM01 Mouse TRC 1.0 Pooled shrna
More informationG0411 pfiv3.2mcsegfp. Plasmid Features
G0411 pfiv3.2mcsegfp Plasmid Features Coordinates Feature CMV/5 LTR hybrid 1:682 Major Splice Donor 926:957 Partial gag 958:1468 Central Polypurine Tract 1494:1653 Multiple cloning sites 1653:1714 egfp
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationExperimental genetics - 2 Partha Roy
Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic
More informationTest Bank for Molecular Cell Biology 7th Edition by Lodish
Test Bank for Molecular Cell Biology 7th Edition by Lodish Link download full: http://testbankair.com/download/test-bank-formolecular-cell-biology-7th-edition-by-lodish/ Chapter 5 Molecular Genetic Techniques
More informationCambridge University Press
Figure 1.1. Model of RNAi pathway in C. elegans. Transmembrane protein SID-1 allows dsrna to enter the cell. In the cytoplasm,dsrna gets processed by DCR-1,existing in a complex with RDE-4,RDE-1 and DRH-1.
More informationNew microribbon production
New microribbon production In vitro transformation Excystation brief exposure to acidic ph (~2) flagellar activity within 5-10 min after return to neutral ph breakdown of cyst wall (proteases) trophozoite
More informationPre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
More informationARN interférence Technologies : sirna, shrna, mirna
ARN interférence Technologies : sirna, shrna, mirna LabCluster Tour 2014 - Delphine Ayache sigma-aldrich.com Methods for Modulating Gene Expression DNA RNA Protein Transcription Translation Genome Editing:
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationManufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray
Manufacturing Viral Gene Therapy s: 1 Dr. Vice President, Research & Development Audentes Therapeutics, Inc. San Francisco, USA Natural virus life cycle Late Early Viral Virally infected cell Naïve cell
More informationMETODOLOGIE INTEGRATE PER LA SELEZIONE GENOMICA DI PIANTE ORTIVE
CORSO GENHORT METODOLOGIE INTEGRATE PER LA SELEZIONE GENOMICA DI PIANTE ORTIVE Marzo 2014 Docente: e-mail: Pasquale Termolino termolin@unina.it Posttranscriptional gene silencing Transcriptional gene silencing
More informationRNA Interference and the World of Small RNAs
RNA Interference and the World of Small RNAs O, I die, Horatio; The potent poison quite o'er-crows my spirit: I cannot live to hear the news from England; But I do prophesy the election lights On Fortinbras:
More informationOff-target effects: disturbing the silence of RNA interference (RNAi)
TECH NOTE Off-target effects: disturbing the silence of RNA interference (RNAi) Abstract Off-target effects occur when an is processed by the RNA-Induced Silencing Complex (RISC) and down-regulates unintended
More informationEctopic Gene Expression in Mammalian Cells
Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic
More informationComparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research.
Comparison of Commercial Transfection Reagents: Cell line optimized transfection kits for in vitro cancer research. by Altogen Labs, 11200 Manchaca Road, Suite 203 Austin TX 78748 USA Tel. (512) 433-6177
More informationMethods for Reverse genetics References:
Methods for Reverse genetics References: 1. Alonso JM, Ecker JR. Moving forward in reverse: genetic technologies to enable genomewide phenomic screens in Arabidopsis. Nat Rev Genet. 2006 Jul;7(7):524-36.
More informationshrna expression Cloning Kit
shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-
More informationG0752 pfiv3.2mcswtiresegfp
G0752 pfiv3.2mcswtiresegfp Plasmid Features Coordinates Feature 1-682 CMV/5 LTR Hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1653-1738 Multiple Cloning Sites 1739-2325 wtires 2326-3045
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationYour Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationpsmpuw-u6-puro Lentiviral Expression Vector
Product Data Sheet psmpuw-u6-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-221 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human
More informationGene regulation V Biochemistry 302. March 6, 2006
Gene regulation V Biochemistry 302 March 6, 2006 Common structural motifs associated with transcriptional regulatory proteins Helix-turn-helix Prokaryotic repressors and activators Eukaryotic homeodomain
More informationTECHNICAL BULLETIN. MISSION shrna Mouse Gene Family Sets, Bacterial Glycerol Stocks
MISSION shrna Mouse Gene Family Sets, Bacterial Glycerol Stocks Catalog Numbers SM0111, SM0411, and SM2011 Storage Temperature 70 C TECHNICAL BULLETIN Product Description Small interfering RNAs (sirnas)
More informationsherwood UltramiR shrna Lentiviral Target Gene Set in pzip
sherwood UltramiR shrna Lentiviral Target Gene Set in pzip TLHSU1400 (human), TLMSU1400 (mouse), TLRSU1400 (rat) Format: Bacterial glycerol stock sherwood-ultramir shrna sherwood-ultramir short hairpin
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationWORKING WITH THE FIGURES. 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions?
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
More informationPotent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. A. Fire et al. (1998) Nature Vol 391:
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans A. Fire et al. (1998) Nature Vol 391: 806-810 1 Outline 1. Introduction 2. Objective 3. Results 4. Mechanism 5.
More informationYour Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationNCode mirna profiling. Sensitive, reproducible mirna profiling
Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationmicrorna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
More informationNew Technologies for RNAi Screening
sirna is a hot topic! Craig C. Mello, PhD, Nobel Prize in Medicine 2006-1 - New Technologies for RNAi Screening Dr. Jörg Dennig Global Product Manager RNAi Joerg.Dennig@qiagen.com 1 New Technologies for
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationTherapeutic & Prevention Application of Nucleic Acids
Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers
More informationBiology 4361 Developmental Biology Lecture 4. The Genetic Core of Development
Biology 4361 Developmental Biology Lecture 4. The Genetic Core of Development The only way to get from genotype to phenotype is through developmental processes. - Remember the analogy that the zygote contains
More informationThe RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: Lentivirus production of shrna, CRISPR, or ORF-pLX clones in 10 cm dishes or 6- well plates Current Revision Date: 6/3/2015 RNAi Platform,, trc_info@broadinstitute.org
More informationOptimizing RNA interference for application in mammalian cells
Biochem. J. (2004) 380, 593 603 (Printed in Great Britain) 593 REVIEW ARTICLE Optimizing RNA interference for application in mammalian cells René H. MEDEMA 1 Division of Molecular Biology, H8, Netherlands
More informationGenetics Faculty of Agriculture and Veterinary Medicine. Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology
Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 16: Biotechnology 1 Biotechnology is defined as the technology that involves the use of living organisms
More informationPre-made Lentiviral Particles for nuclear permeant CRE recombinase expression
Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationCat. #FP981. Vector description
p2fp-rnai vector Cat. #FP981 Vector description p2fp-rnai vector is a mammalian expression vector designed for RNA interference studies. The vector encodes two fluorescent proteins: and JRedneomycin phosphotransferase
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationReading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
More informationExperimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
More informationValue Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
More informationCloning of shrna Templates into shrna Expression Vectors. User Manual
Cloning of shrna Templates into shrna Expression Vectors v3a, 8-29-2013 Table of Contents Page A. Background 2 B. Required Materials 2 C. Cloning of shrna Template Oligonucleotides into shrna Expression
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More information