SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 Materials and Methods Transgenic Plant Materials and DNA Constructs. VEX1::H2B-GFP, ACA3::H2B-GFP, KRP6::H2B-GFP, KRP6::mock21ts-GFP, KRP6::TE21ts- GFP and KRP6::miR161ts-GFP constructs were generated through cloning of an overlapping PCR fragment containing the promoter sequence and the histone H2B sequence without stop codon with the primers specified in Supplementary Table 3. The overlapping PCR fragments generated were cloned in a pentr-d-topo gateway entry vector (Invitrogen). All the confirmed positive entry vectors were recombined into a promoterless version of the gateway destination vector pb7fgwg2,0 generated through removal of the 35S promoter region with the restriction enzymes SpeI and SacI and self-ligation of the resulting linearized vector. MGH3::MGH3-GFP, MGH3::MGH3-GFP-VEX1 3 UTR and MGH3::MGH3-GFP-TE 3 UTR were generated through sequential In-Fusion cloning of the MGH3 promoter plus the MGH3 coding sequence fragment without stop codon with the primers specified in Supplementary Table 3. The PCR fragment generated was cloned into the KpnI unique restriction site generated in a pmdc107 gateway destination vector modified through digestion with the restriction enzyme KpnI in order to remove the ccdb region. The digested vector was self-ligated in order to create a unique KpnI restriction site. This digestion leaves a unique SacI restriction site on the 3 UTR of the vector between the stop codon of mgfp6 and the nos terminator that was used to In-Fusion clone a 315 bp fragment of VEX1 (AT5G62850) sense coding region or a 315 bp fragment of Athila2 sense coding region with the primers specified in Supplementary Table 3. KRP6::mock22ts-trGFP, KRP6::TE21ts-trGFP, KRP6::miR173-trGFP, VCK1::mock22ts-trGFP, VCK1::TE21ts-trGFP and VCK1::miR173-trGFP were generated by cloning a trgfp fragment into pentr-d-topo (Invitrogen) with the primers specified in Supplementary Table 3. This allowed the cloning of a 420bp fragment from mgfp6 and the generation of a unique KpnI restriction site before the trgfp fragment. This KpnI unique restriction site was used to linearize a positive trgfp pentr-d-topo clone and in-fusion clone the KRP6 and VCK1 promoters with the different srna target sites amplified with the PCR primers specified in Supplementary Table NATURE PLANTS 1

2 3. Positive clones containing the KRP6 and VCK1 promoter with the srna target sites and the trgfp fragment were LR recombined into a pbgw,0 gateway destination vector. The KRP6::2b-RFP clone was generated by cloning of the viral silencing suppressor from a provided 2b plasmid (Feng Qu, The Ohio State University) into pentr-d-topo (Invitrogen) with the primers specified in Supplementary Table 3, which allowed both the creation of an unique KpnI restriction site right after the cloning site of the pentr-d-topo vector and the cloning of 2b without a stop codon. A confirmed positive clone was digested with KpnI, linearized and used for In-Fusion cloning of the KRP6 promoter with the primers specified in Supplementary Table 3. A confirmed positive entry clone was recombined into a promoterless version of the gateway destination vector pb7rwg2,0 generated through digestion of the 35S promoter region with the restriction enzymes SpeI and SacI and self-ligation of the resulting linearized vector. Analysis of microarray expression levels Developmental analysis of the level of steady state transcript accumulation in Supplemental Figure 1B was extracted from the Pollen Transcriptome Navigator ( which contains ATH1 microarray data for unicellular, bicellular, and tricellular pollen transcriptomes extracted from 1. Sperm and whole pollen transcriptome data for Supplemental Figure 3D is extracted from 2. 2 NATURE PLANTS

3 SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1. Identification of pollen vegetative cell-specific promoters (a) Experimental scheme to identify promoters that are specific to the vegetative cell and only expressed after pollen mitosis I. (b) Microarray steady-state mrna expression levels though pollen development. (c) The ACA1 and VEX1 promoters are specific to the vegetative nucleus and express late in pollen development. Each promoter drives the expression of an H2B-GFP fusion protein. DAPI marks the nuclei while RFP shows the background fluorescence levels. NATURE PLANTS 3

4 Supplementary Figure 2. Isolation of pure unicellular microspores The KRP6::H2B-GFP homozygous line was used for gradient centrifugation and microspore isolation. These microspores do not fluoresce GFP and only have one point of DAPI (one nucleus), in contrast to the 2-3 visible nuclei and GFP fluorescent vegetative nuclei detected in mature pollen. 4 NATURE PLANTS

5 SUPPLEMENTARY INFORMATION Supplementary Figure 3. Vegetative cell-specific expression and accumulation of RNAi pathway mrnas and proteins (a) Epifluorescence analysis of an AGO1 protein fusion to GFP under control of the endogenous AGO1 promoter. This transgene is from 3. The pollen grain also has the vegetative cell nucleus specific Act11pro::H2B-mRFP transgene from 4. (b) Confocal slice of an AGO1pro::AGO1-GFP pollen grain (top) and a sibling pollen grain that did not inherit the segregating transgene (bottom). The AGO1 protein accumulates in the pollen vegetative cell cytoplasm and nucleus but not in the sperm cells, which appear as two distinct dark shadows within the cytoplasm of the vegetative cell. (c) Analysis of a pollen grain with a transgene that has the DCL4 promoter driving H2B-GFP (DCL4pro::H2B-GFP). The pollen grain also has the vegetative cell nucleus specific Act11pro::H2B-mRFP transgene as in panel a. The DCL4 promoter is expressed from the pollen vegetative nucleus. (d) Ratio of sperm cell steady state mrna accumulation to whole pollen accumulation. Transcripts below 1.0 are vegetative cell enriched. NATURE PLANTS 5

6 Supplementary Figure 4. Comparison of pollen small RNA-sequencing libraries (a) Total microrna accumulation (mirbase release 21) normalized in reads per million. The libraries are not direct biological replicates, as the method of pollen harvesting and the genotypes differ between the wt Col pollen sequenced in 5 and this study. 6 NATURE PLANTS

7 SUPPLEMENTARY INFORMATION (b) Endogenous TE 21-22nt sirna production. TE 21-22nt sirna reads per million are reduced by roughly half in the dcl2/dcl4 double mutant. (c) Accumulation of microrna161 (black, above the X-axis) and the mock 21nt target site targeting small RNAs (red, below the X-axis). (d) Accumulation of microrna173 (black, above the X-axis) and the mock 22nt target site targeting small RNAs (red, below the X-axis). The accumulation of mirna173 is lower in genotypes with the mir173 target site transgene, suggesting that AGO cleavage of the mir/target mrna complex reduces a limited pool of microrna173. (e) Accumulation of sirnas that target the 3 UTRs of the GFP transgenes from Figure 4D-E. The Athila TE 3 UTR is shown in black above the X-axis and the Vex1 3 UTR is shown in red below the X-axis. For parts b-e, normalization was performed using reads per million (RPM)(left Y-axis) and reads per million micrornas (RPMM)(right Y-axis). Supplementary References 1 Honys, D. & Twell, D. Transcriptome analysis of haploid male gametophyte development in Arabidopsis. Genome Biol 5, R85 (2004). 2 Borges, F. et al. Comparative transcriptomics of Arabidopsis sperm cells. Plant Physiol 148, (2008). 3 McCue, A. D., Nuthikattu, S., Reeder, S. H. & Slotkin, R. K. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA. PLoS Genet 8, e (2012). 4 Rotman, N. et al. A novel class of MYB factors controls sperm-cell formation in plants. Curr Biol 15, (2005). 5 Slotkin, R. K. et al. Epigenetic reprogramming and small RNA silencing of transposable elements in pollen. Cell 136, (2009). NATURE PLANTS 7

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Local auxin metabolism regulates environment-induced hypocotyl elongation Zuyu Zheng 1,2, Yongxia Guo 3, Ondřej Novák 4,5, William Chen 2, Karin Ljung 4, Joseph P. Noel 1,3, *, and Joanne Chory 1,2, *

More information

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance

Learning Objectives. Define RNA interference. Define basic terminology. Describe molecular mechanism. Define VSP and relevance Learning Objectives Define RNA interference Define basic terminology Describe molecular mechanism Define VSP and relevance Describe role of RNAi in antigenic variation A Nobel Way to Regulate Gene Expression

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.

2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided. AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing

More information

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.

Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total)

Unit 6: Molecular Genetics & DNA Technology Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 16 The Molecular Basis of Inheritance Unit 6: Molecular Genetics

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing

Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing I LOVE YOU Plants Fight it out Intrinsic defence mechanism The magic world of Gene silencing Over expression of Chalcone synthase gene to get Purple Petunias Napoli, Lemieux & Jorgensen,1990 Desired Effect

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

Control of Eukaryotic Gene Expression (Learning Objectives)

Control of Eukaryotic Gene Expression (Learning Objectives) Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

mirnaselect pegp-mir Cloning and Expression Vector

mirnaselect pegp-mir Cloning and Expression Vector Product Data Sheet mirnaselect pegp-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-GP-C STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pegp-mir Cloning

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

More information

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b) Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

More information

Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential

Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential Supplemental Fig. 1. Transient expression of dynamic reporters of DNA methylation (DYNAMETs) in plants. (A) Schematic representation of potential dynamic reporter of DNA methylation (DYNAMET). A DYNAMET

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients

Supplemental Information. Boundary Formation through a Direct. Threshold-Based Readout. of Mobile Small RNA Gradients Developmental Cell, Volume 43 Supplemental Information Boundary Formation through a Direct Threshold-Based Readout of Mobile Small RNA Gradients Damianos S. Skopelitis, Anna H. Benkovics, Aman Y. Husbands,

More information

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing

Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina

More information

Construction of plant complementation vector and generation of transgenic plants

Construction of plant complementation vector and generation of transgenic plants MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological

More information

MicroRNA sequencing (mirnaseq)

MicroRNA sequencing (mirnaseq) , Robust experimental design Data analysis using the CAP-miRSeq: A comprehensive analysis pipeline for deep microrna sequencing E. Starr Hazard Over view of this first lecture 1) Review of very basic mirna

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Supporting Information

Supporting Information Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but

More information

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above

Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above 1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8

More information

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery!

Bio-Reagent Services. Custom Gene Services. Gateway to Smooth Molecular Biology! Your Innovation Partner in Drug Discovery! Bio-Reagent Services Custom Gene Services Gateway to Smooth Molecular Biology! Gene Synthesis Mutagenesis Mutant Libraries Plasmid Preparation sirna and mirna Services Large-scale DNA Sequencing GenPool

More information

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and

Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and Supplemental Figure 1. Mutation in NLA Causes Increased Pi Uptake Activity and PHT1 Protein Amounts. (A) Shoot morphology of 19-day-old nla mutants under Pi-sufficient conditions. (B) [ 33 P]Pi uptake

More information

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection

Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version

More information

Regulation of Gene Expression

Regulation of Gene Expression Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley

More information

Supplementary information, Figure S1

Supplementary information, Figure S1 Supplementary information, Figure S1 (A) Schematic diagram of the sgrna and hspcas9 expression cassettes in a single binary vector designed for Agrobacterium-mediated stable transformation of Arabidopsis

More information

Alternative Cleavage and Polyadenylation of RNA

Alternative Cleavage and Polyadenylation of RNA Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors

Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors Figure S1: Insert sequences for GR1, GR2, Qc3c_AgeI and GR3 vectors A Vector GR1 SacI BamHI CTCTGGCTAACTAGGC Insert 5/7nt - G TCGAGAGACCGATTGATCCG Insert 5/7nt - CCTAG 1 G CAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACAAC

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

Zool 3200: Cell Biology Exam 2 2/20/15

Zool 3200: Cell Biology Exam 2 2/20/15 Name: TRASK Zool 3200: Cell Biology Exam 2 2/20/15 Answer each of the following short and longer answer questions in the space provided; circle the BEST answer or answers for each multiple choice question

More information

AP Biology Gene Expression/Biotechnology REVIEW

AP Biology Gene Expression/Biotechnology REVIEW AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

mir-24-mediated down-regulation of H2AX suppresses DNA repair

mir-24-mediated down-regulation of H2AX suppresses DNA repair Supplemental Online Material mir-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells Ashish Lal 1,4, Yunfeng Pan 2,4, Francisco Navarro 1,4, Derek M. Dykxhoorn

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

Concepts and Methods in Developmental Biology

Concepts and Methods in Developmental Biology Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation

More information

Supplementary Figure 2

Supplementary Figure 2 Supplementary Figure 2 a SBS-C1 SBS-C2 SBS-C3 SBS-C4 SBS-C5 SBS-C6 SBS-C7 SBS-C8 SBS-C9 LCR CNS-1 CNS-2 Il5 Rad50 Il13 Il4 Kif3a Sept8 0 50 100 150 200kb Sau3AI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

More information

4/26/2015. Cut DNA either: Cut DNA either:

4/26/2015. Cut DNA either: Cut DNA either: Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC

Candidate region (0.74 Mb) ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC ATC TCT GGG ACT CAT TAG CAG GAG GCT AGC A idm-3 idm-3 B Physical distance (Mb) 4.6 4.86.6 8.4 C Chr.3 Recom. Rate (%) ATG 3.9.9.9 9.74 Candidate region (.74 Mb) n=4 TAA D idm-3 G3T(E4) G4A(W988) WT idm-3 ATC TCT GGG ACT CAT GAG CAG GAG GCT AGC

More information

AQA Biology A-level Topic 8: The control of gene expression

AQA Biology A-level Topic 8: The control of gene expression AQA Biology A-level Topic 8: The control of gene expression Notes Mutations Mutations are changes in the sequence of nucleotides in DNA molecules. Types of mutations include: Insertion/deletion mutations

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10163 Supplementary Table 1 Efficiency of vector construction. Process wells recovered efficiency (%) Recombineering* 480 461 96 Intermediate plasmids 461 381 83 Recombineering efficiency

More information

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression

Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia

More information

Protocol for tissue-specific gene disruption in zebrafish

Protocol for tissue-specific gene disruption in zebrafish Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Control of Eukaryotic Genes. AP Biology

Control of Eukaryotic Genes. AP Biology Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Gateway Vectors for BiFC

Gateway Vectors for BiFC Gateway Vectors for BiFC 1. The enhanced YFP (EYFP) are used (Split EYFP). 2. The Fusion fusion gene is expressed by CaMV35S promoter. 3. The N- or C-terminal fragments of EYFP are fused subsequent to

More information

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare

Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare Subtractive hybridization is a powerful technique particularly well-suited for the identification of target cdnas that correspond to rare transcripts, that are expressed in one population but not in the

More information

Regulation of Gene Expression

Regulation of Gene Expression CAMPBELL BIOLOGY IN FOCUS URRY CAIN WASSERMAN MINORSKY REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University SECOND EDITION

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc

Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount

More information

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab

Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is

More information

BIOLOGY. Chapter 16 GenesExpression

BIOLOGY. Chapter 16 GenesExpression BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results

More information

7.013 Practice Quiz

7.013 Practice Quiz MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel 7.013 Practice Quiz 2 2004 1 Question 1 A. The primer

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Problem Set 4

Problem Set 4 7.016- Problem Set 4 Question 1 Arginine biosynthesis is an example of multi-step biochemical pathway where each step is catalyzed by a specific enzyme (E1, E2 and E3) as is outlined below. E1 E2 E3 A

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Overview of Human Genetics

Overview of Human Genetics Overview of Human Genetics 1 Structure and function of nucleic acids. 2 Structure and composition of the human genome. 3 Mendelian genetics. Lander et al. (Nature, 2001) MAT 394 (ASU) Human Genetics Spring

More information

Biology 252 Nucleic Acid Methods

Biology 252 Nucleic Acid Methods Fall 2015 Biology 252 Nucleic Acid Methods COURSE OUTLINE Prerequisites: One semester of college biology (BIO 101 or BIO 173) and one semester of college English (ENG 111); completion of CHM 111is recommended.

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Year III Pharm.D Dr. V. Chitra

Year III Pharm.D Dr. V. Chitra Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves

More information

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG

PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG PROTEOMICS AND FUNCTIONAL GENOMICS PRESENTATION KIMBERLY DONG A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen Jason Moffat,1,2,4,10 Dorre A. Grueneberg,1,10

More information

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: ) Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Bacterial DNA replication

Bacterial DNA replication Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems

More information

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,

More information

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna

Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna

More information

Supplemental Information. Cytoplasmic Assembly and Selective Nuclear Import. of Arabidopsis ARGONAUTE4/siRNA Complexes. Molecular Cell, Volume 46

Supplemental Information. Cytoplasmic Assembly and Selective Nuclear Import. of Arabidopsis ARGONAUTE4/siRNA Complexes. Molecular Cell, Volume 46 Molecular Cell, Volume 46 Supplemental Information Cytoplasmic Assembly and Selective Nuclear Import of Arabidopsis ARGONAUTE4/siRNA Complexes Ruiqiang Ye, Wei Wang, Taichiro Iki, Chang Liu, Yang Wu, Masayuki

More information

Cambridge University Press

Cambridge University Press Figure 1.1. Model of RNAi pathway in C. elegans. Transmembrane protein SID-1 allows dsrna to enter the cell. In the cytoplasm,dsrna gets processed by DCR-1,existing in a complex with RDE-4,RDE-1 and DRH-1.

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:

More information

Chapter 11: Regulation of Gene Expression

Chapter 11: Regulation of Gene Expression Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas

More information

WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7.

WiscDsLox485 ATG < > //----- E1 E2 E3 E4 E bp. Col-0 arr7 ARR7 ACTIN7. s of mrna/ng total RNA (x10 3 ) ARR7. A WiscDsLox8 ATG < > -9 +0 > ---------//----- E E E E E UTR +9 UTR +0 > 00bp B S D ol-0 arr7 ol-0 arr7 ARR7 ATIN7 D s of mrna/ng total RNA opie 0. ol-0 (x0 ) arr7 ARR7 Supplemental Fig.. Genotyping and

More information

MISSION shrna Library: Next Generation RNA Interference

MISSION shrna Library: Next Generation RNA Interference Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/science.1203903/dc1 Supporting Online Material for Self-Recognition in Social Amoebae Is Mediated by Allelic Pairs of Tiger Genes Shigenori Hirose, Rocio Benabentos,

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information