Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
|
|
- Lambert Lane
- 5 years ago
- Views:
Transcription
1 Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki, Haruhiko Siomi, and Mikiko C. Siomi
2 Supplemental Data A (nt) 4, 2, 1, 5 2 EGFP-tj MT MT-1 MT-2 MT-3 MT-4 egfp probe gapdh probe B (nt) 4, 2, 1, 5 2 MT-2 MT-2-1 MT-2-2 MT-2-3 egfp probe gapdh probe Figure S1. Northern blotting, related to Figure 2. (A) Northern blotting using an egfp probe shows the expression levels of EGFP-tj MT and its mutants. The gapdh transcript was visualized as a loading control. (B) Northern blotting using an egfp probe shows the expression levels of MT-2 and its mutants. The gapdh transcript was visualized as a loading control.
3 A sgrna: (bp) bp B OSC-Δtj-cis 1 target site 1 traget site 2 5 -GATTCCAAGAATGTTTTCCAAATAGTCTCCACTCGAAAGAACATGTTTTCCAAAAAGAGTTTGTTAAAGCGTTTCCAAGGGGTCA-3 3 -CTAAGGTTCTTACAAAAGGTTTATCAGAGGTGAGCTTTCTTGTACAAAAGGTTTTTCTCAAACAATTTCGCAAAGGTTCCCCAGT-5 65 bp deletion TTGGTTTGATTCCAAG A C AAGGGGT C A G A T G T C A G OSC-Δtj-cis 2 target site 1 target site 3 5 -GATTCCAAGAATGTTTTCCAAATAGTCTCCACTCGAAAGAAC...ATTTGTGTTATACCACGCGTTATTGTAAGTTTGTCCCTA-3 3 -CTAAGGTTCTTACAAAAGGTTTATCAGAGGTGAGCTTTCTTG...TAAACACAATATGGTGCGCAATAACATTCAAACAGGGAT bp deletion T T GGTTT G AT TCCAAG A G TTAT TG T AAG TTTG T CCCT A TTT TTG T G T Figure S2. Targeted deletion of the Tj-cis-element by CRISPR/Cas9 from the Drosophila genome, related to Figure 3. (A) PCR on the genomic DNA isolated from OSC cells transfected with the CRISPR/Cas9 vector detected shorter DNA fragments (red arrowheads) (599 nt and 53 nt). A single DNA fragment (664 nt) appeared when genomic DNA from parental OSC cells was used (black arrowhead). (B) Sequencing of the PCR bands in Fig.3A confirms the genomic deletion in the mutant cell lines. Target sites of three sgrnas are shown in blue. Proto-spacer adjacent motifs are shown in red.
4 (nt) 4, 2, 1, 5 2 EGFP-tj-cis MT-5 egfp probe gapdh probe Figure S3. Northern blotting, related to Figure 4. Northern blotting using an egfp probe shows the expression levels of EGFP-tj-cis and MT-5. The gapdh transcript was visualized as a loading control.
5 A (kd) Yb CLIP 1 Yb CLIP 2 B Yb CLIP R= Yb CLIP2 C Tj locus 5 bp RefSeq 2 pirna 1 Yb CLIP1 D (nt) MT-8 EGFP-tj-cis MT-6 MT-7 E 3 4, 2, 1, egfp probe Count 2 1 base A C G U 5 2 gapdh probe Distance from crosslinked sites [nt] F Tj locus 5 bp RefSeq 1 Yb CLIP1 CIMS Tj-R2 Tj-R1 Tj-cis-element CIMS 344 Tj-cis-element Yb CLIP1 Tj-R1 CIMS 31 Yb CLIP1 Tj-R2 CIMS 712 Yb CLIP1
6 Figure S4. Yb binds pirna cluster transcripts, related to Figure 5. (A) Autoradiograph of Yb RNA complexes used for HITS-CLIP library generation. Library construction was performed twice. (B) The reproducibility of all Yb binding sites, when comparing two CLIP experiments was high (Pearson correlation co-efficient R =.98). The axis shows the amount of reads in each of the multisample clusters in log1 scale. (C) A browser view of Yb-CLIP tags and pirna sequences in wild-type OSCs (Figure S1A) mapped onto the Tj locus. The red dashed line indicates the Tj-cis-element. Signals are displayed as read counts. (D) Northern blotting using an egfp probe shows the expression levels of the constructs shown in Figure 5B. (E) Nucleotide composition around the CIMS identified in Yb HITS-CLIP data. The x-axis represents coordinates relative to the CIMS, where negative and positive values represent the upstream and downstream positions, respectively. The y-axis represents raw counts of each base. (F) CIMS defined with FDR <.1 mapped to Tj locus. Top panel: the Tj locus, with the number of Yb-CLIP tags and CIMS. Bottom panel: an enlarged view of the Tj-cis-element, Tj-R1 and Tj-R2.
7 A (nt) 4, 2, 1, MT-9 EGFP-tj-cis EGFP-flam-e1 EGFP-flam-e2 egfp probe B (nt) 4, 2, 1, MT-9 EGFP-tj-cis EGFP-flam-e1 EGFP-flam-e1-R2 EGFP-flam-e1-R1 egfp probe 5 2 gapdh probe 5 2 gapdh probe Figure S5. Northern blotting, related to Figure 6. (A and B) Northern blotting using an egfp probe shows the expression levels of the constructs shown in Figure 6B (A) and Figure 6D (B). The gapdh transcript was visualized as a loading control.
8
9 Figure S6. Artificial pirnas cause transcriptional silencing though Piwi-dependent pathway, related to Figure 7. (A) Scheme of the experiment to assess the exogenous pirna-induced gene silencing. (B) The efficiency of Krimper gene silencing through Krimper targeting pirnas as shown in Figure 7B was validated by the following experiments. Western blotting was performed to assess Krimp protein levels in blasticidin-selected exogenous pirna-expressing OSCs. Krimp protein levels were normalized to β-tubulin. Relative expression of OSCs transfected with the EGFP-tj-cis construct was presented as 1.. Bars represent means ± SD of three independent experiments. **P <.1. (C) The percentage of Krimp body containing EGFP-positive cells was calculated. Bars represent means ± SD of three independent experiments. (D) Western blot analysis of exogenous pirna-induced silencing in Piwi-depleted cells. Bars represent means ± SD of three independent experiments. *P <.5. (E) ChIP-qPCR analysis of RNA Pol II and H3K9me3 occupancy on the Krimp promoter following expression of Krimp targeting exogenous pirnas (Krimp-CDS-1 and Krimp-3 ). No targeting was used as a negative control. Bars represent means ± SD of three independent experiments. *P <.5. (F) The impact of strand orientation on the occupancy of RNA Pol II and H3K9me3 on the target region (left panel). Bars represent means ± SD of three independent experiments. *P <.5. Northern Blot analysis showed that sense or antisense pirnas were produced (right panel).
10 nucleus Yb primary pirna source Yb Yb primary binding of Yb pirna precursors target gene pirisc secondary binding of Yb Flam body Yb body primary pirnas Zuc MITO Figure S7. Model of somatic primary pirna biogenesis in Drosophila, related to all Figures. Our present study suggests that Yb determines primary pirna sources by two sequential modes of action: primary binding to cis-elements, representing the selection of pirna precursors among cellular RNAs, then secondary binding to downstream regions that represents the defining domains to be processed. The secondary binding may be accomplished either by 5 to 3 translocation or multimerization of Yb on the substrate. These implications are based on the fact that Yb is a member of the DEAD-box RNA helicases and our experimental observation that Yb self-associates in OSC cells (data not shown), respectively.
11 Table S1. DNA oligonucleotides and sirnas, related to experimental procedures. (Table S1.xlsx)
12 Supplemental Experimental Procedure Plasmid construction The EGFP-tj MT construct was generated using a KOD plus mutagenesis kit (Toyobo) with the primers EGFP-tj MT F/R. To generate the MT-1 construct, the Tj 3 UTR nt region of EGFP-tj MT was removed by inverse PCR using the primers MT-1 F/R. MT-2 and MT-3 constructs were also generated by inverse PCR using the MT-1 construct as a template with the primers MT-2 F/R and MT-3 F/MT-2 R. pace vector was generated by subcloning of the EGFP ORF of pegfp-c1 into NheI and HindIII sites of pacm. For MT-4 construct, the full-length actin42a 3 UTR was PCR-amplified with the primers act42a-3 UTR F/R from OSCs cdna samples using KOD plus DNA polymerase and then cloned between HindIII and NotI sites of pace. Mutations were introduced into the nt region of the actin42a 3 UTR using a KOD plus mutagenesis kit with the primers MT-4 F/R. MT-2-1, MT-2-2 and MT-2-3 constructs were generated using the KOD plus mutagenesis kit with the primers MT-2-1 F/R, MT-2-2 F/R and MT-2-3 F/R. For sgrna expression constructs, target-specific sequences were synthesized as 5'-phosphorylated oligonucleotides, annealed and ligated into the BbsI sites of pu6-bbsi-chirna (Addgene ID 45956). To generate the EGFP-tj-cis construct, the Tj 3 UTR nt region was first introduced downstream of the EGFP ORF of pace using the KOD plus mutagenesis kit with the primers EGFP-tj-cis F/R, and then a 25-nt tandem repeat was inserted into the construct by the same strategy using the primers R1 F/R. For the MT-5 construct, the Tj
13 3 UTR nt region of EGFP-tj-cis was first removed by inverse PCR using the primers delta-tj-cis F/R and then inserted upstream of the polya signal using an In-Fusion HD Cloning Kit (Clontech) according to the manufacturer's instructions. The target fragment containing the Tj 3 UTR nt region was PCR-amplified using the In-Fusion primers MT-5-insert F/R and then cloned into the linearized vector generated by PCR with the primers MT-5-vector F/R. For the MT-6 and MT-7 constructs, the target fragments of Tj 3 UTR were PCR-amplified with the In-Fusion primers MT-6-insert F/R and MT-7-insert F/R respectively, using a cdna library as a template and then cloned into the linearized vector generated by PCR with the primers delta-tj F/R. For the MT-8 construct, the multi-cloning site of pacm was introduced downstream of the EGFP ORF of EGFP-tj-cis construct using the KOD plus mutagenesis kit with the primers MT-8 F/R. For the constructs used in Figures 6, the target fragment of flam exon and CG9257 was PCR-amplified with the In-Fusion primers using a cdna library and genome DNA as a template and then cloned into the linearized vector generated by PCR with the primers delta-tj F/R. For Krimper and Tj targeting pirna expression constructs (Krimp-5, Krimp-CDS-1, Krimp-CDS-2, Krimp-3, Tj-5' and Tj-CDS), three repeat sequences of the pirna targeting regions were inserted into the BamHI site of EGFP-tj-cis in antisense orientation. To generate tandem repeats, the double-stranded monomer fragments were first generated by annealing two complementary single-stranded DNA fragments Krimp-5 S/AS, Krimp-CDS-1 S/AS, Krimp-CDS-2 S/AS, Krimp-3 S/AS, Tj-5 S/AS and Tj-CDS S/AS. Then, monomer fragments were ligated to form oligomers, followed by
14 digestion with BamHI and BclI to remove non-unidirectional repeats.
Schematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
More informationBootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
More informationSupplementary Information
Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen
More informationEnzyme that uses RNA as a template to synthesize a complementary DNA
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have
More informationSUPPLEMENTARY INFORMATION
Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationGT-rich promoters can drive RNA pol II transcription and deposition of H2A.Z in African trypanosomes
GT-rich promoters can drive RNA pol II transcription deposition of H2A.Z in African trypanosomes Carolin Wedel, Konrad U. Förstner, Ramona Derr T. Nicolai Siegel Appendix Table of Contents Appendix Materials
More informationSupplementary Figure 1. Diagram for CATCHA construct. Nature Biotechnology doi: /nbt.3444
Supplementary Figure 1 Diagram for CATCHA construct. Supplementary Figure 2 Representative view of ebony (left) and non-ebony (right) F2 flies from experiments described in Fig. 1c. F0 #1 F0 #2 F0 #3 F0
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationCRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter
CRISPR-dCas9 mediated TET1 targeting for selective DNA demethylation at BRCA1 promoter SUPPLEMENTARY DATA See Supplementary Sequence File: 1 Supplementary Figure S1: The total protein was extracted from
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationSupplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationTRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
More informationAllele-specific locus binding and genome editing by CRISPR at the
Supplementary Information Allele-specific locus binding and genome editing by CRISPR at the p6ink4a locus Toshitsugu Fujita, Miyuki Yuno, and Hodaka Fujii Supplementary Figure Legends Supplementary Figure
More informationZhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
More informationSupplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationAntisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
More informationSupplementary Figure 1. Nature Structural & Molecular Biology: doi: /nsmb.3494
Supplementary Figure 1 Pol structure-function analysis (a) Inactivating polymerase and helicase mutations do not alter the stability of Pol. Flag epitopes were introduced using CRISPR/Cas9 gene targeting
More informationSupporting Information
Supporting Information Development of a 2,4-Dinitrotoluene-Responsive Synthetic Riboswitch in E. coli cells Molly E. Davidson, Svetlana V. Harbaugh, Yaroslav G. Chushak, Morley O. Stone, Nancy Kelley-
More informationRegulation of ARE transcript 3 end processing by the. yeast Cth2 mrna decay factor
Regulation of ARE transcript 3 end processing by the yeast Cth2 mrna decay factor Manoël Prouteau, Marie-Claire Daugeron and Bertrand Séraphin Supplementary Information Material and Methods Plasmid construction
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationA Guide to CRISPR/Cas9
Genome editing and beyond freepik A Guide to CRISPR/Cas9 The latest advance in genomic DNA editing is the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system. This simple-touse
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationExperimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationApplied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
More informationSupplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells.
Supplementary Figure 1. Quantitative RT-PCR experimental validation of CRISPR/Cas9 and sgrnas expression in HEK293A transfected cells. HEK293A cells were transfected with the indicated combinations of
More information4/26/2015. Cut DNA either: Cut DNA either:
Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationIsolation of single-base genome-edited human ips cells without
Nature Methods Isolation of single-base genome-edited human ips cells without antibiotic selection Yuichiro Miyaoka, Amanda H. Chan, Luke M. Judge, Jennie Yoo, Miller Huang, Trieu D. Nguyen, Paweena P.
More informationConstruct Design and Cloning Guide for Cas9-triggered homologous recombination
Construct Design and Cloning Guide for Cas9-triggered homologous recombination Written by Dan Dickinson (ddickins@live.unc.edu) and last updated December 2013. Reference: Dickinson DJ, Ward JD, Reiner
More information1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA.
Supplemental data: 1. Primers for PCR to amplify hairpin stem-loop precursor mir-145 plus different flanking sequence from human genomic DNA. Strategy#1: 20nt at both sides: #1_BglII-Fd primer : 5 -gga
More information3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves
Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Suppl. Table 1 Oligonucleotides used in the study The table shows the structure and nucleotide position of the oligonucleotides used in the study along with their application
More informationImmunostaining of ovaries, S2 cells and OSCs was performed as previously described
Supplemental Material: Supplemental Materials and Methods Immunofluorescence Immunostaining of ovaries, S2 cells and OSCs was performed as previously described (Saito et al. 2006; Saito et al. 2009). The
More informationBiotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationSUPPLEMENTARY INFORMATION
Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs
More informationSUPPLEMENTARY EXPEMENTAL PROCEDURES
SUPPLEMENTARY EXPEMENTAL PROCEDURES Plasmids- Total RNAs were extracted from HeLaS3 cells and reverse-transcribed using Superscript III Reverse Transcriptase (Invitrogen) to obtain DNA template for the
More information6/256 1/256 0/256 1/256 2/256 7/256 10/256. At3g06290 (SAC3B)
Chr.III M 5M 1M 15M 2M 23M BAC clones F22F7 F1A16 F24F17 F24P17 T8E24 F17A9 F21O3 F17A17 F18C1 F2O1 F28L1 F5E6 F3E22 T1B9 MLP3 Number of recombinants 6/256 1/256 /256 1/256 2/256 7/256 1/256 At3g629 (SAC3B)
More informationSupplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified
Supplementary Figure 1. jmj30-2 and jmj32-1 produce null mutants. (a) Schematic drawing of JMJ30 and JMJ32 genome structure showing regions amplified by primers used for mrna expression analysis. Gray
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationSupplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)
Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The
More informationSupplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts.
Supplementary Figure 1. CRISPR/Cas9-induced targeted mutations in TaGASR7, TaDEP1, TaNAC2, TaPIN1, TaLOX2 and TaGW2 genes in wheat protoplasts. Lanes 1 and 2: digested CRISPR/Cas9-transformed protoplasts;
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationXXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationSequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
More informationChapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
More informationBacterial DNA replication
Bacterial DNA replication Summary: What problems do these proteins solve? Tyr OH attacks PO4 and forms a covalent intermediate Structural changes in the protein open the gap by 20 Å! 1 Summary: What problems
More information7.02/ RECOMBINANT DNA METHODS EXAM KEY
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the
More informationSupplemental Information. Autoregulatory Feedback Controls. Sequential Action of cis-regulatory Modules. at the brinker Locus
Developmental Cell, Volume 26 Supplemental Information Autoregulatory Feedback Controls Sequential Action of cis-regulatory Modules at the brinker Locus Leslie Dunipace, Abbie Saunders, Hilary L. Ashe,
More informationThe Biotechnology Toolbox
Chapter 15 The Biotechnology Toolbox Cutting and Pasting DNA Cutting DNA Restriction endonuclease or restriction enzymes Cellular protection mechanism for infected foreign DNA Recognition and cutting specific
More informationB. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationBiotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
More informationSite directed mutagenesis, Insertional and Deletion Mutagenesis. Mitesh Shrestha
Site directed mutagenesis, Insertional and Deletion Mutagenesis Mitesh Shrestha Mutagenesis Mutagenesis (the creation or formation of a mutation) can be used as a powerful genetic tool. By inducing mutations
More informationSpermatazoa. Sertoli cells. Morc1 WT adult. Morc1 KO adult. Morc1 WT P14.5. Morc1 KO P14.5. Germ cells. Germ cells. Spermatids.
a. Spermatazoa Sertoli cells Morc1 WT adult c. Morc1 KO adult Morc1 WT P1.5 Morc1 KO P1.5 Morc1 WT adult Morc1 KO adult Germ cells Germ cells Spermatids Spermatozoa Supplementary Figure 1. Confirmation
More informationi-stop codon positions in the mcherry gene
Supplementary Figure 1 i-stop codon positions in the mcherry gene The grnas (green) that can potentially generate stop codons from Trp (63 th and 98 th aa, upper panel) and Gln (47 th and 114 th aa, bottom
More informationAbcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
More informationB. Transgenic plants with strong phenotype (%)
A. TCTAGTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT AAATATGGTCTAAAGAAGAAGAATATGGTCTAAAGAAGAAGAATATGG 2XP35S STTM165 5 GGGGGATGAAGctaCCTGGTCCGA3 3 CCCCCUACUUC---GGACCAGGCU5 mir165 HindIII mir165 96 nt GTTGTTGTTGTTATGGTCTAGTTGTTGTTGTTATGGTCTAATTT
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More information