Multiplex-PCR and oligonucleotide microarray for detection of single. nucleotide polymorphisms associated with drug resistance in Plasmodium ACCEPTED

Transcription

1 JCM Accepts, published online ahead of print on 0 April 00 J. Clin. Microbiol. doi:./jcm Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Multiplex-PCR and oligonucleotide microarray for detection of single nucleotide polymorphisms associated with drug resistance in Plasmodium falciparum (Running title: Microarray for drug-resistance SNPs in Pf) Guo Qing Zhang 1, Ya Yi Guan 1, Hai Hui Sheng, Bin Zheng 1, Song Wu 1, Hua Sheng Xiao, and Lin Hua Tang 1, * National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, WHO Collaborating Center for Malaria, Schistosomiasis and Filariasis, 0 Rui Jin Er Road, Shanghai 000, China 1 National Engineering Center for Biochip at Shanghai, Li Bing Road, Pudong, Shanghai 0, China * Corresponding author. Mailing address: National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, 0 Rui Jin Er Road, Shanghai 000, China. Phone: -1-. Fax: ipd_sh@1.com. 0 1

2 ABSTRACT Drug resistance in Plasmodium falciparum is a serious public health threat in the endemic countries. Since resistance has been associated with specific single nucleotide polymorphisms (SNPs) in the parasite genes, molecular markers are becoming useful surrogates for monitoring the emergence and dispersion of drug resistance. In this study, a multiplex-pcr (mpcr) and oligonucleotide microarray method was developed for detection of these SNPs in genes encoding chloroquine resistance transporter (pfcrt), multi-drug resistance 1 (pfmdr1), dihydrofolate reductase (pfdhfr), dihydropteroate synthetase (pfdhps) and adenosine triphosphatase- (pfatpase) of P. falciparum. The results show that DNA microarray technology combined with multiplex PCR is a promising and time-saving tool supporting conventional detection methods, allowing sensitive, accurate, simultaneous analysis of the SNPs associated with drug resistance in P. falciparum. Keywords: Plasmodium falciparum; Drug resistance; Single nucleotide polymorphism; Polymerase chain reaction; Microarray 1

3 Malaria is still one of the most serious public health problems in the world; more than one million people worldwide die from it every year (). This trouble is largely caused by the resistance of Plasmodium falciparum to most antimalarial drugs currently used, including chloroquine (CQ), sulfadoxine-pyrimethamine (SP), mefloquine (MQ), amodiaquine (AQ) and lumefantrine (LUM); furthermore, reduced susceptibility of P. falciparum to artemisinin and its derivatives has been also reported (1, 1, ). Antimalarial drug resistance has been associated with single nucleotide polymorphisms (SNPs) in particular P. falciparum genes. The P. falciparum chloroquine resistance transporter (pfcrt) gene KT mutation has been linked to CQ and possibly AQ resistance (, 1, 0); the P. falciparum multi-drug resistance 1 (pfmdr1) gene NY mutation has sown association with the response of the parasite to aminoalcool quinolines as MQ (,, ) and LUM (); mutations N1I, CR, SN/T and I1L in P. falciparum dihydrofolate reductase (pfdhfr) gene have been associated with resistance to pyrimethamine (1, 1, 1, 1, ); mutations SA, AG, K0E, A1G, and A1 S/T in P. falciparum dihydropteroate synthetase (pfdhps) gene have been shown to confer resistance to sulfadoxine (1, 1, 1, ); and P. falciparum adenosine triphosphatase- (pfatpase) SN mutation has been associated with increased IC0s of artemether (, 1, 1). These SNPs are believed to represent molecular epidemiology surveillance tools of antimalarial drug resistance, which can complement the more conventional and logistically complex in vitro or in vivo test (,,, ).

4 Existing molecular methods for analysis of these SNPs include allele-specific PCR, PCR-restriction fragment length polymorphism (RFLP) analysis, multiplex PCR (mpcr)-rflp, DNA sequencing, dot blot hybridization techniques, molecular beacons method, real-time PCR, PCR-enzyme-linked immunosorbent assay, and pyrosequencing (1,,,,,, 1,, ). Each of these techniques offers its own advantages and limitations. Among the techniques, PCR RFLP protocols constitute the most common methodological approach for the analyses of these SNPs, but it is laborious and time-consuming. A rapid and high-throughput genotyping method would be ideal for large-scale population-based studies. The oligonucleotide microarray technology, also known as DNA chip, has provided an incredible technical development in rapid, large-scale and automatic analysis of SNPs (, ). Briefly, the principle of oligonucleotide microarray is based on reverse Southern hybridization on a glass or silicon substrate. The fluorescently labeled products hybridized to the immobilized probes on the substrate can be easily detected using a fluorescence-detecting scanner, and the readable fluorescent signals obtained are combined to determine the genotype of genes (1). In recent years, microarray technique has been successfully applied to the detection of resistance genes or resistance-associated SNPs in various pathogens (,,, ). Here, we introduce a one-step mpcr in combination with oligonucleotide microarray method for rapid, high-throughput detection of the antimalarial resistance-associated SNPs in pfcrt, pfmdr1, pfdhps, pfdhfr and pfatpase.

5 MATERIALS AND METHODS Samples. Three P. falciparum laboratory strains (D, HB, and DD) (0) and field samples (positive for P. falciparum by microscopy) collected on MM filter paper (Whatman, Maidstone, UK) from China s Yunnan province (0 samples), Hainan province ( samples) and Myanmar s Shan state ( samples) were used in this study. The genomic DNA of P. berghei (CS strain), P. cynomolgi (B strain) and P. vivax (collected from Anhui province, China) were used as controls. The research protocol was approved by the Chinese National Institute of Parasitic Diseases ethics committee. DNA extraction. Genomic DNA of P. falciparum laboratory strains D, HB, and Dd were provided by the Malaria Research and Reference Reagent Resource Center ( Extraction of DNA from bloodspots on filter paper was carried out by the Chelex-0 (Bio-Rad Laboratories, Hercules, CA) method described by Wooden and others () with some modifications described by Pearce and others (). The quality of DNA samples was tested by OD 0/0 measurement. Single Nucleotide Polymorphisms Studied. The following 1 SNPs were analyzed: pfcrt 1 T/A, G/C, G/T, 00 A/G, 0 T/A, 0 A/C (corresponding to codons CS, MI, NE, KT); pfmdr1 A/T, A/T (NY/F); pfdhps 1 T/G, 1 C/T/G, 1 C/G, 1 A/G, C/G and 01 G/T/A (SA/F/C, AG, K0E, A1G, and A1S/T); pfdhfr 1 T/C, 1 A/T, 1 T/C, 1 T/C, G/A/C and 0 A/T (C0R, N1I, CR, SN/T, and I1L); pfatpase 0 G/A (SN). These SNPs are located at eleven nucleotide positions as some positions include two or more

6 SNPs. Multiplex PCR. To reduce the time and cost of DNA amplification, an mpcr was developed to amplify the DNA fragments containing all the SNPs studied in one reaction. Five pairs of primers were designed using Primer.0 software and checked for specificity in a BLAST search available through the National Center for Biotechnology Information (NCBI) website ( The primers used in the mpcr are shown in Table 1. MPCR was performed with the PCR amplification kit of Genscript (Piscataway, NJ) following the manufacturer s instructions. Briefly, the mpcr was performed using the PTC 00 cycler (MJ Research Inc., Waltham, MA) in a total volume of 0 µl of reaction mix containing. µl of template DNA, µl of Genscript master mix and 1.0 µl of primers mixture (consisting of. µl 1. µm P1F,. µl 1. µm P1R,.0 µl 1. µm PF,.0 µl 1. µm PR,.0 µl 1. µm PF,.0 µl 1. µm PR,.0 µl 1. µm PF,.0 µl 1. µm PR,.0 µl 1. µm PF,.0 µl 1. µm PR). The mpcr cycling conditions were: C for 1 min one cycle; denaturation at C for 0 s, annealing at 0 C for min, and extension (ramping from 0 C to C by 0.1 C/s ) for about min 0 s, 0 cycles; C for min one cycle, and C hold. The resulting amplicon covers all the 1 observed SNPs. A total of µl of PCR product was identified by electrophoresis on a 0 g/l agarose gel to confirm the successful amplification. 1 0 Table 1 1

7 Fragmentation and labeling of mpcr product. MPCR products were purified with the QIAquick PCR Purification Kit (Qiagen Inc., USA) and treated by DNase I (Fermentas, Lithuania, U/µg DNA) to generate fragments of 0 to 00 bp. Reaction mixtures contained 1 mm Tris-HCl, 0. mm MgCl, 0.0 mm CaCl. Fragmentation reaction was performed as follows: C 1 min, C min. Labeling of DNA was performed using terminal deoxynucleotidyl transferase (TdT), reaction mixtures ( µl) contained 00 mm potassium cacodylate, mm Tris-HCl (ph.), 1 mm CoCl, 0.01% Triton X-0, 0 µm Cy-dCTP (GE Healthcare, USA), and 0 U TDT (Fermentas, Lithuania). The mixtures were incubated for 1 h at C followed by denaturation at C for min. Oligonucleotide probe design and microarray manufacture. For each of the polymorphic sites associated with antimalarial drug resistance, a group of probes were designed, differentiated by the interrogated base (s) positioned in the central region of the probes. To reduce the number of potential ambiguous hybridization results, some oligonucleotide probes were designed to represent combinations of SNPs, rather than one SNP. Totally eleven groups of probes were designed. Specificity of oligonucleotide probes was verified through a BLAST search. Based on initial hybridization experiments, some probes were optimized by modifying their length and sequence to achieve more uniform fluorescence intensities across the microarray. Probes were commercially synthesized and modified (Table ). Each probe contained a -amino group for immobilization chemistry, a 1-mer poly-dt spacer, followed by the nucleotide hybridization sequence. The probes were suspended in 0 mm phosphate buffer solution (PBS) containing

8 % sodium dodecyl sulfate (SDS) at a concentration of µm and printed on silylated slides (OPAldehydeSlide TM, CapitalBio Corporation, Beijing, China) by OmniGrid TM 0 Microarrayer (GeneMachine, San Carlos, CA, USA). Each slide was spotted with ten sets of three identical subarrays consisting of a matrix; a matrix includes specific probes and two Cy-labeled spotting control probes (sequence, ATTGCTTGCGGCGGTAACG-Cy), a positive hybridization control probe (TCTGCTTCTGCTTCTGCTT), a negative hybridization control probe (TCTGCTTCTCCTTCTGCTT), and a blank control probe (0 mm PBS containing 0.0% SDS). A schematic diagram of the probe positions on the microarray is shown in Fig. 1. Table Fig. 1 Hybridization and washing. Hybridization of fluorescently labeled ssdna samples to the oligonucleotide microarray was performed in 1 hybridization buffer ( sodium chloride-sodium phosphate-edta buffer, % dimethyl sulfoxide, 0.1% Triton X-0) at C for 1 h. Just before hybridization, µl of the Cy-labeled ssdna sample was mixed with equal volume of hybridization buffer containing 1 nm Cy-labeled control oligo (sequence, AAGCAGAAGCAGAAGCAGA), followed by denaturation at C for min and chilling on ice. After hybridization, the slides were washed at C for min with

9 saline sodium citrate (SSC) buffer containing 1% SDS, for min with 1 SSC buffer containing 0.% SDS, and for min with 0. SSC buffer. Traces of buffer were removed by air stream. Microarray scanning and analysis. Slides were scanned using a scanner GenePix 000B (Axon Instruments, CA, USA), data acquisition and processing was performed by using the software GenePix Pro.0 (Axon Instruments, CA, USA). The median of local background-corrected feature intensities (henceforth referred to as net intensities) and their signal-to-noise ratios (net intensities/standard deviation of local background) were used for further analyses. Each signal was ranked from highest to lowest in each probe group according to their net intensities. The highest ranked signal in each group was regarded as positive signal, and signal with intensities more than one-third of the strongest signal in that group was also considered positive signal, while signals with intensities less than one-third of the strongest signal were considered negative. When hybridized to single-infection samples, only one probe in each group produced a positive signal as the perfect match. In multiple infections, two or more probes with highest signal intensities in a group might be selected as positive. Microarray analyses of synthesized oligos. Because genotype variations of the five genes from the samples studied here were limited, we also used a set of synthesized 0-bp oligos (Table ) harboring all known genotypes of the loci studied to evaluate the microarray. Twenty combinations (Table ) of the synthesized oligos were detected by the microarray to test whether the method can correctly identify all possible genotypes in single

10 or mixed infection. The labeling and hybridization conditions were the same as above Table Table Traditional nested PCR-sequencing assay. To validate the results of microarray analysis, nested PCR-sequencing assays were performed in parallel. Nested PCRs described by Djimde and others () were used to amplify fragments of the pfcrt and pfmdr1 genes from genomic DNA. Nested PCRs described by Pearce and others () were used to amplify fragments of the pfdhfr and pfdhps genes. Nested PCR used to amplify fragments of the pfatpase gene will be described elsewhere (L.H. Tang et al. unpublished data). Sequencing reactions were carried out using ABI PRISM Big Dye terminator v.1 Cycle Sequencing kit (Applied Biosystems, USA) as specified by the manufacturer s protocol. The sequences of the amplicons were compared with the published data of the NCBI database by BLAST analysis. 1

11 RESULTS Multiplex PCR. We began our analysis with mpcr amplification of the five antimalarial resistance related genes from laboratory strains and field samples. Gel electrophoresis of the resulting mpcr products indicated that they were of the expected sizes (Fig. ). Under this amplification conditions, no nonspecific bands were observed for most samples. And the genomic DNA of P. vivax, P. berghei and P. cynomolgi could not yield any PCR product of expected length. Fig. Microarray analyses of laboratory strains and field samples. Net intensities achieved at the different oligonucleotide probes varied substantially, which is reflected by the wide range of signal-to-noise ratios from.±0. to 0.±.. However, upon hybridization to perfectly matching target DNA, signal-to-noise ratios at all probes were larger than three (Fig. A). This threshold is considered indicative of sufficient signal in fluorescence based microarray hybridization (). And, net intensities at matching probes always were at least five times as strong as those at probes with mismatch(es) to the respective targets (Fig. B), which will suffice for robust genotyping. 1 0 Fig. 1

12 All the SNPs in the three P. falciparum laboratory strains could be correctly analyzed by the mpcr-microarray system. In eight out of field samples, results could not be obtained due to failure of DNA extraction or mpcr amplification. Among genotyped positions of the successful hybridizations, (.%) yielded usable data, 1 (1.%) had inconsistent genotyping results between nested PCR-sequencing assay and microarray assay (Table S1). Four discrepancies were due to error in sequencing assay, three discrepancies were due to insufficient quality of probe spotting, three discrepancies were due to nonspecific signal of microarray, and two discrepancies were due to false determination of mixed infection by microarray. Scanning images and genotyping results of P. falciparum D and Dd are shown in Fig.. Table S1 Fig. Serial tenfold dilutions of genomic DNA ranging from 0 ng to 0. pg were used to test the sensitivity of the mpcr-microarray system. The results demonstrated that when the DNA was not less than 0.0 ng, all the SNPs in the five genes could be identified. When the DNA was diluted to pg, SNPs at codon 0, 1,,, and 1 of Pfdhfr could not be identified, but other SNPs were identified successfully. When the DNA was diluted to 0. pg, only SNPs at codon,, 0, 1 of Pfdhps and SNP at codon of Pfmdr1 could 1

13 be detected. The specificity of microarray assay was tested using mpcr products from P. berghei, P. cynomolgi and P. vivax. For these three parasites no positive signal was obtained with any specific probe except spotting control probe and positive hybridization control probe. To determine at what level minor SNPs in mixed infection can be detected, we mixed genomic DNA of D strain and Dd strain. These two strains have different genotypes at pfdhfr 1,,, pfmdr1, pfdhps, 1, and pfcrt,,. While DNA concentration of one parasite strain was fixed at ng/µl, DNA concentration of the other strain was serially ten-fold diluted from 0 ng/µl to 0. pg/µl. When the DNA concentration of D was fixed, Dd could be satisfactorily analyzed at 0 pg/µl. When the DNA concentration of Dd was fixed, D also could be satisfactorily analyzed at 0 pg/µl. There was.% (/) agreement among the genotypes obtained from three identical subarrays in the same slide for samples. Thirty samples were investigated on two separate tests by the microarray method and interpreted blindly, and the reproducibility between the repeated typing was.1% (1/0). Microarray analyses of the synthesized oligos. All SNPs in the 0 combinations of the synthesized oligos were identified without ambiguity by the microarray except two genotyped positions of pfdhps 0 which could not give usable signals due to spotting failure. The net intensity ratio of matching probes to the mismatch ones were more than five times for.% of the total and between. to.0 times for the others. Fig. shows 1

14 the scanning image of the combination 1 of the synthesized oligos (simulation of mixed infection of P. falciparum D and P. falciparum Dd). Fig. 1

15 DISCUSSION In this study, we describe the development of an mpcr based oligonucleotide microarray method which can simultaneously detect a set of SNPs, covering the genetic markers associated with the resistance of P. falciparum to the most common used antimalarial drugs such as CQ, AQ, MQ, LUM, pyrimethamine, sulfadoxine, and artemether. A high degree of concordance was observed when comparing the new microarray assay with the existing nested PCR-sequencing method, probably the most credible method currently used for detection of these SNPs. It indicates that the microarray technique for drug resistance associated genes genotyping is reliable and accurate. Traditional nested PCR method requires PCR reactions for application of the genes, which may take workdays to accomplish. Here, the use of mpcr to amplify the genes in one reaction leads to a significant decrease of time, cost and number of manipulations. It totally takes about h to perform the whole detection procedures, from mpcr reaction (.0 h), DNA labeling (.0 h), hybridization (1. h), microarray washing (0. h) to microarray scanning and analysis (0. h). There are 0 subarrays in a slide allowing the genotyping of different samples thrice by each assay, so approximately 0 samples could be analyzed for the 1 resistance-associated SNPs in one workday by two technicians. Therefore, this method is especially suitable for large-scale surveillance of the molecular markers. Besides, the method requires a less amount of genomic DNA, which is propitious to analyze samples with low parasite density. 1

16 The high throughput of the microarray method substantially reduces the cost. In estimating the cost, we included expenses associated with DNA isolation, multiplex-pcr, PCR product labeling, microarray production, microarray hybridization and microarray washing. The equipment and labor costs were not included. We calculated a price of. RMB (US$0.1) per SNP for the microarray method; it was lower than that for pyrosequencing ($. per SNP), conventional sequencing ($. per SNP) and RFLP ($. per SNP) (). Filter paper samples used in the present study offered considerable advantages for field collection, transportation, and storage over frozen liquid samples, but eight samples collected from Hainan province in 001 failed to be analyzed by microarray. We found that these samples were not stored in a dry environment and became moldy before tests were conducted. Thus it is probable that genomic DNA of the parasite in these samples were destroyed or degraded. Therefore, it is important to store samples properly to ensure high-quality DNA. In addition, since false determinations of microarray were mainly caused by nonspecific signals and poor probe spotting, the microarray silylated slides should be carefully kept from dust contamination and more efforts should be made to further improve the spotting quality. The testing results of the 0 combinations of the synthesized oligos show that the microarray is able to identify all the possible genotypes at the loci studied. Furthermore, it indicates that the technique can also tell the SNPs of mixed infection with P. falciparum of different genotypes, which enables the application of microarray in various regions for 1

17 different genetic background of P. falciparum. As a limitation, the microarray could only be used to analyze the known SNPs in the resistance related genes. Further studies are needed to develop microarray assay for detection of pfmdr1 copy number, which has been associated with resistance against chloroquine, mefloquine and probably artemisinins. Since new SNPs associated with antimalarial drug resistance are continuing to be discovered, the present microarray should be continuously updated by adding new probes. It needs to be noted that microarray technology requires a microarray spotter and a microarray scanner, which may not be available in ordinary laboratories. We hereby suggest a microarray laboratory be established in one or several endemic countries so that every site within the area can send filter paper samples to the laboratory for testing. Moreover, in the next phase we will try to adopt chemiluminescence in the microarray technology, and then the microarray assay can be performed in more laboratories. In conclusion, mpcr based microarray provides a promising tool for resistance-associated SNPs detection in P. falciparum. This approach not only saves time and cost, but also enables high-throughput detection of the SNPs. However, we consider that molecular techniques including microarray will complement rather than replace conventional in vivo or in vitro testing. Conventional resistance testing will remain indispensable for detection of resistance because the molecular results do not always correlate with clinical response in P. falciparum. Therefore, microarray-based analysis will be most useful in combination with conventional methods. We expect that the method 1

18 developed herein will considerably facilitate the molecular surveillance of antimalarial resistance in malaria-affected countries and regions. 1

19 ACKNOWLEDGMENTS This work was supported by the Key Science-Technology Project of the National Tenth Five-year Plan of China (NO. 00BA1B1). We are grateful to Dr. Yi Zhong Duan and Dr. Ying Xue Lin for providing P. falciparum samples. We thank Prof. Yao Yu Feng and Prof. Yi Chang Ni for critically reading the manuscript. We also thank the Malaria Research and Reference Reagent Resource Center for providing the genomic DNA of P. falciparum D, HB, and Dd. 1

20 REFERENCES Abdel-Muhsin, A. M., L. C. Ranford-Cartwright, A. R. Medani, S. Ahmed, S. Suleiman, B. Khan, P. Hunt, D. Walliker, and H. A. Babiker. 00. Detection of mutations in the Plasmodium falciparum dihydrofolate reductase (dhfr) gene by dot-blot hybridization. Am J Trop Med Hyg :-.. Alifrangis, M., S. Enosse, R. Pearce, C. Drakeley, C. Roper, I. F. Khalil, W. M. Nkya, A. M. Ronn, T. G. Theander, and I. C. Bygbjerg. 00. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent assay-based technology. Am J Trop Med Hyg :1-1.. Antwerpen, M. H., M. Schellhase, E. Ehrentreich-Forster, F. Bier, W. Witte, and U. Nubel. 00. DNA microarray for detection of antibiotic resistance determinants in Bacillus anthracis and closely related Bacillus cereus. Mol Cell Probes 1:1-.. Booth, S. A., M. A. Drebot, I. E. Martin, and L. K. Ng. 00. Design of oligonucleotide arrays to detect point mutations: molecular typing of antibiotic resistant strains of Neisseria gonorrhoeae and hantavirus infected deer mice. Mol Cell Probes 1:-. 1. Bruant, G., C. Maynard, S. Bekal, I. Gaucher, L. Masson, R. Brousseau, and J. Harel Development and validation of an oligonucleotide microarray for detection of multiple virulence and 0 antimicrobial resistance genes in Escherichia coli. Appl Environ Microbiol : Djimde, A., O. K. Doumbo, J. F. Cortese, K. Kayentao, S. Doumbo, Y. Diourte, A. Dicko, X. Z. 0

21 Su, T. Nomura, D. A. Fidock, T. E. Wellems, C. V. Plowe, and D. Coulibaly A molecular marker for chloroquine-resistant falciparum malaria. N Engl J Med :-.. Djimde, A., A. Dolo, A. Ouattara, S. Diakite, C. V. Plowe, and O. K. Doumbo. 00. Molecular diagnosis of resistance to antimalarial drugs during epidemics and in war zones. J Infect Dis 10:-.. Duraisingh, M. T., J. Curtis, and D. C. Warhurst. 1. Plasmodium falciparum: detection of polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes by PCR and restriction digestion. Exp Parasitol :1-.. Duraisingh, M. T., and P. Refour. 00. Multiple drug resistance genes in malaria -- from epistasis to epidemiology. Mol Microbiol :-.. Durand, R., J. Eslahpazire, S. Jafari, J. F. Delabre, A. Marmorat-Khuong, J. P. di Piazza, and J. Le Bras Use of molecular beacons to detect an antifolate resistance-associated mutation in Plasmodium falciparum. Antimicrob Agents Chemother :1-.. Eckstein-Ludwig, U., R. J. Webb, I. D. Van Goethem, J. M. East, A. G. Lee, M. Kimura, P. M. O'Neill, P. G. Bray, S. A. Ward, and S. Krishna. 00. Artemisinins target the SERCA of Plasmodium falciparum. Nature : Ehrenreich, A. 00. DNA microarray technology for the microbiologist: an overview. Appl 1 Microbiol Biotechnol : Gregson, A., and C. V. Plowe. 00. Mechanisms of resistance of malaria parasites to antifolates. 0 Pharmacol Rev : Happi, C. T., G. O. Gbotosho, O. A. Folarin, D. O. Akinboye, B. O. Yusuf, O. O. Ebong, A. 1

22 Sowunmi, D. E. Kyle, W. Milhous, D. F. Wirth, and A. M. Oduola. 00. Polymorphisms in Plasmodium falciparum dhfr and dhps genes and age related in vivo sulfadoxine-pyrimethamine resistance in malaria-infected patients from Nigeria. Acta Trop : Hyde, J. E. 00. Drug-resistant malaria. Trends Parasitol 1:-. 1. Jambou, R., E. Legrand, M. Niang, N. Khim, P. Lim, B. Volney, M. T. Ekala, C. Bouchier, P. Esterre, T. Fandeur, and O. Mercereau-Puijalon. 00. Resistance of Plasmodium falciparum field isolates to in-vitro artemether and point mutations of the SERCA-type PfATPase. Lancet : Johnson, D. J., D. A. Fidock, M. Mungthin, V. Lakshmanan, A. B. Sidhu, P. G. Bray, and S. A. Ward. 00. Evidence for a central role for PfCRT in conferring Plasmodium falciparum resistance to diverse antimalarial agents. Mol Cell 1:-. 1. Jung, M., H. Kim, K. Y. Nam, and K. T. No. 00. Three-dimensional structure of Plasmodium falciparum Ca+ -ATPase(PfATP) and docking of artemisinin derivatives to PfATP. Bioorg Med Chem Lett 1:-. 1. Kublin, J. G., F. K. Dzinjalamala, D. D. Kamwendo, E. M. Malkin, J. F. Cortese, L. M. Martino, R. A. Mukadam, S. J. Rogerson, A. G. Lescano, M. E. Molyneux, P. A. Winstanley, P. Chimpeni, T. E. Taylor, and C. V. Plowe. 00. Molecular markers for failure of sulfadoxine-pyrimethamine 1 and chlorproguanil-dapsone treatment of Plasmodium falciparum malaria. J Infect Dis 1: Lakshmanan, V., P. G. Bray, D. Verdier-Pinard, D. J. Johnson, P. Horrocks, R. A. Muhle, G. E. 0 Alakpa, R. H. Hughes, S. A. Ward, D. J. Krogstad, A. B. Sidhu, and D. A. Fidock. 00. A 1 critical role for PfCRT KT in Plasmodium falciparum verapamil-reversible chloroquine resistance.

23 Embo J : Ndiaye, D., J. P. Daily, O. Sarr, O. Ndir, O. Gaye, S. Mboup, and D. F. Wirth. 00. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal. Trop Med Int Health :-.. Pearce, R. J., C. Drakeley, D. Chandramohan, F. Mosha, and C. Roper. 00. Molecular determination of point mutation haplotypes in the dihydrofolate reductase and dihydropteroate synthase of Plasmodium falciparum in three districts of northern Tanzania. Antimicrob Agents Chemother :1-1.. Perreten, V., L. Vorlet-Fawer, P. Slickers, R. Ehricht, P. Kuhnert, and J. Frey. 00. Microarray-based detection of 0 antibiotic resistance genes of gram-positive bacteria. J Clin Microbiol :1-0.. Plowe, C. V. 00. Monitoring antimalarial drug resistance: making the most of the tools at hand. J Exp Biol 0:-.. Reed, M. B., K. J. Saliba, S. R. Caruana, K. Kirk, and A. F. Cowman Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature 0:0-0.. Sisowath, C., J. Stromberg, A. Martensson, M. Msellem, C. Obondo, A. Bjorkman, and J. P. Gil. 00. In vivo selection of Plasmodium falciparum pfmdr1 N coding alleles by 1 artemether-lumefantrine (Coartem). J Infect Dis : Tagelsir, N., Z. Ibrahim, A. Medani, O. Salih, A. Hamad, H. Giha, A. El-Agib, B. Khan, N. 0 Saeed, and M. Ibrahim. 00. High frequency of Plasmodium falciparum PfCRT KT and 1 PfpghNY in patients clearing infection after chloroquine treatment in the Sudan. Acta Trop

24 : Veiga, M. I., P. E. Ferreira, A. Bjorkman, and J. P. Gil. 00. Multiplex PCR-RFLP methods for pfcrt, pfmdr1 and pfdhfr mutations in Plasmodium falciparum. Mol Cell Probes 0:0-.. Vora, G. J., C. E. Meador, M. M. Bird, C. A. Bopp, J. D. Andreadis, and D. A. Stenger. 00. Microarray-based detection of genetic heterogeneity, antimicrobial resistance, and the viable but nonculturable state in human pathogenic Vibrio spp. Proc Natl Acad Sci U S A : Walliker, D., I. A. Quakyi, T. E. Wellems, T. F. McCutchan, A. Szarfman, W. T. London, L. M. Corcoran, T. R. Burkot, and R. Carter. 1. Genetic analysis of the human malaria parasite Plasmodium falciparum. Science : Wilson, P. E., A. P. Alker, and S. R. Meshnick. 00. Real-time PCR methods for monitoring antimalarial drug resistance. Trends Parasitol 1:-.. Wooden, J., S. Kyes, and C. H. Sibley. 1. PCR and strain identification in Plasmodium falciparum. Parasitol Today :0-0.. Woodrow, C. J., and S. Krishna. 00. Antimalarial drugs: recent advances in molecular determinants of resistance and their clinical significance. Cell Mol Life Sci :1-1.. World Health Organization. 00. Susceptibility of Plasmodium falciparum to antimalarial drugs: Report on global monitoring, World Health Organization, Geneva, Switzerland. 1. World Health Organization and UNICEF. 00. World malaria report 00. World Health 1 Organization, Geneva, Switzerland. 0. Zhang, F., S. Hu, J. Huang, H. Wang, Z. Wen, G. Yongyao, and S. Wang. 00. Development and 1 clinical evaluation of oligonucleotide microarray for HLA-AB genotyping. Pharmacogenomics

25 :-.. Zhou, Z., A. C. Poe, J. Limor, K. K. Grady, I. Goldman, A. M. McCollum, A. A. Escalante, J. W. Barnwell, and V. Udhayakumar. 00. Pyrosequencing, a high-throughput method for detecting single nucleotide polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes of Plasmodium falciparum. J Clin Microbiol :00-.. Zolg, J. W., G. X. Chen, and J. R. Plitt. 10. Detection of pyrimethamine resistance in Plasmodium falciparum by mutation-specific polymerase chain reaction. Mol Biochem Parasitol :-.

26 Table 1. Primers used in the multiplex PCR Gene Primer sequence pfcrt pfmdr1 pfdhps pfdhfr pfatpase P1F:GGAGGTTCTTGTCTTGGTAAAT P1R:ATATTGGTAGGTGGAATAGATTCT PF:TGTTGAAAGATGGGTAAAGAGCAGA PR:TCGTACCAATTCCTGAACTCACTT PF:GATTCTTTTTCAGATGGAGG PR:TTCCTCATGTAATTCATCTGA PF:TGATGGAACAAGTCTGCGACGTT PR:CTGGAAAAAATACATCACATTCATATG PF:AAAATAAATACCACATCAACACAT PR:TCAATAATACCTAATCCACCTAAA Amplicon size (bp) Reference 1 This study 1 This study 0 [] [] This study

27 Table. Oligonucleotide probes used in the microarray Name Corresponding genotype Sequence( ) A1 pfdhfr -0CN NH -(T)1-CCATGGAAATGTAATTCCCTAGATAT A -0CI NH -(T)1-CCATGGAAATGTATTTCCCTAGATAT A -0CN NH -(T)1-CATGGAAATGTAACTCCCTAGATATG A -0RN NH -(T)1-CCATGGAAACGTAATTCCCTAGATAT A -0RN NH -(T)1-CATGGAAACGTAACTCCCTAGATAT A -0RI NH -(T)1-CCATGGAAACGTATTTCCCTAGATAT B1 -C NH -(T)1-ATATGAAATATTTTTGTGCAGTTACAACAT B -R NH -(T)1-ATGAAATATTTTCGTGCAGTTACAAC B - control NH -(T)1-ATGAAATATTTTGGTGCAGTTACAAC C1 -S NH -(T)1-GAAGAACAAGCTGGGAAAGC C -N NH -(T)1-GGAAGAACAAACTGGGAAAGC C -T NH -(T)1-GAAGAACAACCTGGGAAAGC C - control NH -(T)1-GGAAGAACAATCTGGGAAAGC D1-1I NH -(T)1-AAATGTTTTATTATAGGAGGTTCCGT D -1L NH -(T)1-AAATGTTTTATTTTAGGAGGTTCCGT D -1 control NH -(T)1-ATGTTTTATTCTAGGAGGTTCCG E1 pfmdr1-n NH -(T)1-ATTAAAGAACATGAATTTAGGTGATGAT E -Y NH -(T)1-ATTAAAGAACATGTATTTAGGTGATGAT E -F NH -(T)1-TTAAAGAACATGTTTTTAGGTGATGATA E - control NH -(T)1-TTAAAGAACATGCATTTAGGTGATGA F1 pfatpase-s NH -(T)1-TTTGCTTATAAAAAATTAAGTAGTAAAGATTTAAATAT F -N NH -(T)1-CTTTGCTTATAAAAAATTAAATAGTAAAGATTTAAATAT

28 F - control NH -(T)1-TTTGCTTATAAAAAATTAACTAGTAAAGATTTAAATAT G1 pfdhps-aa NH -(T)1-AGAATCCGCTGCTCCTTTTGT G -AG NH -(T)1-AGAATCCGCTGGTCCTTTTGT G -SA NH -(T)1-GAGAATCCTCTGCTCCTTTTG G -SG NH -(T)1-GAGAATCCTCTGGTCCTTTTG G -FA NH -(T)1-GAGAATCCTTTGCTCCTTTTGT G -FG NH -(T)1-GAGAATCCTTTGGTCCTTTTGT G -CA NH -(T)1-GAGAATCCTGTGCTCCTTTTG H1-0K NH -(T)1-CACATACAATGGATAAACTAACAAATTA H -0E NH -(T)1-CACATACAATGGATGAACTAACAAATTA H -0 control NH -(T)1-CACATACAATGGATCAACTAACAAATT I1-1A NH -(T)1-GATTAGGATTTGCGAAGAAACATG I -1G NH -(T)1-GATTAGGATTTGGGAAGAAACATGA I -1 control NH -(T)1-GATTAGGATTTGAGAAGAAACATG J1-1A NH -(T)1-AAAAGATTTATTGCCCATTGCATGA J -1S NH -(T)1-AAAAAGATTTATTTCCCATTGCATGAAT J -1T NH -(T)1-AAAAAGATTTATTACCCATTGCATGAAT J -1 control NH -(T)1-AAAAGATTTATTCCCCATTGCATGA K1 pfcrt-cvmnk NH -(T)1-GTGTATGTGTAATGAATAAAATTTTTGCTA K -CVIET NH -(T)1-TGTATGTGTAATTGAAACAATTTTTGCTAA K -SVMNT NH -(T)1-TATTTATTTAAGTGTAAGTGTAATGAATACAATT K -CVIEK NH -(T)1-GTGTATGTGTAATTGAAAAAATTTTTGCTA K -S VMNT NH -(T)1-TATTTATTTAAGTGTATCTGTAATGAATACAATTTTTG 1

29 Table. Thirty-seven synthesized oligos Name Harboring genotype Sequence( ) A1 pfdhfr -0CN TGTAACTGCACGAAAATATTTCATATCTAGGGAATTACATTTCCATGGTA A -0CI TGTAACTGCACGAAAATATTTCATATCTAGGGAAATACATTTCCATGGTA A -0CN TGTAACTGCACGAAAATATTTCATATCTAGGGAGTTACATTTCCATGGTA A -0RN TGTAACTGCACGAAAATATTTCATATCTAGGGAATTACGTTTCCATGGTA A -0RN TGTAACTGCACGAAAATATTTCATATCTAGGGAGTTACGTTTCCATGGTA A -0RI TGTAACTGCACGAAAATATTTCATATCTAGGGAAATACGTTTCCATGGTA B1 -C TGATTCATTCACATATGTTGTAACTGCACAAAAATATTTCATATCTAGGG B -R TGATTCATTCACATATGTTGTAACTGCACGAAAATATTTCATATCTAGGG C1 -S AAATTTTTTTGGAATGCTTTCCCAGCTTGTTCTTCCCATAACTACAACAT C -N AAATTTTTTTGGAATGCTTTCCCAGTTTGTTCTTCCCATAACTACAACAT C -T AAATTTTTTTGGAATGCTTTCCCAGGTTGTTCTTCCCATAACTACAACAT D1-1I TCTTGATAAACAACGGAACCTCCTATAATAAAACATTTATAGTAATTTAA D -1L TCTTGATAAACAACGGAACCTCCTAAAATAAAACATTTATAGTAATTTAA E1 pfmdr1-n TAGGATTAATATCATCACCTAAATTCATGTTCTTTAATATTACACCAAAC E -Y TAGGATTAATATCATCACCTAAATACATGTTCTTTAATATTACACCAAAC E -F TAGGATTAATATCATCACCTAAAAACATGTTCTTTAATATTACACCAAAC F1 pfatpase-s TTCTTAATATTTAAATCTTTACTACTTAATTTTTTATAAGCAAAGCTAAG F -N TTCTTAATATTTAAATCTTTACTATTTAATTTTTTATAAGCAAAGCTAAG G1 pfdhps -AA TTGGATTAGGTATAACAAAAGGAGCAGCGGATTCTCCACCTATATCTATA G -AG TTGGATTAGGTATAACAAAAGGACCAGCGGATTCTCCACCTATATCTATA G -SA TTGGATTAGGTATAACAAAAGGAGCAGAGGATTCTCCACCTATATCTATA G -SG TTGGATTAGGTATAACAAAAGGACCAGAGGATTCTCCACCTATATCTATA

30 G -FA TTGGATTAGGTATAACAAAAGGAGCAAAGGATTCTCCACCTATATCTATA G -FG TTGGATTAGGTATAACAAAAGGACCAAAGGATTCTCCACCTATATCTATA 1 G -CA TTGGATTAGGTATAACAAAAGGAGCACAGGATTCTCCACCTATATCTATA H1-0K ACTAGATTATCATAATTTGTTAGTTTATCCATTGTATGTGGATTTCCTCT H -0E ACTAGATTATCATAATTTGTTAGTTCATCCATTGTATGTGGATTTCCTCT I1-1A TTTAATAGATTGATCATGTTTCTTCGCAAATCCTAATCCAATATCAAATA I -1G TTTAATAGATTGATCATGTTTCTTCCCAAATCCTAATCCAATATCAAATA J1-1A ACATTTTGATCATTCATGCAATGGGCAATAAATCTTTTTCTTGAATATCC J -1S ACATTTTGATCATTCATGCAATGGGAAATAAATCTTTTTCTTGAATATCC J -1T ACATTTTGATCATTCATGCAATGGGTAATAAATCTTTTTCTTGAATATCC K1 pfcrt-cvmnk GTTCTTTTAGCAAAAATTTTATTCATTACACATACACTTAAATAAATAAT K -CVIET GTTCTTTTAGCAAAAATTGTTTCAATTACACATACACTTAAATAAATAAT K -SVMNT GTTCTTTTAGCAAAAATTGTATTCATTACACTTACACTTAAATAAATAAT K -CVIEK GTTCTTTTAGCAAAAATTTTTTCAATTACACATACACTTAAATAAATAAT K -SVMNT GTTCTTTTAGCAAAAATTGTATTCATTACAGATACACTTAAATAAATAAT 0

31 Table. Twenty combinations of the synthesized oligos NO. Oligos combination a 1 A1, B1, C1, D1, E1, F1, G1, H1, I1, J1, K1 A, B, C, D, E, F, G, H, I, J, K A, B1, C, D1, E, F1, G, H1, I1, J, K A, B, C1, D, E1, F, G, H, I, J1, K A, B1, C, D1, E, F1, G, H1, I1, J, K A, B, C, D, E, F, G, H, I, J, K1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K A, B, C, D, E, F, G1, H, I, J, K A, B1, C, D1, E, F1, G, H1, I1, J, K A, B, C1, D, E1, F, G, H, I, J1, K A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, A 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, B 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, C 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, D 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, E 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, F 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, C, G 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, A, B, C, E, G, J, K 1 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, B, C, E, G, K 0 A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, D, K a Combinations 1- simulate single infection with various genotypes, combinations -0 simulate mixed infections. 1

32 Fig. 1. Schematic diagram of the probe positions on the microarray. A1-K, specific probes for detection of the SNPs; S, spotting control probe; N, negative control probe; P, positive control probe; B, blank control probe. Each probe was thrice spotted.

33 Fig.. Agarose gel electrophoresis of multiplex PCR products. M, 0 bp DNA ladder. Lane 1, P. falciparum D; lane, P. falciparum Dd; lane : P. falciparum HB; lanes -: P. falciparum samples collected from field; lane : P. vivax; lane : P. berghei; lane : P. cynomolgi; lane : Blank control (H O).

34 Fig.. Signal-to-noise ratios and mismatch discrimination. Data are based on three independent hybridizations of P. falciparum D. (A) Signal-to-noise ratios (means and standard errors) of perfectly matching probes. (B) Relative intensities of mismatched probes (means and standard errors).

35 Fig.. Scanning images of P. falciparum D and Dd. For D, Positive probes: A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, P, S. (Genotypes: pfdhfr 0/1CN, C, S, 1I; pfmdr1 N; pfatpase S; pfdhps / SG, 0K, 1A, 1A; pfcrt -CVMNK). For Dd, Positive probes: A, B, C, D1, E, F1, G, H1, I1, J, K, P, S. (Genotypes: pfdhfr 0/1CI, R, N, 1I; pfmdr1 F; pfatpase S; pfdhps / FG, 0K, 1A, 1S; pfcrt -CVIET).

36 Fig.. Scanning image of simulated mixed infection of P. falciparum D and P. falciparum Dd (combination 1 of synthesized oligos). Positive probes: A1, B1, C1, D1, E1, F1, G, H1, I1, J1, K1, A, B, C, E, G, J, K, P, S.

37

38

39

40

41