BREEDING, GENETICS, AND PHYSIOLOGY. OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System

Transcription

1 BREEDING, GENETICS, AND PHYSIOLOGY OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System M.R. Morsy and J.McD. Stewart ABSTRACT Low-temperature stress is a major limiting factor in rice production especially during the early seedling development stages. Two related cold-induced genes, OsLti6a and OsLti6b, were isolated from developing seedlings of a chilling-tolerant rice (Oryza sativa L.) cultivar CT6748. The OsLti6a protein (6.0 kda) is highly hydrophobic with two possible membrane-spanning domains. Concurrence of tolerance to cold stress and decreased membrane damage in rice seedlings with higher expression level of the OsLti6 genes indicated a possible role of these genes in increased membrane stability. To test this hypothesis and determine the functional role of the OsLti6 gene family in cold-stress tolerance, interaction between OsLti6a and other rice proteins was studied. No interaction was detected by the GAL4 yeast two-hybrid assay between OsLti6a and other rice proteins represented in high titer in a rice cdna library. OsLti6a appears to have minimum interaction with other proteins. Since changes in protein/lipid ratio are related to changes in membrane fluidity and integrity, we propose that OsLti6 may increase membrane stability by changing this ratio in response to cold stress. INTRODUCTION The functions of many stress-responsive genes remain unknown, and identification of the function of these genes is a challenge facing molecular biologists. One method to help understand the function of an unknown protein is to identify its interacting proteins. Fields and Song (1989) described the first yeast two-hybrid system used to identify protein-protein interaction. This system is based on the fact that eukaryotic transcrip- 117

2 AAES Research Series 550 tion factors have discrete and separable DNA-binding and transcriptional activation domains. In this system, fusing one test protein to the DNA-binding domain of the yeast GAL4 transcription factor, and fusing a second protein to the GAL4 activation domain allows protein-protein interactions to be tested. The fusion proteins are expressed in a suitable yeast strain and the interaction detected by assaying for expression of a GAL4- responsive reporter gene. Thus far, the properties of OsLti6 genes and their homologs are hypothetical, but based on their hydropathy plots (hydrophobic nature of the protein) and subcellular localization in the membrane fraction, they are thought to have a possible role in increasing membrane integrity during stress. This paper reports the results of research to identify possible interacting protein partners of OsLti6 using the yeast two-hybrid system. PROCEDURES Construction of Expression cdna Library An RNeasy kit (Qiagen, Valencia, Calif.) was used to isolate total RNA from 2-leaf stage rice seedlings of chilling-tolerant CT6748 grown under a 10/13 C regime for 4 days. The mrna was isolated from total RNA with a PolyA-Tract kit (Promega, Madison, Wis.) following the recommendations of the manufacturer. A yeast expression cdna library was made according to the HybriZAP2.1 two-hybrid system (Stratagene, La Jolla, Calif.). The initial titer of the HybriZAP-2.1 cdna library was 4.12x10 6 cfu/ml transformants with average insert size of 1.2 kb. Plasmid Construction OsLti6a was amplified with specific primers containing over-hangings for the EcoRI and XhoI restriction sequences at the 5 and 3 ends, respectively, for further directional cloning in the pbd-gal4 Cam vector. The OsLti6a template on the pbluescript vector was added to a PCR reaction and amplified using the primers: 5 GGAATTC- CAAGCAGAAGAATGGCGGACAGC 3 (F) and 5 CCGCTCGAGCTACTTGGT- GACCCAG 3 (R). After amplification, OsLti6a was cloned into pbd-gal4 Cam vector and transformed into E. coli DH5α. Positive clones were sequenced to confirm that transformed colonies contained the pbd-gal4 Cam vector with OsLti6a insert in the correct orientation. Yeast Transformation Competent yeast (Saccharomyces cerevisiae strain YRG-2) cells were prepared and transformed according to Gietz et al. (1992). Briefly, 100 ng of pbd/oslti6a construct, null pbd-gal4 Cam vector or control plasmids were placed in 50 ml tubes followed by the addition of 1 ml of competent yeast cells, 100 µg denatured salmon sperm, and 600 µl of TE LiAc PEG solution. The tubes were vortexed and incubated 118

3 B.R. Wells Rice Research Studies 2006 at 30 C for 30 minutes with shaking at 200 rpm. Each tube received 70 µl of DMSO, was mixed gently, and heat-shocked for 15 minutes at 42 C. Transformed cells were pelleted and resuspended in 1 ml of 1X TE buffer. One hundred µl of transformed cells were spread on synthetic dropout (SD) agar plates lacking leucine, or leucine and tryptophan, or tryptophan only, depending on the plasmid used as suggested by Stratagene, and incubated at 30 C for 2 to 4 days until colonies appeared. Yeast Protein Isolation and Western Blot Expression of OsLti6a protein was verified by western blot analysis after isolation of yeast total proteins. Yeast clones expressing the pbd/oslti6a and control yeast containing the null pbd-gal4 Cam were grown separately in selective SD broth lacking tryptophan overnight at 30 C. Cells were pelleted by centrifugation, washed with 1 ml ice-cold ddh2o, and again recovered by centrifugation. One ml ice-cold ddh2o containing 100 µg/ml phenyl methyl sulfonyl fluoride (PMSF) was added followed by 150 µl ice cold 2N NaOH + 8% β-mercaptoethanol (ME) (for 1 ml, 400 µl 5N NaOH µl ddh2o + 80 µl β ME). The tubes were mixed by inverting several times, incubated on ice for 10 min, and then 150 µl ice cold 50% tricholoroacetic acid (TCA) were added. The contents were again mixed by inverting the tubes several times, and the tubes were incubated on ice for 10 min. After centrifugation for 2 minutes, cells were washed with 1 ml ice-cold acetone and repelleted for 2 minutes. The pellet was dried and resuspended in 100 µl sample buffer (500 µl 3X sample buffer ph µl ddh2o µl β-me + 25 µl 1M Tris base µg PMSF + a drop of bromphenol blue). Proteins were denatured at 95 C for 5 min, then 10 µl were loaded on a gel for SDS-PAGE. Immunodetection of the OsLti proteins on a western blot was performed with the ECL Plus western blotting reagent and detection system (Amersham, Piscataway, N.J.) using a polyclonal antibody raised against OsLti6a protein as described by Morsy et al. (2005). Yeast Two-Hybrid Screening Ten control plasmids (separate or in pairwise combination) transformed into YRG-2 were tested for interaction by lacz expression assay before proceeding with the library transformation strain. The transformation results of these control plasmids identified no interaction, so transformation of YRG2-OsLti6 with the expression library followed. One hundred µg of plasmid DNA from the HybriZAP2.1 cdna library and 3 mg of salmon-sperm carrier DNA were transformed into YRG2-OsLti by the lithium acetate method described above. The transformation mixture was plated on SD medium lacking histidine, tryptophan, and leucine. For further selection of positive interactions, the lacz reporter gene activity was assayed by the filter-lift assay according to Stratagene recommendations. 119

4 AAES Research Series 550 RESULTS AND DISCUSSION A class of stress-induced genes coding for small hydrophobic proteins is found in many organisms, including animals, plants, fungi, and bacteria, suggesting that these genes have a roll in stress tolerance. We isolated two closely related genes, OsLti6a and OsLti6b, and proposed that they contribute to the biochemical processes involved in preserving the structural and functional integrity of the plasma membrane during cold stress in rice seedlings (Morsy et al., 2005). In an attempt to determine how OsLti6 proteins function, we checked the ability of OsLti protein to interact with other rice proteins. Full-length OsLti6a, fused to the GAL4 DNA-binding domain vector (pbd/oslti6a), was introduced into the YRG-2 yeast strain and was tested for activation of the HIS3 selectable marker and the LacZ reporter. The resulting YRG2-OsLti strain did not activate the transcription of the HIS3 selectable marker or the LacZ, thus demonstrating the absence of transcriptional activation in the pbd/oslti6a. Expression of the OsLti6a fusion protein was confirmed by western blot analysis where a band with molecular weight of ~23 kda was observed in the YRG2-OsLti yeast strain but not in the YRG2-BD containing the null vector (Fig. 1). Therefore, we proceeded to introduce the cdna expression library into the yeast bait strain. Controls for both positive and negative interaction gave the expected results, demonstrating that the yeast two-hybrid system was functioning properly (Fig. 2 a to f). A total of 4.12x10 6 transformants were screened for their ability to grow on a medium lacking histidine, tryptophan, and leucine. This initial screening yielded only a few, small positive clones after 14 days of incubation (Fig. 2h). Subsequent screening for lacz expression showed no activation (Fig. 2g). This experiment was repeated 4 times, with new transformation events from the expression library, with the same results. These results suggest that OsLti6a has very weak, if any, interaction with other rice proteins represented in the library used for screening. Investigation of protein-protein interaction between OsLti6a and the rice proteins, using the yeast two-hybrid system, showed no interaction between OsLti6a and other proteins represented in the screened library. One possible explanation for the positive effect of the OsLti6a fusion protein on survival, growth rate, and membrane leakiness in rice is that OsLti6a, as a small membrane protein, may cause changes in the protein/lipid ratio and thereby alter membrane fluidity. We propose that OsLti6 may enhance cellular membrane protection against stress via several mechanisms. These mechanisms may include alteration of the lipid/protein ratio and/or lipid mobility or via production of conformational changes to the lipid bilayer leading to more flexible membranes during cold stress. Lipid mobility is related to chilling sensitivity in plant thylakoid membranes via its effect on membrane fluidity (Gang et al., 1990) and membrane protection (Kota et al., 2002). The overall lipid mobility of the membranes depends to a certain extent on lipid-protein interactions, which are determined by the lipid/protein ratio. 120

5 B.R. Wells Rice Research Studies 2006 SIGNIFICANCE OF FINDINGS The correlation between the OsLti6 expression and decreased membrane leakiness in rice and increased survival with higher expression of OsLti without obvious interacting partners indicates that this protein is important in abiotic stress tolerance. A reasonable hypothesis is that OsLti6 increases membrane integrity during stress via alteration of the lipid/protein ratio and/or lipid mobility. ACKNOWLEDGMENTS The authors thank the Rice Research and Promotion Board for their financial support of the research. LITERATURE CITED Fields, S. and O. Song A novel genetic system to detect protein-protein interaction. Nature 340: Gang, L., P.F. Knowles, D.J. Murphyq, and D. Marsh Lipid-protein interactions in thylakoid membranes of chilling-resistant and -sensitive plants studied by spin label electron spin resonance spectroscopy. J. Biological Chemistry 26: Gietz, D., A. St. Jean, R.A. Woods, and R.H. Schiestl Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Research 20: Kota, Z., L.I. Horvath, M. Droppa, G. Horvath, T. Farkas, and T Pali Protein assembly and heat stability in developing thylakoid membranes during greening. Proc. National Academy of Sciences, USA 99: Morsy, M.R., A.M. Almutairi, J. Gibbons, S.J. Yun, and B.G. de los Reyes The OsLti6 genes encoding low molecular weight membrane proteins are differentially expressed in rice cultivars with contrasting sensitivity to low temperature. Gene 344:

6 AAES Research Series 550 kda YRG2-OsLti YRG2-BD YRG2-OsLti YRG2-BD a b Fig. 1. Conformation of OsLti expression in yeast. (a) SDS-PAGE profile showing the accumulation of a ~6.2 kda polypeptide in the protein extract of YRG2-OsLti yeast strain compared to YRG@BD yeast strain. (b) Western blot showing ~6.2 kda polypeptide detected by the OsLti antibody in the YRG2-OsLti yeast strain protein extract. The highmolecular-weight proteins binding the OsLti6 antibody are unknown but may result from low-stringency binding to other proteins or to aggregates of the fusion protein. 122

7 B.R. Wells Rice Research Studies 2006 a b c d e f h g Fig. 2. Results of yeast two-hybrid screening and positive and negative control transformations. a = Positive control LacZ pgal4, b = Negative interaction plamin C & pad-mut, c = Negative interaction plamin C & pad-wt, d = Positive interaction pbd-wt & pad-wt, e = Positive interaction pbd Mut, pad Mut, f = Negative control LacZ pbd WT, h = colonies grown on selective media after transformation of the YRG2-OsLti with rice GAL4-AD expression library, and g = selection for activation of LacZ reporter gene in positive clones. 123