Genetics Journal Club YoSon Park Feb 11, Announcement: Marco Trizzino s seminar March 25 th, 2016!
|
|
|
- Suzan Jackson
- 5 years ago
- Views:
Transcription
1 Genetics Journal Club YoSon Park Feb 11, 2016 Announcement: Marco Trizzino s seminar March 25 th, 2016!
2 Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial structures derived from crest cells Homologous skeletal elements derived from identical cell lineages among species Morphological patterning of the cells highly dependent on the embryonic development Kuratani 2005, Zoological science
3 Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial structures derived from crest cells Homologous skeletal elements derived from identical cell lineages among species Morphological patterning of the cells highly dependent on the embryonic development Kuratani 2005, Zoological science
4 Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial structures derived from crest cells Homologous skeletal elements derived from identical cell lineages among species Morphological patterning of the cells highly dependent on the embryonic development Kuratani 2005, Zoological science
5 Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial structures derived from crest cells Homologous skeletal elements derived from identical cell lineages among species Morphological patterning of the cells highly dependent on the embryonic development Kuratani 2005, Zoological science
6 Craniofacial development Implications in brain development, bipedal postures, etc Most craniofacial structures derived from crest cells Homologous skeletal elements derived from identical cell lineages among species Morphological patterning of the cells highly dependent on the embryonic development Neural- crest- derived Kuratani 2005, Zoological science
7 Gene expression and morphology Expression domains of homologous Hox genes Hox-code dependent vertebral specification in the mouse (Kessel 1992) Kuratani 2005, Zoological science
8 Gene expression and morphology Expression domains of homologous Hox genes Hox-code dependent vertebral specification in the mouse (Kessel 1992) Kuratani 2005, Zoological science
9 How do we approach this problem? Protein-coding regions of the genome remain largely conserved between humans and chimpanzees Morphological divergence may be driven by quantitative and spatiotemporal changes in gene expression mediated by cis-regulatory elements Differentiated ipscs/escs - a promising ground to test whether such changes may be concordant with predictions
10 How do we approach this problem? Protein-coding regions of the genome remain largely conserved between humans and chimpanzees Morphological divergence may be driven by quantitative and spatiotemporal changes in gene expression mediated by cis-regulatory elements Differentiated ipscs/escs - a promising ground to test whether such changes may be concordant with predictions
11 How do we approach this problem? Protein-coding regions of the genome remain largely conserved between humans and chimpanzees Morphological divergence may be driven by quantitative and spatiotemporal changes in gene expression mediated by cis-regulatory elements Differentiated ipscs/escs - a promising ground to test whether such changes may be concordant with predictions
12 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs are: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify
13 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs are: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify
14 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs show: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify
15 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs show: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify
16 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs show: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify
17 CNCCs from human and chimp ipscs Same cell culture conditions Chimp ipscs and human IPSCs show: Morphologically indistinguishable differentiation of highly mobile stellate cells Express a broad range of migratory NC markers Very low level of HOX gene expression Profiles consistent with CNCC identify Consistent with CNCC iden;ty
18 Genome-wide annotation of human and chimp CNCC regulatory elements Cis-regulatory regions CNCC TFs (TFAP2A and NR2F1) or p300 enrichment and/or increased chromatin accessibility Distal enhancers vs promoters Restricted by the ratio of H3K4me1/H3K4me3 enrichment at these sites Active vs inactive elements H3K27ac enrichment
19 Genome-wide annotation of human and chimp CNCC regulatory elements Cis-regulatory regions CNCC TFs (TFAP2A and NR2F1) or p300 enrichment and/or increased chromatin accessibility Distal enhancers vs promoters The ratio of H3K4me1/H3K4me3 enrichment at these sites Active vs inactive elements H3K27ac enrichment
20 Genome-wide annotation of human and chimp CNCC regulatory elements Cis-regulatory regions CNCC TFs (TFAP2A and NR2F1) or p300 enrichment and/or increased chromatin accessibility Distal enhancers vs promoters The ratio of H3K4me1/H3K4me3 enrichment at these sites Active vs inactive elements H3K27ac enrichment
21 Epigenomic patterns at most regions were highly correlated for human and chimp CNCCs
22 Epigenomic patterns at most regions were highly correlated for human and chimp CNCCs
23 Epigenomic patterns at most regions were highly correlated for human and chimp CNCCs
24 Functional tests for 208 of 247 candidate regions in mouse embryos in Visel et al, 2007 consistent w/ craniofacial dev role in embryogenesis
25 Highly conserved profiles both species
26 Highly conserved profiles both species H3K27ac enrichments highly concordant within species
27 Highly conserved profiles both species H3K27ac enrichments highly concordant within species A subset significantly species-biased (FDR<0.01)
28 Human and chimp CNCC H3K27ac profiles cluster together from 49 other human cell types
29 Human and chimp CNCC H3K27ac profiles cluster together from 49 other human cell types H3K27ac sufficiently recap species-bias prediction Chimp specific enhancers
30 Human and chimp CNCC H3K27ac profiles cluster together from 49 other human cell types H3K27ac sufficiently recap species-bias prediction Human specific enhancers
31 Of 14,606 annotated active human CNCC enhancers 84% invariant 4% nonorthologous 6% increased in humans 7% decreased in humans FDR 0.15 applied based on previous pub for chimp LCL ChIP-seqs
32 Of 14,606 annotated active human CNCC enhancers 84% invariant 4% nonorthologous 6% increased in humans 7% decreased in humans FDR 0.15 applied based on previous pub for chimp LCL ChIP-seqs
33 Of 14,606 annotated active human CNCC enhancers 84% invariant 4% nonorthologous 6% increased in humans 7% decreased in humans FDR 0.15 applied based on previous pub for chimp LCL ChIP-seqs
34 Of 14,606 annotated active human CNCC enhancers 84% invariant 4% nonorthologous 6% increased in humans 7% decreased in humans FDR 0.15 applied based on previous pub for chimp LCL ChIP-seqs
35 Functional validation of predictions by a luciferase reporter assay >80% tested enhancers correlated species bias Corollary a large portion of enhancer divergence can be explained by a cisregulatory environment
36 Functional validation of predictions by a luciferase reporter assay >80% tested enhancers correlated species bias Corollary a large portion of enhancer divergence can be explained by a cisregulatory environment
37 in vivo validation by a lacz reporter transgenic mouse assay
38 in vivo validation by a lacz reporter transgenic mouse assay Low expression in chimps
39 in vivo validation by a lacz reporter transgenic mouse assay Low expression in chimps High expression in humans
40 A distinct reduction of sequence conservation signatures in species-biased enhancers 163 HARs overlap active chromatin features in CNCCs Of these, 20 are speciesbiased
41 A distinct reduction of sequence conservation signatures in species-biased enhancers 163 HARs overlap active chromatin features in CNCCs Of these, 20 are speciesbiased
42 A distinct reduction of sequence conservation signatures in species-biased enhancers 163 HARs overlap active chromatin features in CNCCs Of these, 20 are speciesbiased
43 Specific endogeneous retroviruses enriched at species-biased enhancers Pairwise H3K27ac var prop to seq dissimilarity Motifs at divergent sites
44 Specific endogeneous retroviruses enriched at species-biased enhancers Pairwise H3K27ac var prop to seq dissimilarity Motifs at divergent sites
45 Specific endogeneous retroviruses enriched at species-biased enhancers Pairwise H3K27ac var prop to seq dissimilarity Motifs at divergent sites
46 Motifs for TFs with known effects in NC regulation identified in cluster analysis of corr. coeff.
47 Motifs recognized by ALX homeobox factors highly expressed in the face and mutated in severe frontonasal dysplasia in humans are also identified
48 Group 1 identifies motifs potentially recruiting repressive factors with negative effects on overall enhancer activity
49 Coordinator motifs highly predictive of active chromatin states and species bias were an outlier
50 Coordinator motifs are Positively selected within speciesbiased enhancers Causal for the observed chromatin changes CNCC-specific Singularly drive activity in luciferase report assays in CNCCs
51 Coordinator motifs are Positively selected within speciesbiased enhancers Causal for the observed chromatin changes CNCC-specific Singularly drive activity in luciferase report assays in CNCCs
52 Coordinator motifs are Positively selected within speciesbiased enhancers Causal for the observed chromatin changes CNCC-specific Singularly drive activity in luciferase report assays in CNCCs
53 Coordinator motifs are Positively selected within speciesbiased enhancers Causal for the observed chromatin changes CNCC-specific Sufficient to drive the activity in luciferase reporter assays in CNCCs
54 Impact of nucleotide changes within Coordinator motifs are analyzed Similarly prone to gain or loss in speciesbiased sets
55 Impact of nucleotide changes within Coordinator motifs are analyzed Similarly prone to gain or loss in speciesbiased sets
56 Chimp loss + human gain Impact of nucleotide changes within Coordinator motifs are analyzed Similarly prone to gain or loss in speciesbiased sets
57 Chimp gain + human loss Impact of nucleotide changes within Coordinator motifs are analyzed Similarly prone to gain or loss in speciesbiased sets
58 Similar to humans than chimps in Denisovans and Neanderthals
59 Significant speciesbiased GEx strongly enriched for nearby species-biased enhancers The fraction of speciesbiased genes scales with the number of flanking enhancers biased toward the same species
60 Significant speciesbiased GEx strongly enriched for nearby species-biased enhancers Species-biased genes fraction scales with the number of flanking enhancers
61 32 human and 65 chimp clusters of divergence passed the inflection point in the distribution Highly divergent clusters of tissue-specific enhancers may promote inter-species and intra-species phenotypic variation
62 32 human and 65 chimp clusters of divergence passed the inflection point in the distribution Highly divergent clusters of tissue-specific enhancers may promote inter-species and intra-species phenotypic variation
63 Ontological annotations of all significantly species-biased enhancers Candidates include BMP4, BMPER, PRDM16, COL17A1, PAX3, PAX7
64 Limitations Sample size Lack of independent validation presumably due to the rarity of available ESCs/iPSCs Topological cues for cell differentiation not considered due to protocols in vitro
65 Thank you! Questions? Comments?
Why DNA Isn t Your Destiny
Technical Journal Club April 7 2015 Why DNA Isn t Your Destiny Despoina Goniotaki Aguzzi Group GENOME: a genome is an organism s complete set of DNA, including all of its genes. Each genome contains all
Axel Visel. Genomic and Transgenic Resources for Craniofacial Enhancer Studies. January 2015 Update
Genomic and Transgenic Resources for Craniofacial Enhancer Studies January 2015 Update e11.5 Axel Visel e13.5 e15.5 Staff Scientist Genomics Division Lawrence Berkeley National Laboratory Associate Adjunct
Integrating diverse datasets improves developmental enhancer prediction
1 Integrating diverse datasets improves developmental enhancer prediction Genevieve D. Erwin 1, Rebecca M. Truty 1, Dennis Kostka 2, Katherine S. Pollard 1,3, John A. Capra 4 1 Gladstone Institute of Cardiovascular
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
Measuring Protein-DNA interactions
Measuring Protein-DNA interactions How is Biological Complexity Achieved? Mediated by Transcription Factors (TFs) 2 Transcription Factors are genetic switches 3 Regulation of Gene Expression by Transcription
Non-coding Function & Variation, MPRAs II. Mike White Bio /5/18
Non-coding Function & Variation, MPRAs II Mike White Bio 5488 3/5/18 MPRA Review Problem 1: Where does your CRE DNA come from? DNA synthesis Genomic fragments Targeted regulome capture Problem 2: How do
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs
NGS Approaches to Epigenomics
I519 Introduction to Bioinformatics, 2013 NGS Approaches to Epigenomics Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Background: chromatin structure & DNA methylation Epigenomic
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
File S1. Program overview and features
File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically
ChIP-seq analysis 2/28/2018
ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines
Nature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
GREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
Predicting tissue specific cis-regulatory modules in the human genome using pairs of co-occurring motifs
BMC Bioinformatics This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Predicting tissue specific
The genetic code of gene regulatory elements
The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts
The ENCODE Encyclopedia. & Variant Annotation Using RegulomeDB and HaploReg
The ENCODE Encyclopedia & Variant Annotation Using RegulomeDB and HaploReg Jill E. Moore Weng Lab University of Massachusetts Medical School October 10, 2015 Where s the Encyclopedia? ENCODE: Encyclopedia
Multi-omics in biology: integration of omics techniques
31/07/17 Летняя школа по биоинформатике 2017 Multi-omics in biology: integration of omics techniques Konstantin Okonechnikov Division of Pediatric Neurooncology German Cancer Research Center (DKFZ) 2 Short
Lecture 17. Transgenics. Definition Overview Goals Production p , ,
Lecture 17 Reading Lecture 17: p. 251-256, 260-261 & 264-266 Lecture 18: p. 258-264, 508-524 Transgenics Definition Overview Goals Production p.251-256, 260-261, 264-266 315 Definition A transgenic animal
: Genomic Regions Enrichment of Annotations Tool
http://great.stanford.edu/ : Genomic Regions Enrichment of Annotations Tool Gill Bejerano Dept. of Developmental Biology & Dept. of Computer Science Stanford University 1 Human Gene Regulation 10 13 different
3/15/2016. Genome = Genes + Gene Regulation. Personal Transcription Factor. Binding Site Mutations Point to. Personal Medical Histories
Personal Transcription Factor GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
DIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine
DIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine Defining MYB Transcriptional Network by Genome-wide Chromatin Occupancy Profiling (ChIP-Seq) 2010 E.Glazov, L. Zhao Transcription Factors:
ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015
ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or
ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind
C2H2 zinc finger proteins greatly expand the human regulatory lexicon
Supplementary Information for: C2H2 zinc finger proteins greatly expand the human regulatory lexicon Hamed S. Najafabadi*,1, Sanie Mnaimneh*,1, Frank W. Schmitges*,1, Michael Garton 1, Kathy N. Lam 2,
Supplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
Integrating Diverse Datasets Improves Developmental Enhancer Prediction
Integrating Diverse Datasets Improves Developmental Enhancer Prediction Genevieve D. Erwin 1,2, Nir Oksenberg 2,3, Rebecca M. Truty 1, Dennis Kostka 4, Karl K. Murphy 2,3, Nadav Ahituv 2,3, Katherine S.
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity.
Supplementary Figure 1 Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity. (a) ESTIMATE immune score from mrna expression array
Visually Relating Gene Expression and in vivo DNA Binding Data
Visually Relating Gene Expression and in vivo DNA Binding Data Min-Yu Huang, Lester Mackey, Soile V. E. Keränen, Gunther H. Weber, Michael I. Jordan, David W. Knowles, Mark D. Biggin and Bernd Hamann Institute
Simultaneous genome and transcriptome sequencing
Simultaneous genome and transcriptome sequencing Technical Journal Club 31.01.2017 Christina Müller Introduction Rapid growth of single cell genomics www.biomarkerinsights.qiagen.com Introduction Single
Methoden zur Analyse von Transkriptionsfaktoren. Seminar: BCII, Lausen
Methoden zur Analyse von Transkriptionsfaktoren Seminar: BCII, Lausen Gene expression: from transcription to translation Orphanides G, Reinberg D.Cell. 2002 Feb 22;108(4):439-51. Schematic of a gene regulatory
NIH Public Access Author Manuscript Fly (Austin). Author manuscript; available in PMC 2008 May 23.
NIH Public Access Author Manuscript Published in final edited form as: Fly (Austin). 2007 December ; 1(6): 337 339. The Abdominal-B Promoter Tethering Element Mediates Promoter-Enhancer Specificity at
Nature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
SNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
2/10/17. Contents. Applications of HMMs in Epigenomics
2/10/17 I529: Machine Learning in Bioinformatics (Spring 2017) Contents Applications of HMMs in Epigenomics Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2017 Background:
Supplementary Fig. S1. Building a training set of cardiac enhancers. (A-E) Empirical validation of candidate enhancers containing matches to Twi and
Supplementary Fig. S1. Building a training set of cardiac enhancers. (A-E) Empirical validation of candidate enhancers containing matches to Twi and Tin TFBS motifs and located in the flanking or intronic
sherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
Human Gene Regulation
Human Gene Regulation 4 Transcriptional networks underlying development ~20,000 genes take up 2% of the human genome. 1,000,000 gene regulation regions (promoters, enhancers, silencers, insulators) controlling
The Evolution of Lineage-Specific Regulatory Activities in the Human Embryonic Limb
The Evolution of Lineage-Specific Regulatory Activities in the Human Embryonic Limb Justin Cotney, 1,5 Jing Leng, 4,5 Jun Yin, 1 Steven K. Reilly, 1 Laura E. DeMare, 1 Deena Emera, 1 Albert E. Ayoub, 2,3
Nature Methods: doi: /nmeth Supplementary Figure 1. Construction of a sensitive TetR mediated auxotrophic off-switch.
Supplementary Figure 1 Construction of a sensitive TetR mediated auxotrophic off-switch. A Production of the Tet repressor in yeast when conjugated to either the LexA4 or LexA8 promoter DNA binding sequences.
A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo.
Gus Frangou, Stephanie Palmer & Mark Groudine Fred Hutchinson Cancer Research Center, Seattle- USA A Genetic Screen to Identify Mammalian Chromatin Modifiers In Vivo. During mammalian development and differentiation
What Can the Epigenome Teach Us About Cellular States and Diseases?
What Can the Epigenome Teach Us About Cellular States and Diseases? (a computer scientist s view) Luca Pinello Outline Epigenetic: the code over the code What can we learn from epigenomic data? Resources
Nature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
Introduction to genome biology
Introduction to genome biology Lisa Stubbs Deep transcritpomes for traditional model species from ENCODE (and modencode) Deep RNA-seq and chromatin analysis on 147 human cell types, as well as tissues,
Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone modifications or chromatin accessibility
Dogan et al. Epigenetics & Chromatin (2015) 8:16 DOI 10.1186/s13072-015-0009-5 RESEARCH Open Access Occupancy by key transcription factors is a more accurate predictor of enhancer activity than histone
Epigenetic modifications are associated with inter-species gene expression variation in primates
Zhou et al. Genome Biology 2014, 15:547 RESEARCH Open Access Epigenetic modifications are associated with inter-species gene expression variation in primates Xiang Zhou 1,2,4, Carolyn E Cain 1, Marsha
Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057
Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Reviewing sites: affinity and specificity representation binding
Core vertebrate long range cis-regulatory interactions revealed by zebrafish human comparative genomics
Core vertebrate long range cis-regulatory interactions revealed by zebrafish human comparative genomics Yves Clément & Hugues Roest Crollius GTGC Lyon 01/07/2016 Enhancers as long range cis-regulatory
DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements
Wilken et al. Epigenetics & Chromatin 2015, 8:8 RESEARCH Open Access DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements Matthew S Wilken 1,3,
Supporting Information
Supporting Information Gómez-Marín et al. 10.1073/pnas.1505463112 SI Materials and Methods Generation of BAC DK74B2-six2a::GFP-six3a::mCherry-iTol2. BAC clone (number 74B2) from DanioKey zebrafish BAC
Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C
CORRECTION NOTICE Nat. Genet. 47, 598 606 (2015) Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C Borbala Mifsud, Filipe Tavares-Cadete, Alice N Young, Robert Sugar,
The ENCODE Encyclopedia. Zhiping Weng University of Massachusetts Medical School ENCODE 2016: Research Applications and Users Meeting June 8, 2016
The ENCODE Encyclopedia Zhiping Weng University of Massachusetts Medical School ENCODE 2016: Research Applications and Users Meeting June 8, 2016 The Encyclopedia Of DNA Elements Consortium Goals: - Catalog
Discovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq Part 1 An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk http://bit.ly/bio2links
Lecture 20: Drosophila melanogaster
Lecture 20: Drosophila melanogaster Model organisms Polytene chromosome Life cycle P elements and transformation Embryogenesis Read textbook: 732-744; Fig. 20.4; 20.10; 20.15-26 www.mhhe.com/hartwell3
Insulator function and topological domain border strength scale with architectural protein occupancy
Van Bortle et al. Genome Biology 2014, 15:R82 RESEARCH Open Access Insulator function and topological domain border strength scale with architectural protein occupancy Kevin Van Bortle 1, Michael H Nichols
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
Molecular Biology of the Cell ed. By Bruce Albert et al. (free online through ncbi books)
Lecture 20 continued: Drosophila embryogenesis Embrygenesis Four classes of genes: Maternal genes Gap genes Pair-rule genes Segment polarity genes Homeotic genes Read 826-837Fig. D18- D27; 19.2; 19.16
Huijuan Feng, Shining Ma,Chao Ye & Zhixing Feng
Huijuan Feng, Shining Ma,Chao Ye & Zhixing Feng Background-Author introduction Research interest: Methods for gene mapping of complex traits Inference of population structure from genetic data Genome variation
Recent Advances Towards An Intraspecific Theory of Human Variation for Digital Models
Recent Advances Towards An Intraspecific Theory of Human Variation for Digital Models By Bradly Alicea freejumper@yahoo.com Department of Telecommunication, Information Studies, and Media and Cognitive
Bi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
Value Correct Answer Feedback. Student Response. A. Dicer enzyme. complex. C. the Dicer-RISC complex D. none of the above
1 RNA mediated interference is a post-transcriptional gene silencing mechanism Which component of the RNAi pathway have been implicated in cleavage of the target mrna? A Dicer enzyme B the RISC-siRNA complex
SUPPLEMENTARY INFORMATION
Supplementary Discussion Interestingly, a recent study demonstrated that knockdown of Tet1 alone would lead to dysregulation of differentiation genes, but only minor defects in ES maintenance and no change
Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls
Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls, Duke University Christopher D Brown, University of Pennsylvania November 9th,
Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.
Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred
Genome 541 Gene regulation and epigenomics Lecture 3 Integrative analysis of genomics assays
Genome 541 Gene regulation and epigenomics Lecture 3 Integrative analysis of genomics assays Please consider both the forward and reverse strands (i.e. reverse compliment sequence). You do not need to
Developmental Biology 3230 Exam 1 (Feb. 6) NAME
DevelopmentalBiology3230Exam1(Feb.6)NAME 1. (10pts) What is a Fate Map? How would you experimentally acquire the data to draw a Fate Map? Explain what a Fate Map does and does not tell you about the mechanisms
The B cell identity factor Pax5 regulates distinct transcriptional programs in early and late B lymphopoiesis
Manuscript EMBO-2011-80422 The B cell identity factor Pax5 regulates distinct transcriptional programs in early and late B lymphopoiesis Roger Revilla-i-Domingo, Ivan Bilic, Bojan Vilagos, Hiromi Tagoh,
Chromatin assortativity: Integrating epigenomic data and 3D genomic structure
Chromatin assortativity: Integrating epigenomic data and 3D genomic structure Vera Pancaldi 1, *, Enrique Carrillo-de-Santa-Pau 1, Biola Maria Javierre 2, David Juan 1, Peter Fraser 2, Mikhail Spivakov
Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
Computational Systems Biology Deep Learning in the Life Sciences
Computational Systems Biology Deep Learning in the Life Sciences 6.802 6.874 20.390 20.490 HST.506 Christina Ji April 6, 2017 DanQ: a hybrid convolutional and recurrent deep neural network for quantifying
Reviewers' Comments: Reviewer #1 (Remarks to the Author)
Reviewers' Comments: Reviewer #1 (Remarks to the Author) In this study, Rosenbluh et al reported direct comparison of two screening approaches: one is genome editing-based method using CRISPR-Cas9 (cutting,
Nature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
Transcription factors: from enhancer binding to developmental control
MODES OF TRANSCRIPTIONAL REGULATION Transcription factors: from enhancer binding to developmental control François Spitz 1 and Eileen E. M. Furlong 2 Abstract Developmental progression is driven by specific
ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)
ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent
Edinburgh Research Explorer
Edinburgh Research Explorer Human-Specific Gain of Function in a Developmental Enhancer Citation for published version: Prabhakar, S, Visel, A, Akiyama, JA, Shoukry, M, Lewis, KD, Holt, A, Plajzer-Frick,
Practice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
Knowledge-Guided Analysis with KnowEnG Lab
Han Sinha Song Weinshilboum Knowledge-Guided Analysis with KnowEnG Lab KnowEnG Center Powerpoint by Charles Blatti Knowledge-Guided Analysis KnowEnG Center 2017 1 Exercise In this exercise we will be doing
2. Materials and Methods
Identification of cancer-relevant Variations in a Novel Human Genome Sequence Robert Bruggner, Amir Ghazvinian 1, & Lekan Wang 1 CS229 Final Report, Fall 2009 1. Introduction Cancer affects people of all
Defining a Registry of Candidate Regulatory Elements to Interpret Disease Associated Genetic Variation
University of Massachusetts Medical School escholarship@umms GSBS Dissertations and Theses Graduate School of Biomedical Sciences 10-10-2017 Defining a Registry of Candidate Regulatory Elements to Interpret
TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:
Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated
Discovering gene regulatory control using ChIP-chip and ChIP-seq. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk bit.ly/bio2_2012 The Central Dogma
Il trascrittoma dei mammiferi
29 Novembre 2005 Il trascrittoma dei mammiferi dott. Manuela Gariboldi Gruppo di ricerca IFOM: Genetica molecolare dei tumori (responsabile dott. Paolo Radice) Copyright 2005 IFOM Fondazione Istituto FIRC
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
Applied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
Differential Gene Expression
Biology 4361 - Developmental Biology Differential Gene Expression June 18, 2009 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
The Role of Enhancers in Genetic and Epigenetic Control of Gene Expression
The Role of Enhancers in Genetic and Epigenetic Control of Gene Expression J. Wesley Pike Department of Biochemistry University of Wisconsin-Madison, Madison, Wisconsin Encode Users Mee?ng-2016 Stanford
Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
Motifs. BCH339N - Systems Biology / Bioinformatics Edward Marcotte, Univ of Texas at Austin
Motifs BCH339N - Systems Biology / Bioinformatics Edward Marcotte, Univ of Texas at Austin An example transcriptional regulatory cascade Here, controlling Salmonella bacteria multidrug resistance Sequencespecific
Introduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
Title: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Background
Title: Genome-Wide Predictions of Transcription Factor Binding Events using Multi- Dimensional Genomic and Epigenomic Features Team members: David Moskowitz and Emily Tsang Background Transcription factors
BunDLE-seq (Binding to Designed Library, Extracting and Sequencing) -
Protocol BunDLE-seq (Binding to Designed Library, Extracting and Sequencing) - A quantitative investigation of various determinants of TF binding; going beyond the characterization of core site Einat Zalckvar*
Finding Eukaryotic Genes Computationally
Gene Identification Finding Eukaryotic Genes Computationally ü Content-based Methods GC content, hexamer repeats, composition statistics, codon frequencies ü Site-based Methods donor sites, acceptor sites,
Differential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression September 28, 2006 Chromatin Structure ~140 bp ~60 bp Transcriptional Regulation: 1. Packing prevents access CH 3 2. Acetylation ( C O )
Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg
Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg 248-255 Which genes are transcribed on the chromosomes are carefully regulated at many points. Watch this! https://www.youtube.com/watch?v=oewozs_jtgk
Exercises: Analysing ChIP-Seq data
Exercises: Analysing ChIP-Seq data Version 2018-03-2 Exercises: Analysing ChIP-Seq data 2 Licence This manual is 2018, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
Epigenetics and DNase-Seq
Epigenetics and DNase-Seq BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under CC BY-NC 4.0 by Anthony