Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity.
|
|
- Mabel Sherman
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Infiltrating immune cells do not differ between T2E and non-t2e samples and represent a small fraction of total cellularity. (a) ESTIMATE immune score from mrna expression array data for non-t2e and T2E samples. (b) Estimated percentage of tumor infiltrating lymphocytes within each tumor sample as assessed by H&E staining.
2 Supplementary Figure 2 ChIP-seq signal distribution across the genome of primary prostate tissue samples. (a) Distribution of H3K27ac enriched cis-regulatory elements across promoters, introns, exons, downstream/3 UTR, and promoter/5 UTR elements in each of the 19 samples profiled by ChIP-seq. Snapshot of H3K27ac levels surrounding (b) the housekeeping ACTB gene and (c) prostate-specific KLK3 gene.
3 Supplementary Figure 3 Classification of samples into T2E and non-t2e on the basis of ERG expression. (a) Complete linkage hierarchical clustering of HOXB13, AR, ERG, and FOXA1 mrna expression values in 17 CPCG tumor samples. (b) Immunohistochemical staining of ERG in 6 T2E and 5 non-t2e CPCG samples.
4 Supplementary Figure 4 T2E-up and T2E-down elements are proximal to known ERG targets and genomic regions previously not classified as T2E specific. Snapshots of H3K27ac levels in proximity to (a) LAMC2, (b) LINC00898, (c) POTEB, and (b) HTR7 genes.
5 Supplementary Figure 5 Promoter and enhancer acetylation changes between T2E and non-t2e primary prostate tumors are significantly predictive of one another and of associated gene expression changes. Volcano plots of log 2 fold change vs -log 2 FDR-corrected q-value for statistical significance of differential H3K27ac ChIP-seq signal between T2E and non-t2e tumors at enhancer regions linked to (a) T2E-up promoters or (b) T2E-down promoters. Volcano plots of log fold change vs -log FDR corrected q-value for statistical significance of matched differential mrna expression between T2E and non-t2e tumors for mrna associated with genes whose promoters (c) or predicted enhancers (d) show differential H3K27ac ChIP-seq signal between T2E and non-t2e tumors.
6 Supplementary Figure 6 ERG recruits prostate master transcription factors to T2E-up elements.
7 (a) Motif enrichment for selected motifs in cis-regulatory elements that were not significantly different between T2E and non-t2e tumors. (FKH: Forkhead; ARE: androgen response element; ETS: E26 transformation specific; HBOX: homebox). (b) Western blot of ERG, FOXA1, and HOXB13 following depletion of ERG with sirna in VCaP cells. Vinculin was blotted as a loading control. (sictl: non-targeting sirna; sierg: ERG targeting sirna). (c) ChIP-seq signal plots of average HOXB13 tag density in VCaP cells treated with control non-targeting sirna or ERG targeting sirna at HOXB13/ERG co-bound T2E-up elements, (d) HOXB13 bound T2E-up elements not ERG bound, (e) HOXB13 bound T2Edown elements, and (f) HOXB13 peaks that are not T2E-up, T2E down, and not bound by ERG. (g) ChIP-seq plots of average FOXA1 tag density in VCaP cells treated with control non-targeting sirna or ERG targeting sirna at FOXA1/ERG co-bound T2E-up elements, (h) FOXA1 bound T2Eup elements not ERG bound, (i) FOXA1 bound T2E-down elements, and (j) FOXA1 peaks that are not T2E-up, T2E down, and not bound by ERG. (k). Co-immunoprecipitation of FOXA1, ERG, and HOXB13 transcription factors in VCaP cells. Arrows indicate expected size of protein on blot. (IP: immunoprecipitation; WB: western blot).
8 Supplementary Figure 7 ERG colocalizes with FOXA1, HOXB13 and AR at T2E-up elements. Snapshot depicting H3K27ac ChIP-seq signal in primary tumors and VCaP cells as well as FOXA1, HOXB13, AR and ERG binding in VCaP cells at seven loci tested (Fig. 3g) by ChIP-reChIP-qPCR.
9 Supplementary Figure 8 COREs surround prostate master transcription factors, and CORE deregulation in T2E prostate cancer corresponds to T2E-specific gene expression changes. Snapshot depicting H3K27ac ChIP-seq signal in T2E and non-t2e primary prostate cancer for (a) FOXA1 and (b) HOXB13. (c) Volcano plot of log 2 fold change vs -log 2 FDR-corrected q-value for statistical significance of differential expression from MSKCC dataset of all genes that were overlapping a T2E-up or T2E-down CORE.
10 Supplementary Figure 9 CRISPR-mediated deletions of the TMPRSS2 ERG CORE. (a) Snapshot depicting H3K27ac ChIP-seq signal in primary tumors, VCaP cells, and HUVEC cells as well as master transcription factor binding in VCaP cells across the control AAVS1 locus in the PPP1R12C gene. (b) PCR blots to verify deletions of EC1, EC2, EC3, and control loci. PCR products running below expected size products represent deletion fragments. (*: non-specific PCR product).
11 Supplementary Figure 10 Cis-regulatory elements affected by ERG enrich for genes involved in NOTCH and developmental signaling pathways. log 10 FDR values for top ten GO biological processes terms in (a) VCaP sierg H3K27ac down cis-regulatory elements, (b) primary tissue defined T2E-up cis-regulatory elements, and (c) primary tissue defined T2E-up COREs.
12 Supplementary Figure 11 Key NOTCH pathway genes associated with T2E-up cis-regulatory elements and COREs are overexpressed in T2E prostate cancer. Log 2 mrna array expression values for T2E and non-t2e samples within the entire CPCG cohort for (a) HES1, (b) JAG1, and (c) DLL1.
13 Supplementary Figure 12 BMP and Nodal signaling genes do not show essentiality in a T2E-specific manner. Average gene level Z-score in the Achilles project dataset from (a) BMP and (b) Nodal signaling pathway genes in 22Rv1and VCaP cells. Distributions were obtained from 1,000 random gene sets.
14 Supplementary Figure 13 Saturation analysis of called H3K27ac peaks stratified by T2E status suggests we have identified at least 95% of potential peaks. A non-linear regression model was fit to the number of new peaks obtained sequentially over all samples for 1,000 permutations of sample orders and stratified according to (a) T2E and (b) nont2e status. Individual points show mean new peaks per sample added and associated standard error of the mean fitted blue line shows fitted model with saturation line (red) marked as well as estimated number of samples needed to identify 95, 97 and 99% of peaks (grey lines).
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Characterization of Hi-C/CHi-C dynamics and enhancer identification. (a) Scatterplot of Hi-C read counts supporting contacts between domain boundaries. Contacts enclosing domains
More informationSupplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat
Supplementary Figure 1. NORAD expression in mouse (A) and dog (B). The black boxes indicate the position of the regions alignable to the 12 repeat units in the human genome. Annotated transposable elements
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Endogenous gene tagging to study subcellular localization and chromatin binding. a, b, Schematic of experimental set-up to endogenously tag RNAi factors using the CRISPR Cas9 technology,
More informationSupplemental Figure 1.
Supplemental Data. Charron et al. Dynamic landscapes of four histone modifications during de-etiolation in Arabidopsis. Plant Cell (2009). 10.1105/tpc.109.066845 Supplemental Figure 1. Immunodetection
More informationFigure S1. nuclear extracts. HeLa cell nuclear extract. Input IgG IP:ORC2 ORC2 ORC2. MCM4 origin. ORC2 occupancy
A nuclear extracts B HeLa cell nuclear extract Figure S1 ORC2 (in kda) 21 132 7 ORC2 Input IgG IP:ORC2 32 ORC C D PRKDC ORC2 occupancy Directed against ORC2 C-terminus (sc-272) MCM origin 2 2 1-1 -1kb
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11326 Supplementary Figure 1: Histone exchange increases over the ORF in a set2 mutant. (a) Gene average analysis. Schematic representation of the bin distribution over the coding and
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More informationTE5 KYSE510 TE7 KYSE70 KYSE140
TE5 KYSE5 TT KYSE7 KYSE4 Supplementary Figure. Hockey stick plots showing input normalized, rank ordered H3K7ac signals for the candidate SE-associated lncrnas in this study. Rpm Rpm Rpm Chip-seq H3K7ac
More informationSupplementary Information
Supplementary Information Table of contents: Pages: Supplementary Methods 2-3 Supplementary Figure 1 4 Supplementary Figure 2 5 Supplementary Figure 3 6 Supplementary Figure 4 7 Supplementary Figure 5
More informationNature Genetics: doi: /ng Supplementary Figure 1. ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets.
Supplementary Figure 1 ChIP-seq genome browser views of BRM occupancy at previously identified BRM targets. Gene structures are shown underneath each panel. Supplementary Figure 2 pref6::ref6-gfp complements
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationChIP-seq analysis 2/28/2018
ChIP-seq analysis 2/28/2018 Acknowledgements Much of the content of this lecture is from: Furey (2012) ChIP-seq and beyond Park (2009) ChIP-seq advantages + challenges Landt et al. (2012) ChIP-seq guidelines
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationNature Genetics: doi: /ng.3556 INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE. Supplementary Figure 1
INTEGRATED SUPPLEMENTARY FIGURE TEMPLATE Supplementary Figure 1 REF6 expression in transgenic lines. (a,b) Expression of REF6 in REF6-HA ref6 and REF6ΔZnF-HA ref6 plants detected by RT qpcr (a) and immunoblot
More informationNature Genetics: doi: /ng Supplementary Figure 1. H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts.
Supplementary Figure 1 H3K27ac HiChIP enriches enhancer promoter-associated chromatin contacts. (a) Schematic of chromatin contacts captured in H3K27ac HiChIP. (b) Loop call overlap for cohesin HiChIP
More informationC2H2 zinc finger proteins greatly expand the human regulatory lexicon
Supplementary Information for: C2H2 zinc finger proteins greatly expand the human regulatory lexicon Hamed S. Najafabadi*,1, Sanie Mnaimneh*,1, Frank W. Schmitges*,1, Michael Garton 1, Kathy N. Lam 2,
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
More informationSUPPLEMENTARY INFORMATION
18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb
More informationSupplementary Information Supplementary Figures
Supplementary Information Supplementary Figures Supplementary Figure 1. Frequency of the most highly recurrent gene fusions in 333 prostate cancer patients from the TCGA. The Y-axis shows numbers of patients.
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More informationChIP-seq data analysis with Chipster. Eija Korpelainen CSC IT Center for Science, Finland
ChIP-seq data analysis with Chipster Eija Korpelainen CSC IT Center for Science, Finland chipster@csc.fi What will I learn? Short introduction to ChIP-seq Analyzing ChIP-seq data Central concepts Analysis
More informationNature Immunology: doi: /ni Supplementary Figure 1. Control experiments for Figure 1.
Supplementary Figure 1 Control experiments for Figure 1. (a) Localization of SETX in untreated or PR8ΔNS1 virus infected A549 cells (4hours). Nuclear (DAPI) and Tubulin staining are shown. SETX antibody
More informationhnrnp C promotes APP translation by competing with FMRP for APP mrna recruitment to P bodies
hnrnp C promotes APP translation by competing with for APP mrna recruitment to P bodies Eun Kyung Lee 1, Hyeon Ho Kim 1, Yuki Kuwano 1, Kotb Abdelmohsen 1, Subramanya Srikantan 1, Sarah S. Subaran 2, Marc
More informationSupplemental Figure S1
Supplemental Figure S1 A. CRPC (C4-2) 12 % Cell Survival 8 6 4 ABT 1 nm ABT 1 nm ABT nm ABT 1 um ABT 5 um ABT 2 :Docetaxel B. HT-sensitive PCa cells CRPC cells 12 12 % Cell Su urvival 8 6 4 2 LAPC4 LNCaP
More informationDual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation
Dual PI3K/ERK inhibition induces necroptotic cell death of Hodgkin Lymphoma cells through IER3 downregulation *Silvia Laura Locatelli, 1 Giuseppa Careddu, 1 Giuliano Giuseppe Stirparo, 1 Luca Castagna,
More informationChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
More informationSupporting Information
Supporting Information Ho et al. 1.173/pnas.81288816 SI Methods Sequences of shrna hairpins: Brg shrna #1: ccggcggctcaagaaggaagttgaactcgagttcaacttccttcttgacgnttttg (TRCN71383; Open Biosystems). Brg shrna
More informationNature Genetics: doi: /ng Supplementary Figure 1. High-confidence PRC2 targets and candidate PREs.
Supplementary Figure 1 High-confidence PRC2 targets and candidate PREs. (a) Flowchart for identification of candidate Arabidopsis PREs. We identified 1504 genomic regions marked by at least 3 of the following:
More informationSupplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and
Supplementary Figure Legend: Supplementary Fig. 1 Proteomic analysis of ATR-interacting proteins. ATR, ARID1A and ATRIP protein peptides identified from our mass spectrum analysis were shown. Supplementary
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind
More informationSupplementary Fig. 1. Location of top two candidemia associated SNPs in CD58 gene
Supplementary Figures Supplementary Fig. 1. Location of top two candidemia associated SNPs in CD58 gene locus. The region encompass CD58 and three long non-coding RNAs (RP4-655J12.4, RP5-1086K13.1 and
More informationComparative Genomic Hybridization
Comparative Genomic Hybridization Srikesh G. Arunajadai Division of Biostatistics University of California Berkeley PH 296 Presentation Fall 2002 December 9 th 2002 OUTLINE CGH Introduction Methodology,
More informationIntroduction to ChIP Seq data analyses. Acknowledgement: slides taken from Dr. H
Introduction to ChIP Seq data analyses Acknowledgement: slides taken from Dr. H Wu @Emory ChIP seq: Chromatin ImmunoPrecipitation it ti + sequencing Same biological motivation as ChIP chip: measure specific
More informationCufflinks Scripture Both. GENCODE/ UCSC/ RefSeq 0.18% 0.92% Scripture
Cabili_SuppFig_1 a 1.9.8.7.6.5.4.3.2.1 Partially compatible % Partially recovered RefSeq coding Fully compatible % Fully recovered RefSeq coding Cufflinks Scripture Both b 18.5% GENCODE/ UCSC/ RefSeq Cufflinks
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Schematic and results of screening the combinatorial antibody library for Sox2 replacement activity. A single batch of MEFs were plated and transduced with doxycycline inducible
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1 shrna mediated knockdown of ZRSR2 in K562 and 293T cells. (a) ZRSR2 transcript levels in stably transduced K562 cells were determined using qrt-pcr. GAPDH was
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationFigure S1. TT and MZ-CRC-1 cell viability and proliferation after Palbociclib treatment. Cell viability assays (A) and cell counting assays (B) were
Figure S1. TT and MZ-CRC-1 cell viability and proliferation after Palbociclib treatment. Cell viability assays (A) and cell counting assays (B) were performed with TT and MZ-CRC-1 cells treated with Palbociclib
More informationIntroduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Ihh interacts preferentially with its upstream neighboring gene Nhej1. Genes are indicated by gray lines, and Ihh and Nhej1 are highlighted in blue. 4C seq performed in E14.5 limbs
More informationSupplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. sndrop-seq overview.
Supplementary Figure 1 sndrop-seq overview. A. sndrop-seq method showing modifications needed to process nuclei, including bovine serum albumin (BSA) coating and droplet heating to ensure complete nuclear
More informationDIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine
DIAMANTINA INSTITUTE for Cancer, Immunology and Metabolic Medicine Defining MYB Transcriptional Network by Genome-wide Chromatin Occupancy Profiling (ChIP-Seq) 2010 E.Glazov, L. Zhao Transcription Factors:
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1. Validation of CDK9-inhibitor treatment.
Supplementary Figure 1 Validation of CDK9-inhibitor treatment. (a) Schematic of GAPDH with the middle of the amplicons indicated in base pairs. The transcription start site (TSS) and the terminal polyadenylation
More informationSupplementary Online Content
Supplementary Online Content Scher HI, Lu D, Schreiber NA, et al. Association of on circulating tumor cells as a treatment-specific biomarker with outcomes and survival in castration-resistant prostate
More informationChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015
ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
More informationNon-conserved intronic motifs in human and mouse are associated with a conserved set of functions
Non-conserved intronic motifs in human and mouse are associated with a conserved set of functions Aristotelis Tsirigos Bioinformatics & Pattern Discovery Group IBM Research Outline. Discovery of DNA motifs
More informationa previous report, Lee and colleagues showed that Oct4 and Sox2 bind to DXPas34 and Xite
SUPPLEMENTARY INFORMATION doi:1.138/nature9496 a 1 Relative RNA levels D12 female ES cells 24h Control sirna 24h sirna Oct4 5 b,4 Oct4 Xist (wt) Xist (mut) Tsix 3' (wt) Tsix 5' (wt) Beads Oct4,2 c,2 Xist
More informationSpermatazoa. Sertoli cells. Morc1 WT adult. Morc1 KO adult. Morc1 WT P14.5. Morc1 KO P14.5. Germ cells. Germ cells. Spermatids.
a. Spermatazoa Sertoli cells Morc1 WT adult c. Morc1 KO adult Morc1 WT P1.5 Morc1 KO P1.5 Morc1 WT adult Morc1 KO adult Germ cells Germ cells Spermatids Spermatozoa Supplementary Figure 1. Confirmation
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationmonoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal antibody was examined in
Supplementary information Supplementary figures Supplementary Figure 1 Determination of the s pecificity of in-house anti-rhbdd1 mouse monoclonal antibody. (a) The specificity of the anti-rhbdd1 monoclonal
More informationsupplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/146/ra80/dc1 Supplementary Materials for DNMT1 Stability Is Regulated by Proteins Coordinating Deubiquitination and Acetylation-Driven Ubiquitination Zhanwen
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: Plot shows the percentage of initially identified backsplice junctions against the Read depth value. Junctional circrna candidate have one mate
More informationENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
More informationTumor (n = 4,366) Normal (n = 364)
Tumor (n = 4,366) Normal (n = 364) PRADA: Pipeline for RNA sequencing Data Analysis Identify fusion transcripts with - at least 2 discordant read pairs (DRP) - at least 1 perfect junction spanning read
More informationComparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls
Comparative eqtl analyses within and between seven tissue types suggest mechanisms underlying cell type specificity of eqtls, Duke University Christopher D Brown, University of Pennsylvania November 9th,
More informationZhang et al., RepID facilitates replication Initiation. Supplemental Information:
Supplemental Information: a b 1 Supplementary Figure 1 (a) DNA sequence of all the oligonucleotides used in this study. Only one strand is shown. The unshaded nucleotide sequences show changes from the
More informationTITLE: Identification of Androgen Receptor-Regulated Genes in Castration-Recurrent Prostate Cancer
AD Award Number: W81XWH-11-1-0116 TITLE: Identification of Androgen Receptor-Regulated Genes in Castration-Recurrent Prostate Cancer PRINCIPAL INVESTIGATOR: Irwin H. Gelman, Ph.D. CONTRACTING ORGANIZATION:
More informationBioinformatics of Transcriptional Regulation
Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds
More informationCorrection: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis
CORRECTION Correction: The Leukemia-Associated Mllt10/ Af10-Dot1l Are Tcf4/β-Catenin Coactivators Essential for Intestinal Homeostasis Tokameh Mahmoudi, Sylvia F. Boj, Pantelis Hatzis, Vivian S. W. Li,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
More informationSUPPLEMENTARY INFORMATION
Figure S1: Activation of the ATM pathway by I-PpoI. A. HEK293T cells were either untransfected, vector transfected, transfected with an I-PpoI expression vector, or subjected to 2Gy γ-irradiation. 24 hrs
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/5/244/ra71/dc1 Supplementary Materials for The Rho Exchange Factors Vav2 and Vav3 Control a Lung Metastasis Specific Transcriptional Program in Breast Cancer Cells
More informationLecture 22 Eukaryotic Genes and Genomes III
Lecture 22 Eukaryotic Genes and Genomes III In the last three lectures we have thought a lot about analyzing a regulatory system in S. cerevisiae, namely Gal regulation that involved a hand full of genes.
More informationLecture 5: Regulation
Machine Learning in Computational Biology CSC 2431 Lecture 5: Regulation Instructor: Anna Goldenberg Central Dogma of Biology Transcription DNA RNA protein Process of producing RNA from DNA Constitutive
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationSupplemental Figure 1: Nisoldipine Concentration-Response Relationship on ipsc- CMs. Supplemental Figure 2: Exome Sequencing Prioritization Strategy
9 10 11 1 1 1 1 1 1 1 19 0 1 9 0 1 Supplementary Appendix Table of Contents Figures: Supplemental Figure 1: Nisoldipine Concentration-Response Relationship on ipsc- CMs Supplemental Figure : Exome Sequencing
More informationBioinformatics for Biologists
Bioinformatics for Biologists Microarray Data Analysis. Lecture 1. Fran Lewitter, Ph.D. Director Bioinformatics and Research Computing Whitehead Institute Outline Introduction Working with microarray data
More informationChIP-seq guidlines used by ENCODE AND modencode consortia. 2012/11/15 DJEKIDEL Mohamed Nadhir
ChIP-seq guidlines used by ENCODE AND modencode consortia 2012/11/15 DJEKIDEL Mohamed Nadhir Paper & authors ENCODE and modencode performed: >1000 ChIP-seq experiment. 140 different factors. 100 cell lines
More informationThe Role of Enhancers in Genetic and Epigenetic Control of Gene Expression
The Role of Enhancers in Genetic and Epigenetic Control of Gene Expression J. Wesley Pike Department of Biochemistry University of Wisconsin-Madison, Madison, Wisconsin Encode Users Mee?ng-2016 Stanford
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3562 In the format provided by the authors and unedited. Supplementary Figure 1 Glucose deficiency induced FH-ATF2 interaction. In b-m, immunoblotting or immunoprecipitation analyses were
More informationIntroduction to genome biology
Introduction to genome biology Lisa Stubbs Deep transcritpomes for traditional model species from ENCODE (and modencode) Deep RNA-seq and chromatin analysis on 147 human cell types, as well as tissues,
More informationSupplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated
Supplementary Figure Legends Supplementary Fig. 1. Multiple five micron sections of liver tissues of rats treated with either vehicle (left; n=3) or CCl 4 (right; n=3) were co-immunostained for NRP-1 (green)
More informationSUPPORTING INFORMATION:
SUPPORTING INFORMATION: Targeted m 6 A reader proteins to study epitranscriptomic regulation of single RNAs Simone Rauch, Chuan He,,, and Bryan C. Dickinson *, Department of Biochemistry and Molecular
More informationnature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation
nature methods A paired-end sequencing strategy to map the complex landscape of transcription initiation Ting Ni, David L Corcoran, Elizabeth A Rach, Shen Song, Eric P Spana, Yuan Gao, Uwe Ohler & Jun
More informationFlow through. lgg. 7mIPA1-GFP. ChIP-SA rep 1. Flow through. lgg. 7mIPA1-GFP. ChIP-SA rep 2. Flow through. Input. ChIP-YP rep 1.
Supplemental Data. Lu et al. Plant Cell. (213). 1.115/tpc.113.113639 Number of reads A Kd 8 lgg Flow through agfp lgg kb 2. 7mIPA1-GFP 1. B 6 Kd 8 6 Kd 8 agfp agfp lgg agfp lgg Flow through Flow through
More informationHPV E6 oncoprotein targets histone methyltransferases for modulating specific. Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu,
1 HPV E oncoprotein targets histone methyltransferases for modulating specific gene transcription 3 5 Chih-Hung Hsu, Kai-Lin Peng, Hua-Ci Jhang, Chia-Hui Lin, Shwu-Yuan Wu, Cheng-Ming Chiang, Sheng-Chung
More informationNature Methods: doi: /nmeth Supplementary Figure 1. Pilot CrY2H-seq experiments to confirm strain and plasmid functionality.
Supplementary Figure 1 Pilot CrY2H-seq experiments to confirm strain and plasmid functionality. (a) RT-PCR on HIS3 positive diploid cell lysate containing known interaction partners AT3G62420 (bzip53)
More informationSupplementary Figure 1.
Supplementary Figure 1. Quantification of western blot analysis of fibroblasts (related to Figure 1) (A-F) Quantification of western blot analysis for control and IR-Mut fibroblasts. Data are expressed
More informationSupplementary Text. eqtl mapping in the Bay x Sha recombinant population.
Supplementary Text eqtl mapping in the Bay x Sha recombinant population. Expression levels for 24,576 traits (Gene-specific Sequence Tags: GSTs, CATMA array version 2) was measured in RNA extracted from
More informationa KYSE270-CON KYSE270-Id1
a KYSE27-CON KYSE27- shcon shcon sh b Human Mouse CD31 Relative MVD 3.5 3 2.5 2 1.5 1.5 *** *** c KYSE15 KYSE27 sirna (nm) 5 1 Id2 Id2 sirna 5 1 sirna (nm) 5 1 Id2 sirna 5 1 Id2 [h] (pg per ml) d 3 2 1
More informationCharles Girardot, Furlong Lab. MACS, CisGenome, SISSRs and other peak calling algorithms: differences and practical use
Charles Girardot, Furlong Lab MACS, CisGenome, SISSRs and other peak calling algorithms: differences and practical use ChIP-Seq signal properties Only 5 ends of ChIPed fragments are sequenced Shifted read
More informationAPPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
More informationEstradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationWhy DNA Isn t Your Destiny
Technical Journal Club April 7 2015 Why DNA Isn t Your Destiny Despoina Goniotaki Aguzzi Group GENOME: a genome is an organism s complete set of DNA, including all of its genes. Each genome contains all
More informationSuppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. No. CpGs analyzed in the amplicon. Genomic location specificity
Suppl. Table S1. Characteristics of DHS regions analyzed by bisulfite sequencing. DHS/GRE Genomic location Tissue specificity DHS type CpG density (per 100 bp) No. CpGs analyzed in the amplicon CpG within
More informationBi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
More informationFig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and
Fig. S1. TPL and TPL N176H protein interactions. (A) Semi-in vivo pull-down assays using recombinant GST N-TPL and GST N-TPL N176H fusions and transgenic Arabidopsis TPL-HA lysates. Immunoblotting of input
More information797Trex megadomain(s) Per403 megadomain(s) chr1: chr1: chr12: chr12:
Table S1. Megadomains that overlap in all BRD4-NUT NMC cell lines and tissue. chromosome union region start union region end 797 megadomain(s) chr1 17197632 17247632 chr1:1721332-1724232 chr12 851264 8598264
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More information