the mirna quality control study mirqc Jo Vandesompele Pieter Mestdagh
|
|
- Jodie Howard
- 5 years ago
- Views:
Transcription
1 the mirna quality control study mirqc Jo Vandesompele Pieter Mestdagh
2 The mirqc Consortium dr. Toumy Guettouche, University of Miami Novartis AIM Objective assessment of mirna profiling platforms qpcr hybridiza?on sequencing Life Technologies Agilent Illumina Exiqon Affymetrix Life Technologies Qiagen Quanta Biosciences Exiqon Nanostring Wafergen
3 mirqc study design set of 23 samples, profiled by each participant data analysis by mirqc consortium
4 mirqc study design sample set 1 4 MAQC samples, replicate measurements MAQC A : 100 % Universal Reference RNA MAQC B : 100 % Human Brain RNA MAQC C : 75 % MAQC A + 25 % MAQC B MAQC D : 25 % MAQC A + 75 % MAQC B titration response reproducibility 120" 100" 80" 60" 40" 20" 0" A" C" D" B" C/A = B/A D/A = B/A expression" 6" 5" 4" 3" 2" 1" 0" 0" 1" 2" 3" 4" 5" 6" expression"
5 mirqc study design sample set 2 MAQC B + gdna, replicate measurements mirqc study design sample set 3 synthetic mirnas spiked in RNA samples let-7 family hsa-let-7a: UGAGGUAGUAGGUUGUAUAGUU hsa-let-7b: UGAGGUAGUAGGUUGUGUGGUU hsa-let-7c: UGAGGUAGUAGGUUGUAUGGUU hsa-let-7d: AGAGGUAGUAGGUUGCAUAGUU mir-302 family hsa-mir-302a: UAAGUGCUUCCAUGUUUUGGUGA hsa-mir-302b: UAAGUGCUUCCAUGUUUUAGUAG hsa-mir-302c: UAAGUGCUUCCAUGUUUCAGUGG hsa-mir-302d: UAAGUGCUUCCAUGUUUGAGUGU
6 mirqc study design sample set 4 MS2 phage RNA, replicate measurements mirqc study design sample set 5 RNA from human serum, replicate measurements spiked with synthetic mirnas at low but varying concentrations sample 1 sample 2 mirna concentra?on mirna concentra?on mir- 10a 1 mir- 10a 5 let- 7a 1 let- 7a 2 mir- 302a 1 mir- 302a 0.5 mir- 133a 1 mir- 133a 0.2
7 sample set 1 - reproducibility A expression ( log 2 ) expression ( log 2 ) expression ( log 2 ) cumulative fraction (%) cumulative fraction (%) C 6 A replicate 14 expression expression difference ( log ( log 2 ) ) expression ( expression log 2 ) ( log 2 ) cumulative fraction cumulative (%) fraction (%) B expression ( log 2 ) replicate expression expression difference ( log( 2 log ) 2 ) B frequency frequency B frequency frequency B expression ( log 2 ) 0 expression ( log 2 )
8 sample set 1 Titra?on Response (4) (18) (47) (76) (18) (5) (10) (9) 0.8 titrating mirnas (%) titrating mirnas (%) (8) (14) (52) (78) (26) (18) (19) (37) binned difference ( log 2 ) MAQC A MAQC B binned difference ( log 2 ) MAQC A MAQC B
9 sample set 1 Titra?on Response MAD expect = median( y measured -y expect )/0.675 MAD fit = median( y measured -y fit )/ D/A = B/A MADexpect = MADfit = D/A 10 D/A B/A B/A
10 sample set 1 Titra?on Response D/A = B/A MADexpect = MADfit = D/A 10 D/A B/A B/A
11 sample set 3 - Specificity Table 1: mir-302 spike-in experiment mir-302a-3p mir-302b-3p mir-302c-3p mir-302d-3p mir-302a-3p mir-302b-3p mir-302c-3p mir-302d-3p Table 1: mir-302 spike-in experiment mir-302a-3p mir-302b-3p mir-302c-3p mir-302d-3p mir-302a-3p mir-302b-3p mir-302c-3p mir-302d-3p
12 sample set 3 - Specificity Table 2: let-7 spike-in experiment let-7a-5p let-7b-5p let-7c let-7d-5p let-7a-5p let-7b-5p let-7c let-7d-5p let-7e-5p let-7f-5p let-7g-5p let-7i-5p Table 2: let-7 spike-in experiment let-7a-5p let-7b-5p let-7c let-7d-5p let-7a-5p let-7b-5p let-7c let-7d-5p let-7e-5p let-7f-5p let-7g-5p let-7i-5p
13 sample set 5 Sensi?vity Serum samples low mirna content mirna detection rate in serum ~ measure sensitivity #"detected"mirnas" 120" 100" 80" 60" 40" 20" 0" 1" 2" 3" 4" 5" 6" 7" 8" 9"
14 low- copy template detec?on in serum relative expression (log2) relative expression (log2) mir 10a 5p let 7a 5p mir 302a 3p mir 133a mir 10a 5p let 7a 5p mir 302a 3p mir 133a
15 General Conclusions qpcr: sensitivity hybridization: reproducibility sequencing: content (isomirs) Manuscript in preparation (submitted early 2013)
16 courtesy of Gary Schroth, Illumina Expression level mature micro, mir*, and iso-forms Five different human tissue samples Hairpin sequence and loop structure hsa-mir-26b (-40.10) CCGGGACCCAGTTCAAGTAATTCAGGATAGGTTGTGTGCTGTCCAGCCTGTTCTCCATTACTTGGCTCGGGGACCGG ((((..((((((.((((((((..(((((((((((.(..()..))))))))))))..))))))))))).)))..)))) TTCAAGTAATTCAGGATAGGT TTCAAGTAATTCAGGATAGGTT TTCAAGTAATTCAGGATAG TTCAAGTAATTCAGGAT TTCAAGTAATTCAGGATA TTCAAGTAATTCAGGA TTCAAGTAATTCAGGATAGGTTG TTCAAGTAATTCAGGATAGGTTGT TTCAAGTAATTCAGGATAGG TCAAGTAATTCAGGATAGG TCAAGTAATTCAGGATAGGT TCAAGTAATTCAGGATAGGTT CAAGTAATTCAGGATAGG CAAGTAATTCAGGATAGGTT AAGTAATTCAGGATAGGTT AAGTAATTCAGGATAGG AGTAATTCAGGATAGGTT TAATTCAGGATAGGTT GTGTGCTGTCCAGCCTGTTC CCTGTTCTCCATTACTTGGC CCTGTTCTCCATTACTTGG CCTGTTCTCCATTACTTGGCTC CCTGTTCTCCATTACTTGGCT Mature mir*
17 courtesy of Gary Schroth, Illumina Isoform with higher expression level than mature micro mature forms based on mirbase V17 hsa-mir-30a (-37.30) GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAGATGGGCTTTCAGTCGGATGTTTGCAGCTGC (((.((((((((((((..((((((((((((((.().)))...))))))))))))))))))))))).))) -----TGTAAACATCCTCGACTGGAAG TGTAAACATCCTCGACTGGA TGTAAACATCCTCGACTGGAAGC TGTAAACATCCTCGACTGGAAGCT TGTAAACATCCTCGACTGGAA REST_OF_THE_ISOFORMS Total Counts 253, ,235 1,079, , ,750
18 RNA sequencing Option 1: Poly-A, non-directional Option 2: Ribo-depletion, directional
19 courtesy of Gary Schroth, Illumina
20 courtesy of Gary Schroth, Illumina
A robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution
A robust and sensitive microarray system for profiling of mirnas Life Sciences - Genomics Stephanie Fulmer-Smentek RNA Applications R&D Group Manager Overview microrna biology Agilent mirna platform -
More informationBenchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
More informationTaqMan Advanced mirna Assays
PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive
More informationTaqMan Advanced mirna Assays
PRODUCT BULLETIN Key features Universal reverse transcription (RT) one RT step for all TaqMan Advanced mirna Assays Sensitive detect as few as 60 copies of input microrna (mirna) Specific detect only mature
More informationInsights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays
Slide 1 of 38 Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays Jan Hellemans, PhD CEO Biogazelle qpcr & NGS 2013 Freising, Germany March 19, 2013 Biogazelle
More informationRNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
More informationBetter appreciation of true biological mirna expression differences using an improved version of the global mean normalization strategy
Better appreciation of true biological mirna expression differences using an improved version of the global mean normalization strategy Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle
More informationFirePlex mirna Assay. Multiplex microrna profiling from low sample inputs
FirePlex mirna Assay Multiplex microrna profiling from low sample inputs Abstract We introduce a new assay for multiplex microrna (mirna) discovery and verification that enables simultaneous profiling
More informationQuality quantification with qpcr Two-tailed PCR for ultrasensitive detection of micrornas
Quality quantification with qpcr Two-tailed PCR for ultrasensitive detection of micrornas Analytical and preanalytical errors are expensive! European proficiency ring trials Blood DNA & RNA, Blood/Plasm
More informationSupplementary figure 1:
Depletion of trna-halves enables effective small RNA sequencing of lowinput murine serum samples Alan Van Goethem, Nurten Yigit, Celine Everaert, Myrthala Moreno-Smith, Liselot M. Mus, Eveline Barbieri,
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationTechnical Note. GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison. Introduction:
Technical Note GeneChip 3 IVT PLUS Reagent Kit vs. GeneChip 3 IVT Express Reagent Kit Comparison Introduction: Affymetrix has launched a new 3 IVT PLUS Reagent Kit which creates hybridization ready target
More informationEvaluation of extraction kits and RT-qPCR systems adapted to high-throughput platform for
Evaluation of extraction kits and RT-qPCR systems adapted to high-throughput platform for circulating mirnas. Geok Wee Tan, Alan Soo Beng Khoo, Lu Ping Tan Supplementary Table S1. ICC (two-way mixed model
More informationQPCR ASSAYS FOR MIRNA EXPRESSION PROFILING
TECH NOTE 4320 Forest Park Ave Suite 303 Saint Louis, MO 63108 +1 (314) 833-9764 mirna qpcr ASSAYS - powered by NAWGEN Our mirna qpcr Assays were developed by mirna experts at Nawgen to improve upon previously
More informationQIAseq mirna Library Kit The next-generation in mirna sequencing products
QIAseq mirna Library Kit The next-generation in mirna sequencing products What challenges are there with mirna Sequencing? Sample input is one of many challenges facing mirna sequencing reactions. Kits
More informationIdentification of cytokine-induced modulation of microrna expression and secretion as measured by a novel microrna specific qpcr assay
Supplementary Figure Legends Supplementary Figure 1: Detection, analysis and comparison of mirnas expression in mouse liver and heart by using miqpcr and TaqMan mirna assays. A) Microarray analysis of
More informationHuman mirna controls * * Lim 2003 Berezikov Mouse mirna controls. Not sequenced. Not enough reads. Berezikov 2006b. Xie 2005
Chiang135681_FigureS3 hsa-mir-124-1 hsa-mir-125a hsa-mir-128-1 hsa-mir-142 hsa-mir-150 hsa-mir-192 hsa-mir-205 hsa-mir-214 hsa-mir-455 hsa-mir-483 hsa-mir-499 hsa-mir-888 hsa-mir-9-1 hsa-mir-220a cand141
More informationGene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
More informationJo Vandesompele, PhD Biogazelle, CEO Ghent University, professor
Dissecting microrna function through integrative genomics SysKid workshops, annual meeting and symposium January 26, 2011 Jo Vandesompele, PhD Biogazelle, CEO Ghent University, professor Biogazelle a real-time
More informationncounter Analysis System Digital Technology for Pathway-based Translational Research Molecules That Count NanoString Technologies
NanoString Technologies ncounter Analysis System Digital Technology for Pathway-based Translational Research Molecules That Count Gene Expression mirna Expression Epigenomics Copy Number Variation NanoString
More informationOvercome ligation-induced bias and skewed mirna representation in microrna-seq
Home Learning centers Next-generation sequencing Technical notes Accurate mirna representation in microrna-seq TECH NOTE Overcome ligation-induced bias and skewed mirna representation in microrna-seq SMARTer
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationmirna Profiling: On the Road to Biomarker Development
Isolation Quantification Functionalization mirna Profiling: On the Road to Biomarker Development Eric Lader, Ph.D. Senior Director, R&D eric.lader@qiagen.com - 1 - Welcome to the three-part webinar series
More informationChapter 10. Whole-Genome RT-qPCR MicroRNA Expression Profiling. Pieter Mestdagh, Stefaan Derveaux, and Jo Vandesompele. Abstract. 1.
Chapter 10 Whole-Genome RT-qPCR MicroRNA Expression Profiling Pieter Mestdagh, Stefaan Derveaux, and Jo Vandesompele Abstract MicroRNAs (mirnas) are small noncoding RNA molecules that function as negative
More informationMICRORNA RESEARCH TOOLS, DIAGNOSTICS AND THERAPEUTICS: GLOBAL MARKETS
MICRORNA RESEARCH TOOLS, DIAGNOSTICS AND THERAPEUTICS: GLOBAL MARKETS BIO115A November 2012 Marianna Tcherpakov Project Analyst ISBN: 0-89336-224-7 BCC Research 49 Walnut Park, Building 2 Wellesley, MA
More informationAPPLICATION NOTE. MagMAX mirvana Total RNA Isolation Kit TaqMan Advanced mirna Assays
APPLICATION NOTE MagMAX mirvana Total RNA Isolation Kit TaqMan Advanced mirna Assays A complete workflow for high-throughput isolation of serum mirnas and downstream analysis by qrt-pcr: application for
More informationSuccessful gene expression studies using validated qpcr assays. Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015
Successful gene expression studies using validated qpcr assays Jan Hellemans, CEO Biogazelle webinar October 28 th, 2015 Agenda Requirements for high quality qpcr assays Approaches for qpcr assay validation
More informationA comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control Consortium
A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control Consortium SEQC/MAQC-III Consortium* 214 Nature America, Inc. All rights reserved.
More informationDevelopment of quantitative targeted RNA-seq methodology for use in differential gene expression
Development of quantitative targeted RNA-seq methodology for use in differential gene expression Dr. Jens Winter, Market Development Group Biological Biological Research Content EMEA QIAGEN Universal Workflows
More informationBest Practice for RNA-seq Analysis
MAQC2017 Conference Program Reproducible Genomics Best Practice for RNA-seq Analysis Boku University Paweł Łabaj, David Kreil Fudan University Ying Yu, Chen Suo, Luyao Ren, Yuanting Zheng, Leming Shi April
More informationMicroRNA sequencing (mirnaseq)
, Robust experimental design Data analysis using the CAP-miRSeq: A comprehensive analysis pipeline for deep microrna sequencing E. Starr Hazard Over view of this first lecture 1) Review of very basic mirna
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationTranscriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
More informationGene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays
Gene Expression Profiling and Validation Using Agilent SurePrint G3 Gene Expression Arrays Application Note Authors Bahram Arezi, Nilanjan Guha and Anne Bergstrom Lucas Agilent Technologies Inc. Santa
More informationDevelopment of PrimePCR Assays and Arrays for lncrna Expression Analysis
Development of PrimePCR Assays and Arrays for lncrna Expression Analysis Jan Hellemans, 1 Pieter Mestdagh, 1 James Flynn, 2 and Joshua Fenrich 2 1 Biogazelle NV, Technologiepark 3, B-952, Zwijnaarde, Belgium.
More informationExploring of microrna markers for body fluid identification using NGS
Exploring of microrna markers for body fluid identification using NGS Zheng Wang, Yiping Hou Institute of Forensic Medicine Sichuan University, China Barcelona May, 11, 2016 Outline Introduction of Institute
More informationMicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology
Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables
More informationAgilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements
Agilent s Microarray Platform: How High-Fidelity DNA Synthesis Maximizes the Dynamic Range of Gene Expression Measurements Author Emily LeProust, Ph.D. Agilent Technologies A key factor controlling the
More informationSUPPLEMENTARY INFORMATION FILE
SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY
More informationPOLYMERASE CHAIN REACTION (PCR) TECHNOLOGIES AND GLOBAL MARKETS
POLYMERASE CHAIN REACTION (PCR) TECHNOLOGIES AND GLOBAL MARKETS BIO087B March 2014 Jackson Highsmith Project Analyst ISBN: 1-56965-742-4 BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 USA
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive quantification of mature micrornas by real-time PCR based on ligation of ribonucleotide-modified DNA probe Jiangyan Zhang, Zhengping Li,* Hui Wang, Yucong
More informationABRF 2018 Annual Meeting
ABRF 2018 Annual Meeting Genomics Track Research Group & Platinum Level Vendor Presentations Stuart Levine, Massachusetts Institute of Technology Justin J. Lemke, Promega Life Sciences John M. Ashton,
More informationComparative Analysis using the Illumina DASL assay with FFPE tissue. Wendell Jones, PhD Vice President, Statistics and Bioinformatics
TM Comparative Analysis using the Illumina DASL assay with FFPE tissue Wendell Jones, PhD Vice President, Statistics and Bioinformatics Background EA has examined several protocol assay possibilities for
More informationPitfalls and recommendations for microrna expression analysis using qpcr
Pitfalls and recommendations for microrna expression analysis using qpcr Guidelines to microrna qpcr with examples from the mircury LNA Universal RT microrna PCR system Introduction Over the last few years,
More informationTop 5 Lessons Learned From MAQC III/SEQC
Top 5 Lessons Learned From MAQC III/SEQC Weida Tong, Ph.D Division of Bioinformatics and Biostatistics, NCTR/FDA Weida.tong@fda.hhs.gov; 870 543 7142 1 MicroArray Quality Control (MAQC) An FDA led community
More informationAlain Sewer 1*, Sylvain Gubian 1, Ulrike Kogel 2, Emilija Veljkovic 1, Wanjiang Han 1, Arnd Hengstermann 2, Manuel C Peitsch 1 and Julia Hoeng 1
Sewer et al. BMC Research Notes 214, 7:32 RESEARCH ARTICLE Open Access Assessment of a novel multi-array normalization method based on spike-in control probes suitable for microrna datasets with global
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationGuide for ordering of mircury LNA probes and LNA oligonucleotides
1 Guide for ordering of mircury LNA probes and LNA oligonucleotides microrna mrna Other Detection, p.2-3 in situ hybridization, p.6-7 Other application, p.8-9 Kckdown (in vitro), p.4-5 Other mrna application,
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Linear-Hairpin Variable Primer RT-qPCR for MicroRNA
More informationIBBL BIOSERVICES SAMPLE ANALYSIS & QUALITY CONTROL
IBBL BIOSERVICES SAMPLE ANALYSIS & QUALITY CONTROL WHO ARE WE? IBBL is an autonomous not-for-profit institute dedicated to service provision in the biomedical sector. As an ISO 9001 (general quality management)
More informationTECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298
DIAGNOSTICS BUSINESS ANALYSIS SERIES: TECHNOLOGIES, PRODUCTS & SERVICES for MOLECULAR DIAGNOSTICS, MDx ABA 298 By ADAMS BUSINESS ASSOCIATES March 2017. March 2017 ABA 298 1 Technologies, Products & Services
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationParts of a standard FastQC report
FastQC FastQC, written by Simon Andrews of Babraham Bioinformatics, is a very popular tool used to provide an overview of basic quality control metrics for raw next generation sequencing data. There are
More informationOutline. Analysis of Microarray Data. Most important design question. General experimental issues
Outline Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization Introduction to microarrays Experimental design Data normalization Other data transformation Exercises George Bell,
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Distribution of mirnas between lncrna and protein-coding genes. Pie chart showing distribution of human mirna between protein coding and lncrna genes. To the right, lncrna mirna
More informationSUPPLEMENTARY INFORMATION
Phage-mediated counting by the naked eye of mirna molecules at attomolar concentrations in a Petri dish Supplementary Figure 1-24 Supplementary Table 1 1 NATURE MATERIALS www.nature.com/naturematerials
More informationReduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results
Reduce microrna RT-qPCR Assay Costs by More Than 10-fold Without Compromising Results Authors: Marianna Goldrick 1, Peter Kamp Busk 2, Lance Lepovitz 1 2. Aalborg University, Copenhagen, A.C. Meyers Vænge
More informationHairpin-it TM mirnas qpcr Quantitation Kit
Hairpin-it TM mirnas qpcr Quantitation Kit For the detection and quantification of micrornas using real-time PCR detection instruments. Catalog No. QPM-010/ QPM-011/ QPM-012/ QPM-013 User Manual Table
More informationAlmac Diagnostics. NGS Panels: From Patient Selection to CDx. Dr Katarina Wikstrom Head of US Operations Almac Diagnostics
Almac Diagnostics NGS Panels: From Patient Selection to CDx Dr Katarina Wikstrom Head of US Operations Almac Diagnostics Overview Almac Diagnostics Overview Benefits and Challenges of NGS Panels for Subject
More informationJoint RuminOmics/Rumen Microbial Genomics Network Workshop
Joint RuminOmics/Rumen Microbial Genomics Network Workshop Microbiome analysis - Amplicon sequencing Dr. Sinéad Waters Animal and Bioscience Research Department, Teagasc Grange, Ireland Prof. Leluo Guan
More informationSupplemental Figure 1. Study flow chart.
Supplemental Figure 1. Study flow chart. 1 Supplemental Figure 2. Histograms represent fold changes of mir-22 in HL-1 cells. Vehicle-treated (gray) or sildenafil-treated (black b) cells. Results are expressed
More informationNCode mirna profiling. Sensitive, reproducible mirna profiling
Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior
More informationOvercome limitations with RNA-Seq
Buyer s Guide Simple, customized RNA-Seq workflows Evaluating options for next-generation RNA sequencing Overcome limitations with RNA-Seq Next-generation sequencing (NGS) has revolutionized the study
More informationmmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
More informationLab methods: Exome / Genome. Ewart de Bruijn
Lab methods: Exome / Genome 27 06 2013 Ewart de Bruijn Library prep is only a small part of the complete DNA analysis workflow DNA isolation library prep enrichment flowchip prep sequencing bioinformatics
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationEstablishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor
Establishment and verification of mirnas expression molecules for breast cancer and its distant metastasis Yanhong Gao Associate Professor Department of Clinical Biochemistry Chinese PLA General Hospital
More informationMore than Meets the Eye. Next Generation RNA Extraction
More than Meets the Eye. Next Generation RNA Extraction Discover the World of RNA There are solutions for every scientist s problems, no matter what the application is. provides kits for a variety of biological
More informationLow input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time
TECHNICAL NOTE Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time INTRODUCTION RNA-seq is a next-generation sequencing technique that
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 1: Experimental Design and Data Normalization George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Introduction
More informationUtility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides
Utility of Branched DNA Hybridization Methodology for the Quantitation of Oligonucleotides Laboratory Sciences, MPI Research, A Charles River Company Amy Smith, BA, Senior Director, Bioanalytical/Analytical
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More informationALLEN Human Brain Atlas
TECHNICAL WHITE PAPER: MICROARRAY PLATFORM SELECTION FOR THE ALLEN HUMAN BRAIN ATLAS INTRODUCTION This document describes the process and rationale by which the Allen Institute for Brain Science selected
More informationIntegrative Genomics 1a. Introduction
2016 Course Outline Integrative Genomics 1a. Introduction ggibson.gt@gmail.com http://www.cig.gatech.edu 1a. Experimental Design and Hypothesis Testing (GG) 1b. Normalization (GG) 2a. RNASeq (MI) 2b. Clustering
More informationID3EAL Spike-in RNA Kit. Principle, Workflow and Protocol
ID3EAL Spike-in RNA Kit Principle, Workflow and Protocol Table of Contents Content Page Working Principle 3 Kit Contents & Storage 4 Additional Equipment and Compatibility 5 Additional Equipment and Compatibility
More informationSupporting Information
Supporting Information Schnall-Levin et al. 10.1073/pnas.1006172107 SI Text Cell Transfections. S2R þ cells were maintained in Schneider s medium (Invitrogen), supplemented with 10% FBS and 1% pen-strep.
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationSupplementary Information for Single-cell sequencing of the small-rna transcriptome
Supplementary Information for Single-cell sequencing of the small-rna transcriptome Omid R. Faridani 1,6,*, Ilgar Abdullayev 1,2,6, Michael Hagemann-Jensen 1,3, John P. Schell 4, Fredrik Lanner 4,5 and
More informationMultiplexed detection of micrornas by a competitive DNA. microarray-based resonance light scattering assay
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information for: Multiplexed detection of micrornas by a competitive DNA
More informationTowards a framework for transcriptomics and other Big Data analysis for regulatory application
Towards a framework for transcriptomics and other Big Data analysis for regulatory application Timothy W Gant Wenjun Bao; Remi Bars; Mohamed Benahmed; Alan Boobis; Timothy Ebbels, Karma Fussell, Lili Li;
More informationqrt-pcr efficiency & overall reaction performance
mrna & microrna integrity - the key to success Michael W. Pfaffl Christiane Becker, Andrea Hammerle-Fickinger & Irmgard Riedmaier Michael W. Pfaffl Physiology Weihenstephan Technical University of Munich
More informationBest Practices for Clinical Research Biomarker Studies Using the ncounter Platform:
W H I T E PA P E R Best Practices for Clinical Research Biomarker Studies Using the ncounter Platform: Strategies to Control for Variability MK0455 Dec 2017 NanoString Technologies, Inc., Seattle, WA 98109
More informationMICRORNA RESEARCH TOOLS, DIAGNOSTICS AND THERAPEUTICS: GLOBAL MARKETS
MICRORNA RESEARCH TOOLS, DIAGNOSTICS AND THERAPEUTICS: GLOBAL MARKETS BIO115B September 2014 Natana Raj Project Analyst ISBN: 1-56965-928-1 BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 USA
More informationLecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
More informationSupplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
More informationAutomated Electrophoresis Applications for Synthetic Biology
Automated Electrophoresis Applications for Synthetic Biology Melissa Huang Liu, Ph.D. Product Manager, Electrophoresis Agilent Technologies 1 Outline 2100 Bioanalyzer & 4200 TapeStation Systems Automated
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationCanadian Bioinforma2cs Workshops
Canadian Bioinforma2cs Workshops www.bioinforma2cs.ca Module #: Title of Module 2 1 Introduction to Microarrays & R Paul Boutros Morning Overview 09:00-11:00 Microarray Background Microarray Pre- Processing
More informationMapping and quantifying mammalian transcriptomes by RNA-Seq. Ali Mortazavi, Brian A Williams, Kenneth McCue, Lorian Schaeffer & Barbara Wold
Mapping and quantifying mammalian transcriptomes by RNA-Seq Ali Mortazavi, Brian A Williams, Kenneth McCue, Lorian Schaeffer & Barbara Wold Supplementary figures and text: Supplementary Figure 1 RNA shatter
More informationGuidelines for setting up microrna profiling experiments v2.0
Guidelines for setting up microrna profiling experiments v2.0 December 2010 Table of contents 2 Experimental setup................................................ 3 Single-color experiments........................................
More informationTech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
More informationAssay Standards Working Group Nov 2012 Assay Standards Working Group Recommendations, November 2012
Assay Standards Working Group Recommendations, November 2012 Contents Assay Standards Working Group Recommendations, August 2012... 1 Contents... 1 Introduction... 2 1: Reference Epigenome Criteria...
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More information