Guide for ordering of mircury LNA probes and LNA oligonucleotides

Size: px
Start display at page:

Download "Guide for ordering of mircury LNA probes and LNA oligonucleotides"

Transcription

1 1 Guide for ordering of mircury LNA probes and LNA oligonucleotides microrna mrna Other Detection, p.2-3 in situ hybridization, p.6-7 Other application, p.8-9 Kckdown (in vitro), p.4-5 Other mrna application, p.8-9 Other RNA target, p.8-9 Kckdown (in vivo), p.8-9 Other microrna application, p.8-9

2 mircury LNA Detection probes for microrna detection by ISH or Northern 2 Order XX mircury LNA Detection probe, 250 pmol for any microrna antated in Sanger mirbase. Select probe specific product # from Exiqon website Northern blot probes = in situ hybridization probes Pre-designed microrna probes full length based on mirbase Product number Product description XXXXXX-00 mircury LNA Detection probe, 250 pmol, ready to label U XXXXXX-01 mircury LNA Detection probe, 250 pmol, 5'-DIG labeled U XXXXXX-02 mircury LNA Detection probe, 250 pmol, 5'-ami labeled U XXXXXX-03 mircury LNA Detection probe, 250 pmol, 5'-biotin labeled U XXXXXX-04 mircury LNA Detection probe, 250 pmol, 5'-fluorescein labeled U XXXXXX-05 mircury LNA Detection probe, 250 pmol, 3'-DIG labeled U XXXXXX-06 mircury LNA Detection probe, 250 pmol, 3'-ami labeled U XXXXXX-07 mircury LNA Detection probe, 250 pmol, 3'-biotin labeled U XXXXXX-08 mircury LNA Detection probe, 250 pmol, 3'-fluorescein labeled U Positive/Negative controls Product No Product Name Product Description Sense mir-159 Control, mircury detection probe, 250 pmol, ready to label Scramble-miR Control, mircury detection probe, 250 pmol, ready to label U6, hsa/mmu/r Control, mircury detection probe, 250 pmol, ready to label Also available: custom designed microrna probes: If probe is t found or customer has special requests see next page for explanation to Exiqon custom probe products and which information to provide

3 Probe options for microrna detection by ISH or Northern 3 Probe for a microrna anted in Sanger mirbase or mirplus Standard Exiqon LNA detection probe (full length, different labels see p.2) Order from webshop: XX mircury LNA TM Detection probe, 250 pmol Need ather label If ather label is requested, request will be handled as custom order: Please send the following to tech support : - microrna name (e.g. dre-mir-16) as found in webshop Tech support will send ref# for order and confirm Exiqon list price Pricing and product specification follows custom mircury LNA TM Detection probe, 250 pmol + price of label Product will appear as a # Transfer price is to be calculated accordingly cf. contract Want standard detection probe designed by Exiqon (meaning: full lenght probe, customer has reservations) Need ather label Please send the following to tech support for probe design: - complete TARGET sequence (please specify) Tech support will make optimal LNA probe, send ref# for order Pricing and product specification follows: XX custom mircury LNA TM Detection probe, 250 pmol Please, clearly state that you send TARGET sequence, but for ather small RNA, e.g snrna, but with a mutation/mismatch/sense want standard detection probe designed by Exiqon (meaning: full lenght probe, customer has reservations) Please send the customer s probe design to tech support for approval as follows: - PROBE sequence - LNA spiking pattern (required) * - synthesis scale (200 or 1000 nmol, yield sent to customer is at least 10%)* - application if relevant Tech support will approve possibility of synthesis for customers design, send ref# and Exiqon list pricing information (incl. HPLC fee) for order. Distributor discount according to contract. *FOR MORE DETAILS on #500150, see p. 9 This request falls between two products (99999-XX and XX). Please send the following to tech support for probe design: - TARGET sequence (all of it) - name of RNA/desired probe name - animal model Tech support will make optimal LNA probe, inform what product type is available for request and send ref# for order. Design tips: 3 mirnas are expected to be nt. This is the optimal size for an LNA probe. Hence, all custom detection probes are designed as full length. 1. For microrna, we request to send us complete TARGET sequence. The more sequence, the better. This gives flexibility for design of the most optimal probe. 2. Most optimal use of LNA is obtained for probes at the length of nt. Probe sequences shorter than this are t recommended. For LNA probes longer than 30 nt, the Tm becomes too high or the effect of LNA will be diluted. 3. When possible we suggest to always supply TARGET sequence. In some cases it may be necessary to send PROBE sequence, e.g. if customer has a suggested mismatach probe. Please send the following to tech support for probe design: - PROBE or complete TARGET sequence (please specify) Tech support will make optimal LNA probe, send ref# for order Pricing and product specification follows: XX custom mircury LNA TM Detection probe, 250 pmol Please, clearly state whether you send TARGET or PROBE sequence

4 4 mircury LNA Kckdown probes for direct microrna inhibion Order XX mircury LNA Kckdown probe, 5 nmol for any microrna antated in Sanger mirbase. Select probe specific product # from Exiqon website Pre-designed micorna probes based on mirbase Product number Product description 1XXXXX-00 mircury LNA kckdown probe, 5 nmol, ready to label 1XXXXX-02 mircury LNA kckdown probe, 5 nmol, 5'-ami labeled 1XXXXX-04 mircury LNA kckdown probe, 5 nmol, 5'-fluorescein labeled 1XXXXX-06 mircury LNA Detection probe, 5 nmol, 3'-ami labeled 1XXXXX-08 mircury LNA Detection probe, 5 nmol, 3'-fluorescein labeled Positive/Negative controls Product No Product Name Product Description Sense mir-159 Control, mircury kckdown probe, 5 nmol, ready to label Scramble-miR Control, mircury kckdown probe, 5 nmol, ready to label Also available: custom designed microrna probes: If probe is t found or customer has special requests see next page for explanation to Exiqon custom probe products and which information to provide:

5 Probe options for microrna kckdown 5 Probe for a microrna anted in Sanger mirbase or mirplus Standard Exiqon LNA kckdown probe (different labels see p. 4) Order from webshop: XX mircury LNA TM Detection probe, 5 nmol Need ather label If ather label is requested, request will be handled as custom order: Please send the following to tech support : - microrna name (e.g. dre-mir-16) as found in webshop Tech support will send ref# for order and confirm Exiqon list price Pricing and product specification follows custom mircury LNA TM Kckdown probe, 5 nmol + price of label Product will appear as a # Transfer price is to be calculated accordingly cf. contract Want standard kckdown probe designed by Exiqon (meaning: customer has reservations) Need ather label Please send the following to tech support for probe design: - complete TARGET sequence (please specify) Tech support will make optimal LNA probe, send ref# for order Pricing and product specification follows: XX custom mircury LNA TM Kckdown probe, 5 nmol Please, clearly state that you send TARGET sequence, but for ather small RNA, e.g snrna, but with a mutation/mismatch/sense want standard kckdown probe designed by Exiqon (meaning:customer has reservations) Please send the customer s probe design to tech support for approval as follows: - PROBE sequence - LNA spiking pattern (required) - synthesis scale (200 or 1000 nmol, yield sent to customer is at least 10%)* - application if relevant Tech support will approve possibility of synthesis for customers design, send ref# and Exiqon end-user pricing information (incl. HPLC fee) for order. Distributor discount according to contract. Pricing and product specification follows: custom LNA oligonucleotides FOR MORE DETAILS see also p. 9 This request falls between two products ( XX and ) Please send the following to tech support for probe design: - TARGET sequence (all of it) - name of RNA/desired probe name - animal model Tech support will make optimal LNA probe, inform what product type is available for request and send ref# for order. Design tips (see also p. 9): mirnas are expected to be nt. This is the optimal size for an LNA probe. The most optimal design for a kckdown probe may t full length, but if Exiqon is to design: 1. For microrna (and other RNA), we request to send us complete TARGET sequence. The more sequence, the better. This gives flexibility for design of the most optimal probe. 2. Most optimal use of LNA is obtained for probes at the length of nt. Probe sequences shorter than this are t recommended. For LNA probes longer than 30 nt, the Tm becomes too high or the effect of LNA will be diluted. 3. When possible we suggest to always supply TARGET sequence. In some cases it may be necessary to send PROBE sequence, e.g. if customer has a suggested mismatach probe. Please send the following to tech support for probe design: - PROBE or complete TARGET sequence (please specify) Tech support will make optimal LNA probe, send ref# for order Pricing and product specification follows: XX custom mircury LNA TM Kckdown, 5 nmol Please, clearly state whether you send TARGET or PROBE sequence

6 mrna probe for in situ hybridization 6 Order XX mrna in situ probe, 5 nmol for custom designed probes for detection by ISH for any mrna target Standard product offering See next page for detailed explanation on how to order. Exiqon uses in-house software tools to design detection probe with optimal LNA spiking pattern. Product number Product name Product description Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, ready to label Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 5'-DIG labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 5'-ami labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 5'-biotin labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 5'-fluorescein labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 3'-DIG labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 3'-ami labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 3'-biotin labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 3'-fluorescein labeled Named by Customer LNA mrna in-situ hybridisation probe; 5 nmol, 5'-DIG and 3'-DIG labeled Positive/negative controls (standard label offering as above) Product number Product name Product description Scramble-ISH Control, LNA mrna in situ hybridisation probe, 5 nmol, ready to label PolyT(25)Vn Control, LNA mrna in situ hybridisation probe, 5 nmol, ready to label beta-actin, mmu/r Control, LNA mrna in situ hybridisation probe, 5 nmol, ready to label beta-actin, hsa Control, LNA mrna in situ hybridisation probe, 5 nmol, ready to label Also available (customer s own design or other label option): If desired probe:label combination is t found or customer has custom requests see next page for explanation to Exiqon custom mrna probe products and which information to provide:

7 mrna probe for in situ hybridization How to order Exiqon designed probe ( XX) or customers own design (500150) Customer wants Exiqon to design mrna probe for in situ hybridization 7 No, use own design or different application STANDARD CUSTOM PROBE EXIQON DESIGNS: XX mrna in-situ hybridization probe, 5 nmol (label options see p.6) Please send the following to tech support for probe design: - TARGET sequence (as much as possible t a reference or database. of actual nt sequence is required to avoid misunderstandings) - Organism (we BLAST the probe for potential risk of cross-hybridization) - Preferred label - Application Tech support will design optimal mrna probe (19-25 nt) with respect to LNA probe design criteria (see * below) and BLAST the probe against NCBI gene database. When probe is designed ref# will be sent to distributor for ordering. Pricing and product specification follows: XX mrna in-situ hybridization probe. LNA spiking pattern is t provided. Clearly confirm that TARGET sequence is forwarded CUSTOM CUSTOM PROBE Customer designs or customer has specific requirements: LNA TM Oligonucleotide (for a microrna target) Please send the following to tech support for probe design: - PROBE sequence with LNA spiking pattern, LNA shown as catipal letters, e.g. atgcatgca - synthesis scale (200 nmol or 1000 nmol yield sent to customer is at least 10%) - application (if relevant) Confirm that PROBE sequence is fowarded. (Probe is t blasted) Pricing and product specification follows: , see table for single DNA and LNA nucleotides. All probes are HPLC purified and will be added to pricing. See details on p. 9 Need ather label Pricing and product specification follows XX mrna in-situ hybridization probe + price of label. Product will appear as a # Transfer price is to be calculated accordingly cf. contract *Tips and information for LNA probe design: 1. The most optimal use of LNA is obtained for detection probes at the length of nt. This will ensure the most optimal LNA spike-in pattern and therefore the optimal Tm of the probe for specific binding and to avoid background. Shorter probes for detection are t recommended as they will be very difficult to design with Tm high eugh for stringent hybridization conditions and thus proper specific binding. For LNA probes longer than 30 nt, the Tm becomes too high or the effect of LNA will be diluted. 2. If Exiqon is to design: Please send as much TARGET sequence as possible - it will better ensure a customer satisfaction in the end. The more sequence, the better. This gives flexibility for designing the most optimal probe. We use our in-house software tools to design the most optimal detection probe in terms of LNA-spiking pattern, Tm, length (20-25 nt), GC content, minimal secondary structure and self-annealing properties. 3. It is recommended to avoid larger repeats of G in the probe. Longer repeats of G s as well as larger content of G will complicate the synthesis of the LNA probe resulting in lower yield or lower quality. 4. When possible we suggest to always supply TARGET sequence. In some cases it may be necessary to send PROBE sequence, e.g. if customer has a suggested mismatach probe. 5. LNA spiking pattern will only be provided to the customer if originally given by customer. LNA spiking pattern is t a prerequisite for publishing of data.

8 8 Custom LNA oligonucleotids (prod ) Yes, Exiqon can synthesize an LNA oligonucleotide of for customer s own design for any application Order per DNA/LNA base oligo at standard size synthesis 200 nmol (customer receives min. 20 nmol) or large size synthesis 1000 nmol (customer receives min. 100 nmol). See next page for details. Type Nomenclature LNA A,G,mC,T DNA a,c,g,t 5 -Biotin (C4- C6) Bio 3 -Biotin (C4- C6) Bio 5 -Ami NH2C6 3 -Ami NH2C6 5 -FAM Fitc 3 -Quencher2 #Q2 5 -DIG* Dig 3 -DIG* Dig 5 -Cy3 Cy3 5 -Cy5 Cy5 HPLC - NB: For microrna or mrna detection probes and microrna kckdown probes, we recommend that Exiqon design the probe for optimal LNA content and positioning. See previous pages for products: XX, XX, and XX, respectively. For in vivo kckdown probes please contact Tech support at support@exiqon.com

9 LNA TM Oligonucleotides Ordering of product custom custom probes 9 High quality LNA Oligonucleotides are available for a variety of different specialty applications and invative products. LNA applications: microrna analysis in situ hybridization (detection) Northern blotting (detection) Kckdown capture probe design for microarrays primers for qpcr In vivo kckdown Gene expression analysis by real-time PCR Probes for cytogenetics (FISH) Probes for mrna in situ hybridisation mrna isolation microrna antisense molecules SNP detection mrna antisense molecules Allele-specific PCR priming sirna DNAzymes Fluorescence Polarization probes Molecular Beacons Capture probes for expression microarrays Comparative geme hybridisation (CGH) LNA provides superior binding and hybridization characateristics as well as enhanced biostability. LNA oligonucleotides can be used with great advantage in any application where high hybridization specificity is needed, and in particular when the target sequence is relatively short. The high binding affinity of LNA allows for the use of short and very specific probes LNA TM Oligonucleotide Customer designs or has specific requirements: When: A. For probes fully designed by the customers themselves What is offered:* - Custom oligos priced per nt base - HPLC always included (remember to include this in pricing to customer!) - Desalting t possible/t as standard nmol or 1000 nmole SYNTHESIS scale (yield sent to customer is at least 10%)** - probe sent in solution. Can be dried down upon special request. Procedure for ordering: 1. Send probe information to Exiqon tech support (support@exiqon.com) - PROBE sequence with LNA spiking pattern, LNA shown as catipal letters, e.g. atgcatgca - synthesis scale (200 nmol or 1000 nmol yield sent to customer is at least 10%)* - application (if relevant or possible) 2. Exiqon Tech support will design probe and confirm Exiqon end-user pricing (incl. HPLC fee) with a ref #. Please use ref # for ordering. IMPORTANT: customer designed LNA oligos are more difficult to synthesize. Some designs may t be possible to make, therefore a confirmation (i.e. ref #) from Exiqon is always required when placing the order. 3. Place order with ref# 4. Exiqon will synthesize the probe (shipment after 10 working days) Tips for customer design: 1. The most optimal use of LNA is obtained for probes at the length of nt. This will allow and ensure the most optimal combination of LNA spike-in pattern and Tm of the probe for specific binding and to avoid background. Typically the LNA content should be more than 25% but t exceed 50%. 1. Shorter probes for detection are t recommended as they will be very difficult to design with Tm high eugh for proper specific binding. 2. Longer LNA probes >30 nt are difficult to synthesize. For LNA probes longer than 30 nt, the Tm becomes too high (as too many LNA nt). Lower Tm would be obtained with fewer LNA nt, but then the effect of LNA will be diluted. 2. Refer customer to Tm tool on Exiqon website for help in their design of LNA oligo probe 3. It is recommended to avoid larger repeats of G. Longer repeats of G s as well as larger content of G will complicate the synthesis of the LNA probe resulting in lower yield or lower quality. 4. LNA spiking pattern will only be provided to the customer if originally given by customer. LNA spiking pattern is t a prerequisite for publishing of data. 9 ** yield depends on the ease of the synthesis. Many LNAs, long repetition of G s, and secondary structure will provide lower yield. Yield is typical between 15-20% NB: For microrna or mrna detection probes and microrna kckdown probes, we recommend that Exiqon design the probe for optimal LNA content and positioning. See previous pages for products: XX, XX, and XX respectively.

Functional Analysis. LNA longrna GapmeR

Functional Analysis. LNA longrna GapmeR Functional Analysis LNA longrna GapmeR Instruction manual v2.0 August 2013 Table of contents Product Summary............................................................ Content...................................................................

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

Product Catalog. All you need for RNA research. Order a free printed copy of this catalog

Product Catalog. All you need for RNA research. Order a free printed copy of this catalog Product Catalog All you need for RNA research Order a free printed copy of this catalog Products and Services for RNA Analysis RNA Products and Services Isolation mircury Exosome Isolation Kits (page 14)

More information

SUPPLEMENTARY INFORMATION FILE

SUPPLEMENTARY INFORMATION FILE SUPPLEMENTARY INFORMATION FILE Existence of a microrna pathway in anucleate platelets Patricia Landry, Isabelle Plante, Dominique L. Ouellet, Marjorie P. Perron, Guy Rousseau & Patrick Provost 1. SUPPLEMENTARY

More information

Bridged Nucleic Acids - BNA3 TM

Bridged Nucleic Acids - BNA3 TM Speed-up Discovery Bridged Nucleic Acids - 3 TM Superior hybridization - Enhanced biostability H Base H N R RNA DNA SYNTHESIS CMMITTED T BIMIC RESEARCH Third Generation Super Functional Bridged Nucleic

More information

Antisense LNA GapmeRs Handbook

Antisense LNA GapmeRs Handbook Antisense LNA GapmeRs Handbook October 2017 LNA-optimized oligonucleotides for strandspecific knockdown of mrna and lncrna Sample to Insight Contents Kit Contents... 3 Storage... 4 Intended Use... 4 Quality

More information

Unlock the Secrets of microrna

Unlock the Secrets of microrna Unlock the Secrets of microrna mircury LNA Products for microrna Research 2012 www.exiqon.com Enabling your groundbreaking microrna discovery MicroRNAs are small wonders. To study them, life science researchers

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Fluorescent dye labeled oligos, Molecular Beacons, sirna, phosphonates Affinity Ligands, 2-5 linked

More information

Product Specifications & Manual

Product Specifications & Manual Product Specifications & Manual Oligo dt primers, random primers, sequencing primers Custom Oligo Synthesis, antisense oligos, RNA oligos, chimeric oligos, Affinity Ligands, 2-5 linked Oligos Oligo dt

More information

DNA Oligos - Single Tube Format

DNA Oligos - Single Tube Format Hysel India PL 2017-18 DNA Oligos - Single Tube Format zurück Standard Small Scale Synthesis - price/base in Rs 100% Rabatt Scale [µmol] Standard Yield (OD 260 ) OPC Purified Yield (OD 260 ) HPLC Purified

More information

Hairpin-it TM mirnas qpcr Quantitation Kit

Hairpin-it TM mirnas qpcr Quantitation Kit Hairpin-it TM mirnas qpcr Quantitation Kit For the detection and quantification of micrornas using real-time PCR detection instruments. Catalog No. QPM-010/ QPM-011/ QPM-012/ QPM-013 User Manual Table

More information

microrna Research mircury LNA Products microrna Knockdown microrna Expression Profiling microrna Profiling Services microrna Detection

microrna Research mircury LNA Products microrna Knockdown microrna Expression Profiling microrna Profiling Services microrna Detection microrna Research mircury LNA Products microrna Knockdown microrna Expression Profiling microrna Profiling Services microrna Detection MicroRNA Research with mircury LNA microrna Products Table of Contents

More information

Galina Gabriely, Ph.D. BWH/HMS

Galina Gabriely, Ph.D. BWH/HMS Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered

More information

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230

mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230 mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR

More information

INTEGRATED DNA TECHNOLOGIES. Products & Services

INTEGRATED DNA TECHNOLOGIES. Products & Services INTEGRATED DNA TECHNOLOGIES THE CUSTOM BIOLOGY COMPANY Products & Services CUSTOM DNA & RNA Custom DNA Synthesis Synthesis Scale Length (Tubes) (Plates) 25 nmole 15-60 bases.09/base.08/base 100 nmole 10-90

More information

Custom Oligonucleotide:

Custom Oligonucleotide: Custom Oligonucleotide: Products & Services The Modified Nucleic Acid Experts Custom Oligonucleotide Synthesis Partnering to Help Advance Innovation For over 20 years, TriLink has been an industry leader

More information

Custom Oligonucleotide Synthesis & Products. The Modified Nucleic Acid Experts

Custom Oligonucleotide Synthesis & Products. The Modified Nucleic Acid Experts Custom Oligonucleotide Synthesis & Products The Modified Nucleic Acid Experts For over 20 years, TriLink has been an industry leader synthesizing oligonucleotides for research, diagnostics, OEM, & therapeutics.

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

DNA Synthesis. Best Price Segment

DNA Synthesis. Best Price Segment General Price List in EUR Valid from January 29, 2016 DNA Synthesis Best Price Segment DNA Oligos Large-Volume Orders 1 [Genomics and 0.04 µmol Scale; Desalted; max. Length: 60 bases] # DNA Bases # of

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

DNA/RNA Oligonucleotide Services General Price List; valid from

DNA/RNA Oligonucleotide Services General Price List; valid from Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality

More information

DNA/RNA Oligonucleotide Services Price List UK; valid from

DNA/RNA Oligonucleotide Services Price List UK; valid from Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality

More information

DNA/RNA Oligonucleotide Services Price List Sweden; valid from

DNA/RNA Oligonucleotide Services Price List Sweden; valid from Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality

More information

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation...

Table of contents. I. Description...2. II. Principle...2. III. Kit Components...3. IV. Storage...3. V. Features...4. VI. Precautions for Operation... Table of contents I. Description...2 II. Principle...2 III. Kit Components...3 IV. Storage...3 V. Features...4 VI. Precautions for Operation...4 VII. Protocol...4 VIII.Experiment Example...6 IX. Appendix...8

More information

Dig System for Starters

Dig System for Starters Dig System for Starters Content 1. Powerful and Versatile DIG System 2. Labeling Nucleic Acids using the DIG System 3. Critical Hints for PCR Labeling 1 2 3 1. Powerful and Versatile DIG System Powerful

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

NCode mirna profiling. Sensitive, reproducible mirna profiling

NCode mirna profiling. Sensitive, reproducible mirna profiling Sensitive, reproducible mirna profiling Complete solutions for profiling mirna expression patterns Complete, optimized platform for mirna profiling Quick and efficient mirna expression analysis Superior

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

Roche Molecular Biochemicals Technical Note No. LC 12/2000

Roche Molecular Biochemicals Technical Note No. LC 12/2000 Roche Molecular Biochemicals Technical Note No. LC 12/2000 LightCycler Absolute Quantification with External Standards and an Internal Control 1. General Introduction Purpose of this Note Overview of Method

More information

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect

More information

Fluorescent in-situ Hybridization

Fluorescent in-situ Hybridization Fluorescent in-situ Hybridization Presented for: Presented by: Date: 2 Definition In situ hybridization is the method of localizing/ detecting specific nucleotide sequences in morphologically preserved

More information

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual

mmu-mir-34a Real-time RT-PCR Detection Kit User Manual mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not

More information

DNA/RNA Oligonucleotide Services Price List UK; valid from

DNA/RNA Oligonucleotide Services Price List UK; valid from Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality

More information

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,

More information

DNA/RNA Oligonucleotide Services Price List Denmark; valid from

DNA/RNA Oligonucleotide Services Price List Denmark; valid from Optimised Application Oligos All our application oligos are optimised and scientifically proven to show highly consistent results in respective application Online synthesis reports, data sheets and quality

More information

Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna

Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna Catalog #: Various Silencer Select Pre-designed sirna Silencer Select Validated sirna Silencer Select Custom Designed sirna Custom Select sirna General Product Details and User Information Refer to page

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

User Guide MICROSYNTH WEBSHOP

User Guide MICROSYNTH WEBSHOP User Guide MICROSYNTH WEBSHOP User Guide Content 1 FAQ... 1 2 Login to Shop... 1 3 Ordering of an Oligonucleotide (Normal Entry)... 2 4 Ordering of an Oligonucleotide (Upload Entry)... 9 5 Order History...

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

Optimizing Multiplex qpcr for Detecting Infectious Diseases

Optimizing Multiplex qpcr for Detecting Infectious Diseases Optimizing Multiplex qpcr for Detecting Infectious Diseases Aurita Menezes Ph.D, qpcr Product Manager Integrated DNA Technologies Agenda Establishing robust multiplex assays In the context of Gene expression

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Price List. Primers and Oligonucleotides. DNA and RNA Oligos. Content

Price List. Primers and Oligonucleotides. DNA and RNA Oligos. Content Content Content... 1 Unmodified DNA Oligonucleotides... 2 Modified DNA Oligonucleotides - 5' Fluorescent Labels... 2 Modified DNA Oligonucleotides - 5' Non-Fluorescent Labels... 3 Modified DNA Oligonucleotides

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Assay Design Considerations, Optimization and Validation

Assay Design Considerations, Optimization and Validation Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment

More information

Therapeutic & Prevention Application of Nucleic Acids

Therapeutic & Prevention Application of Nucleic Acids Therapeutic & Prevention Application of Nucleic Acids Seyed Amir Hossein Jalali Institute of Biotechnology and Bioengineering, Isfahan University Of Technology (IUT). 30.7.2015 * Plasmids * DNA Aptamers

More information

Alteration of microrna expression correlates to fatty acidmediated. insulin resistance in mouse myoblasts

Alteration of microrna expression correlates to fatty acidmediated. insulin resistance in mouse myoblasts Alteration of microrna expression correlates to fatty acidmediated insulin resistance in mouse myoblasts Supplemental Data Correlation coefficient matrix con PA PA 0.9425 1.0000 PA+OA 0.9407 0.9626 con

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit for mirna qpcr array Cat. No. QP017 (Old Cat. No. AMRT-2020, 20 mirna reverse

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom

More information

It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue

It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future

More information

Artificial Nucleic Acids -Their Developments and Recent Applications

Artificial Nucleic Acids -Their Developments and Recent Applications Artificial Nucleic Acids -Their Developments and Recent Applications Bioorganic Chemistry Laboratory D2 Kenichiro Ito Organic Seminar 2012/5/7 1 Nucleic acids play central roles in life Replication Transcription

More information

long noncoding RNA Knockdown and detection of Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays

long noncoding RNA Knockdown and detection of Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays Thermo Scientific Lincode sirna and Solaris lncrna Expression Assays Knockdown and detection of long noncoding RNA C omprehensive pre-designed reagents for investigation of human lncrnas sirnas with enhanced

More information

Reviewers' Comments: Reviewer #1 (Remarks to the Author)

Reviewers' Comments: Reviewer #1 (Remarks to the Author) Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript reports a novel form of microrna sponge, designated a "zipper" an LNA antisense sequence that bridges from the 3' end of one microrna

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

BIOGNOSTIK. RNAi Catalog How to meet current demands on RNAi experiments?

BIOGNOSTIK. RNAi Catalog How to meet current demands on RNAi experiments? BIOGNOSTIK RNAi Catalog 2006 How to meet current demands on RNAi experiments? New publication guidelines for RNAi data: Various controls requested for RNAi experiments Nature Cell Biology 2003 (1) Blast

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Experimental schema for the identification of circular RNAs in six normal tissues and seven cancerous tissues. Supplementary Fiure 2 Comparison of human circrnas

More information

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design

Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design Optimizing a Conventional Polymerase Chain Reaction (PCR) and Primer Design The Polymerase Chain Reaction (PCR) is a powerful technique used for the amplification of a specific segment of a nucleic acid

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Non-Radioactive Southern Blot Reagents

Non-Radioactive Southern Blot Reagents Product Specifications Non-Radioactive Southern Blot Reagents Store as labeled. For research use only. Non-Radioactive Southern Blot Analysis, Electrophoresis Reagents Polymerase Chain Reaction Reagents,

More information

DNA Hybridization and Detection

DNA Hybridization and Detection Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................

More information

TaqMan Advanced mirna Assays

TaqMan Advanced mirna Assays PRODUCT BULLETIN TaqMan Advanced mirna Assays TaqMan Advanced mirna Assays Key features Universal reverse transcription (RT) one RT step for all Applied Biosystems TaqMan Advanced mirna Assays Sensitive

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

A robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution

A robust and sensitive. for profiling of mirnas Life Sciences - Genomics. Stephanie Fulmer-Smentek. Group Manager. Agilent mirna profiling solution A robust and sensitive microarray system for profiling of mirnas Life Sciences - Genomics Stephanie Fulmer-Smentek RNA Applications R&D Group Manager Overview microrna biology Agilent mirna platform -

More information

METHODS OF NUCLEIC ACID HYBRIDIZATION

METHODS OF NUCLEIC ACID HYBRIDIZATION Module 3 Lecture 4 METHODS OF NUCLEIC ACID HYBRIDIZATION 3-4.1 Introduction: Nucleic acid hybridization is a basic technique in molecular biology which takes advantage of the ability of individual single-stranded

More information

What is a microarray

What is a microarray DNA Microarrays What is a microarray A surface on which sequences from thousands of different genes are covalently attached to fixed locations (probes). Glass slides Silicon chips Utilize the selective

More information

Agilent s Mx3000P and Mx3005P

Agilent s Mx3000P and Mx3005P Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded

More information

TaqMan Advanced mirna Assays

TaqMan Advanced mirna Assays PRODUCT BULLETIN Key features Universal reverse transcription (RT) one RT step for all TaqMan Advanced mirna Assays Sensitive detect as few as 60 copies of input microrna (mirna) Specific detect only mature

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

LIGHTCYCLER EXPERIMENTAL

LIGHTCYCLER EXPERIMENTAL LIGHTCYCLER EXPERIMENTAL D E S I G N CONTENTS PART 1 INTRODUCTION...4 1.1 Introduction to fluorescence applications for the LightCycler. 4 1.2 Fluorescence techniques for the LightCycler 5 1.2.1 Double

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer

INTRODUCTION. The Technology of Microarrays January Hanne Jarmer INTRODUCTION The Technology of Microarrays January 2009 - Hanne Jarmer The Concept gene mrna gene specific DNA probes labeled target Spotted arrays High-density arrays 13-16 micron features ~60 micron

More information

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

Fluorescent In Situ Hybridization (FISH) Assay

Fluorescent In Situ Hybridization (FISH) Assay Fluorescent In Situ Hybridization (FISH) Assay 1 What is FISH 2 Probes 3 FISH Procedure 4 Application Definition, Principle and Sample Types The core of FISH technology A quick and simple FISH protocol

More information

The DIG System. Labeling and Detection of Nucleic Acids

The DIG System. Labeling and Detection of Nucleic Acids The DG System Labeling and Detection of Nucleic Acids The DG System Specifically Label and Detect Nucleic Acids Publishable results require high level specific detection and low background. Do your hybridizations

More information

QPCR ASSAYS FOR MIRNA EXPRESSION PROFILING

QPCR ASSAYS FOR MIRNA EXPRESSION PROFILING TECH NOTE 4320 Forest Park Ave Suite 303 Saint Louis, MO 63108 +1 (314) 833-9764 mirna qpcr ASSAYS - powered by NAWGEN Our mirna qpcr Assays were developed by mirna experts at Nawgen to improve upon previously

More information

Polymerase Chain Reaction-361 BCH

Polymerase Chain Reaction-361 BCH Polymerase Chain Reaction-361 BCH 1-Polymerase Chain Reaction Nucleic acid amplification is an important process in biotechnology and molecular biology and has been widely used in research, medicine, agriculture

More information

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire

2 march 06 Seminar on RT-PCR. About Real-time PCR. Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire 2 march 06 Seminar on RT-PCR About Real-time PCR Aurélie OLIVIER Université Catholique de Louvain Unité de pharmacologie cellulaire et moléculaire Target DNA PCR Applications: Gene Plasmide, phage Diagnostic

More information

Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0

Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of

More information

MOLECULAR STRUCTURE OF DNA

MOLECULAR STRUCTURE OF DNA MOLECULAR STRUCTURE OF DNA Characteristics of the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell (generation to generation) 2. Information Storage Biologically

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Designing Real-Time Assays on the SmartCycler II System

Designing Real-Time Assays on the SmartCycler II System Designing eal-time Assays on the SmartCycler II System Cepheid Technical Support Overview This document provides general guidelines for the design of real-time experiments on the Cepheid SmartCycler II

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

FAQ (Frequently Asked Questions) about custom DNA Synthesis

FAQ (Frequently Asked Questions) about custom DNA Synthesis FAQ (Frequently Asked Questions) about custom DNA Synthesis 1. What is scale of synthesis? Scale of synthesis refers to the amount of starting CPG (controlled-pore glass) support-bound monomer used to

More information

Exploring of microrna markers for body fluid identification using NGS

Exploring of microrna markers for body fluid identification using NGS Exploring of microrna markers for body fluid identification using NGS Zheng Wang, Yiping Hou Institute of Forensic Medicine Sichuan University, China Barcelona May, 11, 2016 Outline Introduction of Institute

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

SALSA MLPA probemix P200-A1 Human DNA Reference-1 Lot A1-1113, Lot A1-0410, A1-0209, A1-0408

SALSA MLPA probemix P200-A1 Human DNA Reference-1 Lot A1-1113, Lot A1-0410, A1-0209, A1-0408 SALSA MLPA probemix P200-A1 Human DNA Reference-1 Lot A1-1113, Lot A1-0410, A1-0209, A1-0408 The P200-A1 Human DNA Reference-1 probemix contains reference probes and control fragments specific for unique

More information

Then, we went on to discuss genome expression and described: Microarrays

Then, we went on to discuss genome expression and described: Microarrays In the previous lecture, we have discussed: - classical sequencing methods - newer authomatic sequencing methods - solid-phase parallel sequencing - Next Generation mass-sequencing methods Then, we went

More information

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063

ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 INSTRUCTION MANUAL ZR-96 Oligo Clean & Concentrator Catalog Nos. D4062 & D4063 Highlights Quick, high-throughput (96-well) recovery of ultra-pure DNA and RNA oligonucleotides. Complete removal of dyes,

More information

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase

More information

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.

Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure a T m ( C) Seq. '-3' uguuugugguaacagugugaggu L 62 AttGtcAcaCtcC L2 6 ccattgtcacactcc L3 66 attgtcacactcc 7 ccattgtcacactcca L 73 ccattgtcacactcc L6 74 AttGTcaCaCtCC L7 7 attgtcacactcc

More information

MicroRNA Expression Plasmids

MicroRNA Expression Plasmids MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 February 15, 2013 Multiple choice questions (numbers in brackets indicate the number of correct answers) 1. Which of the following statements are not true Transcriptomes consist of mrnas Proteomes consist

More information

Gene expression profiling experiments:

Gene expression profiling experiments: Gene expression profiling experiments: Problems, pitfalls, and solutions. Heli Borg The Alternatives in Microarray Experiments bacteria - eucaryots non poly(a) + - poly(a) + oligonucleotide Affymetrix

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information