Hands on session: Advanced promoter analysis
|
|
|
- Damon Wright
- 6 years ago
- Views:
Transcription
1 Interactive workshop Hands on session: Advanced promoter analysis Thomas Werner CEO&CSO Genomatix Software GmbH Landsberger Strasse 6, D München
2 Outline of tasks What you will be doing during the next 2 hours Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
3 Task 1 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
4 Plant promoter modeling Training dataset: five orthologous rbcs promoter sequences Comparative promoter analysis
5 Search for common TF sites GEMS Launcher Task: Search for common TF sites in multiple sequences, working on rbcs_promoters.embl (5 seq.) Which of these matches represent functional binding sites?
6 Task 2 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
7 Definition of common framework GEMS Launcher Task: FrameWorker: Definition of common framework FrameWorker Parameters: Minimum no. of sequences with framework: 5 sequences (100% of 5) Distance between elements: Result: 1 framework with 2 elements was found:
8 Task 3 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
9 Modification of rbcs Model1 GEMS Launcher Task: Modification of user-defined models Manual modification of rbcs Model1 based on matches to the five rbcs promoter training sequences (optional) rbcs Model1 14 to 25 bp P$IBOX P$ABRE (+) (+)
10 Task 4 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
11 Evaluation of rbcs Model1 GEMS Launcher Task: ModelInspector: Search for user-defined models, working on Buchers EPD (Eukaryotic Promoter Database, Rel. 78) rbcs Model1 EPD ModelInspector Result: A total of 37 matches was found. Sequences searched: 4810 (2,886,000 bp). 9 out of 37 EPD matches were plant promoters: 8 rbcs genes (RuBPCss) 1 chalcone synthase (also known to be light regulated) Model1 is selective for rbcs and other light regulated genes
12 Database search using rbcs Model1 GEMS Launcher Task: ModelInspector: Search for user-defined models, working on Plants (GenBank Release 141, a total of 1.14 Billion bp) rbcs Model1 GenBank Plants A) Result: a total of 9440 matches was found. - A two elements model usually also has spurious matches, outside of the right promoter context. B) => Matches filtered for: promoters => A total of 121 matches was found. 34 matches had a single gene annotation in the description line. For these, a software supported screen for keywords within PubMed was performed: 11 were annotated as rbcs At least 5 matches are genes also supposed to be light regulated: phenylalanine ammonia-lyase chalcone synthase sucrose-phosphate synthase nitrate reductase phosphoglycerate kinase Model1 is selective for rbcs and other light regulated genes
13 Plant module library GEMS Launcher Task: ModelInspector: Search for promoter modules, working on rbcs_promoters.embl (5 seq.) Library: Module Library Version 3.5, Plant Modules (January 2004) ~110 plant matrices ~30 plant modules Model IBOX_BZIP_01: P$IBOX, P$BZIP, Distance: bp Model rbcs Model1 : P$IBOX, P$ABRE, Distance: bp Model IBOX_BZIP_01 from Genomatix library is very similar to the in silico generated rbcs Model1
14 Task 5 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
15 Sequence alignment GEMS Launcher Task: DiAlign: Local multiple alignment ATRBCSA 378 AG--CACCAC TCCACCATCA CACAATTTCA C-TCatagat AACGA TAAGATTcat ggaattatct TCCACGTGGC ATTATTCCAG SOYRUBPA 234 t cc ACCACCATCA CACATTTTac gttcttcca AGGAAGAGA TAAGATAAt- -GAAGCCTCC TCCACGTGTC ACT-TCCACA TOBRBCS8B 195 AA--TAACCA ACCTCAATCA TACATTCATA T-CCTCTTCC TAcCCCCATC 242 TAGGATGAGA TAAGATTACT GAGGTGCT-T TACACGTGGC ACC-TCCATT NTRUBSS 334 AAatTAACCA ACCTCAATCA CACATTCATA T-CCTCTTCC TA-CCCCATC 382 TAGGATGAGA TAAGATTACT agg----tct TACACGTGGC ACC-TCCATT PEARPC A ACCACCATCA CACATTTACA C-TCTTCAC ATGAAAAGA TAAGATCAGT GAGGTAAT-A TCCACATGGC ACTGTCCTAT ** ****** ********** ********** * ******** ** ******* ********** ********** ********** ********** ********** ** ****** ********** ********** * ******** ** ******* ********** ********** ******** * ********** *** ****** ****** ********** ********** * ******** ** ******* ********** ********** * ********** *** ****** ****** ********** ********** * ******** ** ********* ********** * ********** *** ****** * ********** ********** * ******* ********* ******** * ********** ** ****** ********** ******** ** *** ****** ********** ** ********* ****** ********* ****** rbcs Model1 Element 1 ATRBCSA 607 CACTCCAAag cttgttctca ttgttgttat CATTATATAT AGAtgaccaa SOYRUBPA 446 TAGTACTACA CAAATCACAc t ATTATATAT AGT TOBRBCS8B 447 GCGAAATATG TAAAACC TTAT CATTATATAT AGAGTGGTGG NTRUBSS 583 AGGAAATATG TAAAACC TTAT CATTATATAT AGgGTGGTGG PEARPC 357 TGGAAATAGA TAAATAAAAa CATTATATAT AGC ********** ********* **** ********** ********** ******** ******* **** ********** *** ******** ******* **** ********** *** ******** ******* **** ********** *** **** ********** ** **** ********** ** ********** ** ********* ** ********* ** ********* ** P$IBOX Four conserved elements: P$ABRE - Element 1 (unknown) - IBOX (GATAA), -> light regulation - ABRE, abscisic acid response. Contains G-Box core (CACGTG), -> light regulation - TATA-Box TATA-Box
16 Definition of weight matrix GEMS Launcher Task: MatDefine: Definition of weight matrices User defined weight matrix for rbcs Element1 ATRBCSA CCACCATCA CACAAT SOYRUBPA CCACCATCA CACATT TOBRBCS8B CCTCAATCA TACATT NTRUBSS CCTCAATCA CACATT PEARPC CCACCATCA CACATT ********* ****** ********* ****** ********* ****** ********* ****** ********* ****** ********* ****** ********* ****** ********* ****** Element 1 User defined Matrix: U$rbcS_Element1
17 Enhancement of the rbcs model GEMS Launcher Task: Modification of user-defined models Enhance the rbcs model based on matches to the five rbcs promoter training sequences: rbcs Model2 15 to 50 bp 14 to 25 bp U$rbcS_Element1 (+) P$IBOX (+) P$ABRE (+) 100 to 250 bp P$TBPF (+) Database search: rbcs Model2 GenBank Plants - 26 matches were found in GenBank plants section (1.14 Billion bp): - 22 rbcs genes from different plant species - 4 unannotated BAC clones rbcs Model2 is specific for rbcs gene promoters
18 Phylogeny of rbcs Model 2 matches Phylogeny Monocots Brassicaceae Arabidopsis thaliana (thale cress) Brassica napus (rape) Angiosperms Fabaceae Pisum sativum (pea) Glycine max (soybean) Trifolium repens (white clover) Phaseolus vulgaris (kidney bean) Dicots Nicotiana tabacum (tobacco) Solanaceae Nicotinia plumbaginifolia Solanum tuberosum (potato) Lycopersicon esculentum (tomato) Petunia hybrida (garden petunia) 7 new species were found by rbcs Model2 (yellow) Chenopodiaceae Spinacia oleracea (spinach)
19 Task 6 What you will be doing next Analyze rbcs promoters for transcription factor binding sites (TFBS) (MatInspector from GEMS package) Analyze rbcs promoters for TFBS frameworks (FrameWorker from GEMS package) Modify and optimize rbcs promoter models for TFBS frameworks (FastM from GEMS package) Database search with frameworks (ModelInspector from GEMS package) Determine and define new TFBS matrix from multiple alignment (DiAlign and MatDefine from GEMS package) Experimental design: specifically deleting a TFBS (SequenceShaper from GEMS package)
20 Experimental design Pitfalls in mutational analyses Is there experimental evidence for the functionality of unknown Element1? ATRBCSA CCACCATCA CACAAT SOYRUBPA CCACCATCA CACATT TOBRBCS8B CCTCAATCA TACATT NTRUBSS CCTCAATCA CACATT PEARPC CCACCATCA CACATT Reporter assay (wet lab) Element 1 These unintended side effects can happen without experimental design: Arabidopsis: ATRBCSA AGCACCACTCCACCACCATCACACAATTTCACTCATAGAT Deletion: AGCACCACTCCACCACCATCACACAATTTCACTCATAGAT TCACTCATAGAT AGCACCACTCCATCACTCATAGAT Generates TF binding site: Mutation: CCACCATCACACAAT CCACCgaCACACAAT Generates TF binding site:
21 Experimental design GEMS Launcher Task: SequenceShaper: Design of regulatory sequences, working on rbcs_at_element1_context.fasta (40 bp) Experimental design: Specific generation/deletion of TF binding sites without changing the sequence context. Matrix libraries: plants.lib, user_defined.lib ATRBCSA AGCACCACTCCACCACCATCACACAATTTCACTCATAGAT In silico sequence design is a prerequisite for wet lab mutational analyses
22 Plant references Plant references Arguello-Astorga GR, Herrera-Estrella LR. Ancestral multipartite units in light-responsive plant promoters have structural features correlating with specific phototransduction pathways. Plant Physiol Nov; 112(3): Martinez-Hernandez A, Lopez-Ochoa L, Arguello-Astorga G, Herrera-Estrella L. Functional properties and regulatory complexity of a minimal RBCS light-responsive unit activated by phytochrome, cryptochrome, and plastid signals. Plant Physiol Apr; 128(4):
In silico identification of transcriptional regulatory regions
In silico identification of transcriptional regulatory regions Martti Tolvanen, IMT Bioinformatics, University of Tampere Eija Korpelainen, CSC Jarno Tuimala, CSC Introduction (Eija) Program Retrieval
Supporting Information
Supporting Information Poelman et al. 10.1073/pnas.1110748108 SI Text Cloning of Transcription Factor BoMYC as an Example in the Study. A partial sequence (575 bp) of the cabbage transcription factor (MYC)
Finding Eukaryotic Genes Computationally
Gene Identification Finding Eukaryotic Genes Computationally ü Content-based Methods GC content, hexamer repeats, composition statistics, codon frequencies ü Site-based Methods donor sites, acceptor sites,
BIOINFORMATICS AN OVERVIEW
BIOINFORMATICS AN OVERVIEW T.R. Sharma Genoinformatics Lab, National Research Centre on Plant Biotechnology I.A.R.I, New Delhi 110012 trsharma@nrcpb.org Introduction Bioinformatics is the computational
The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant. By Jenalyn Quevedo
The Isolation and Sequence Analysis of the Cryptochrome (Cry1) Gene From a Petunia hybrida Plant By Jenalyn Quevedo Biology 115L June 6, 2005 1 Abstract The blue-light photoreceptor cryptochrome (cry1)
GMO Working Meeting GMO FREE European Regions Network and DG AGRI. 29. April Input AGES Austrian Agency for Health and Food Safety
GMO Working Meeting GMO FREE European Regions Network and DG AGRI 29. April 2009 Input AGES Austrian Agency for Health and Food Safety 1 Austrian Cultivation and Seed Multiplication (2008, defined species)
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro
Sequencing the genomes of Nicotiana sylvestris and Nicotiana tomentosiformis Nicolas Sierro Philip Morris International R&D, Philip Morris Products S.A., Neuchatel, Switzerland Introduction Nicotiana sylvestris
Identifying the functional bases of trait variation in Brassica napus using Associative Transcriptomics
Brassica genome structure and evolution Genome framework for association genetics Establishing marker-trait associations 31 st March 2014 GENOME RELATIONSHIPS BETWEEN SPECIES U s TRIANGLE 31 st March 2014
Products of somatic hybrids and cybrids
Products of somatic hybrids and cybrids Chromosome status of somatic hybrids The chromosome numbers of the somatic hybrids successfully obtained through protoplast fusion indicate that only few have exact
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham.
Liu, Yang (2012) The characterization of a novel abscission-related gene in Arabidopsis thaliana. PhD thesis, University of Nottingham. Access from the University of Nottingham repository: http://eprints.nottingham.ac.uk/12529/4/thesis_part_3_final.pdf
Characterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA
Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan
Sampling methodology for detection of living modified organisms
Sampling methodology for detection of living modified organisms Dr. Moolchand Singh Senior Scientist Division of Plant Quarantine National Bureau of Plant Genetic Resources, New Delhi Sampling Procedure
RNA Sequencing Analyses & Mapping Uncertainty
RNA Sequencing Analyses & Mapping Uncertainty Adam McDermaid 1/26 RNA-seq Pipelines Collection of tools for analyzing raw RNA-seq data Tier 1 Quality Check Data Trimming Tier 2 Read Alignment Assembly
Supplemental Data. Wang et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Analysis of mature mirna sequences of the mir172 family members. Mature sequences of mir172 family members were aligned using software MEGA5. The stars indicate nucleotides conserved
Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
APP Application APP to develop, as a project, genetically modified organisms (as described in
DECISION Amended under section 67A on 5 August 2015 Amended under section 67A of the HSNO Act on 20 September 2016 Date 3 October 2012 Application code Application type Applicant APP201459 To develop in
Supporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
Pyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
Exploring Computational Protein Fishing (CPF) to identify Argonaute Proteins from Sequenced Crop Genomes
International Letters of Natural Sciences Online: 15-01-27 ISSN: 2300-9675, Vol. 33, pp 27-36 doi:10.18052/www.scipress.com/ilns.33.27 15 SciPress Ltd., Switzerland Exploring Computational Protein Fishing
Introduction to genome biology
Introduction to genome biology Lisa Stubbs Deep transcritpomes for traditional model species from ENCODE (and modencode) Deep RNA-seq and chromatin analysis on 147 human cell types, as well as tissues,
Spacing between GT-1 Binding Sites within a Light- Responsive Element 1s Critical for Transcriptional Activity
The Plant Cell, Vol. 2, 447-455, May 1990 O 1990 American Society of Plant Physiologists Spacing between GT-1 Binding Sites within a Light- Responsive Element 1s Critical for Transcriptional Activity Philip
Übung V. Einführung, Teil 1. Transktiptionelle Regulation TFBS
Übung V Einführung, Teil 1 Transktiptionelle Regulation TFBS Transcription Factors These proteins promote transcription 1. Bind DNA 2. Activate Transcription These two functions usually reside on separate
Pathway approach for candidate gene identification and introduction to metabolic pathway databases.
Marker Assisted Selection in Tomato Pathway approach for candidate gene identification and introduction to metabolic pathway databases. Identification of polymorphisms in data-based sequences MAS forward
Supplemental Data. Xie et al. (2014). Plant Cell /tpc
Supplemental Figure 1. The phylogenetic tree of rice and Arabidopsis Group A/B/C MAPKs that contain the TEY motif in their activation loop. Tobacco SIPK and WIPK, human ERK2 and P38 were also included
Detection of Plant Genes Using a Rapid, Nonorganic DNA Purification Method
Detection of Plant Genes Using a Rapid, Nonorganic DNA Purification Method J.-J. Lin, R. Fleming, J. Kuo, B.F. Matthews 1 and J.A. Saunders 1 Life Technologies, Rockville, MD, USA; and 1 USDA, ARS, Beltsville,
DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo
DRAGON DATABASE OF GENES ASSOCIATED WITH PROSTATE CANCER (DDPC) Monique Maqungo South African National Bioinformatics Institute University of the Western Cape RELEVEANCE OF DATA SHARING! Fragmented data
ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas
ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences
Figure 7.1: PWM evolution: The sequence affinity of TFBSs has evolved from single sequences, to PWMs, to larger and larger databases of PWMs.
Chapter 7 Discussion This thesis presents dry and wet lab techniques to elucidate the involvement of transcription factors (TFs) in the regulation of the cell cycle and myogenesis. However, the techniques
Supplementary Information
Supplementary Information MED18 interaction with distinct transcription factors regulates plant immunity, flowering time and responses to hormones Supplementary Figure 1. Diagram showing T-DNA insertion
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
Mining functional microsatellites in legume unigenes
www.bioinformation.net Hypothesis Volume 7(5) Mining functional microsatellites in legume unigenes Manish Roorkiwal 1,2 & Prakash Chand Sharma 1 * 1University School of Biotechnology, Guru Gobind Singh
Nucleic Acid Purification Kits
Nucleic Acid Purification Kits Fast Value Quality Convenient Reproducible Innovations in nucleic acid isolation E.Z.N.A. Plasmid Mini Kit l For Isolation of up to 30 µg of plasmid DNA The E.Z.N.A. Plasmid
Multiplexing Genome-scale Engineering
Multiplexing Genome-scale Engineering Harris Wang, Ph.D. Department of Systems Biology Department of Pathology & Cell Biology http://wanglab.c2b2.columbia.edu Rise of Genomics An Expanding Toolbox Esvelt
CONSERVATION TILLAGE TRENDS IN VIRGINIA AGRICULTURAL PRODUCTION. Research and Extension Center, Painter, VA
2 CONSERVATION TILLAGE TRENDS IN VIRGINIA AGRICULTURAL PRODUCTION Mark S. Reiter 1 * 1 Department of Crop and Soil Environmental Sciences, Virginia Tech Eastern Shore Agricultural Research and Extension
Stefano Monti. Workshop Format
Gad Getz Stefano Monti Michael Reich {gadgetz,smonti,mreich}@broad.mit.edu http://www.broad.mit.edu/~smonti/aws Broad Institute of MIT & Harvard October 18-20, 2006 Cambridge, MA Workshop Format Morning
Discovering gene regulatory control using ChIP-chip and ChIP-seq. Part 1. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq Part 1 An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk http://bit.ly/bio2links
Mutator-Like Elements with Multiple Long Terminal Inverted Repeats in Plants
Comparative and Functional Genomics Volume 2012, Article ID 695827, 14 pages doi:10.1155/2012/695827 Research Article Mutator-Like Elements with Multiple Long Terminal Inverted Repeats in Plants Ann A.
Computational Technique for Improvement of the Position-Weight Matrices for the DNA/Protein Binding Sites
Wright State University CORE Scholar Physics Faculty Publications Physics 2005 Computational Technique for Improvement of the Position-Weight Matrices for the DNA/Protein Binding Sites Naum I. Gershenzon
OECD O E C 52 Vol.6_No.02
OECD O E C 52 Vol.6_No.02 BIOSAFETY 53 54 Vol.6_No.02 BIOSAFETY 55 56 Vol.6_No.02 BIOSAFETY 57 58 Vol.6_No.02 BIOSAFETY 59 1) Recombinant DNA Safety Considerations. Safety considerations for industrial,
Re-sequencing and hybrid assembly strategy of two nematode resistant Beta vulgaris translocation lines. Sarah Christina Jäger
Faculty of Agricultural and Nutritional Sciences Re-sequencing and hybrid assembly strategy of two nematode resistant Beta vulgaris translocation lines Plant Breeding Institute Sarah Christina Jäger Plant
Watanabe, J. A., 1,2) M. Ikegawa 1,3), T. Yamada 1) & K. N. Watanabe 1,2)
Fishing Genes from germplasm: Cloning, testing and use of gene-like fragments associated with root-knot nematode resistance in tuber-bearing Solanum genetic resources Patent: WO03/080838 A1 Watanabe, J.
Regulation of eukaryotic transcription:
Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:
In silico variant analysis: Challenges and Pitfalls
In silico variant analysis: Challenges and Pitfalls Fiona Cunningham Variation annotation coordinator EMBL-EBI www.ensembl.org Sequencing -> Variants -> Interpretation Structural variants SNP? In-dels
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away
Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science Introduc
Identification of Amino Acids of Cladosporium fulvum CfHNNI1 Required for Function of Necrosis Induction in Plants
Acta Botanica Sinica 2004, 46 (6): 738 743 http://www.chineseplantscience.com Identification of Amino Acids of Cladosporium fulvum CfHNNI1 Required for Function of Necrosis Induction in Plants CAI Xin-Zhong
REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
NCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
KnetMiner USER TUTORIAL
KnetMiner USER TUTORIAL Keywan Hassani-Pak ROTHAMSTED RESEARCH 10 NOVEMBER 2017 About KnetMiner KnetMiner, with a silent "K" and standing for Knowledge Network Miner, is a suite of open-source software
Transgenic Plants Model Answers
Transgenic Plants Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 7 Transgenic plants are the ones, whose DNA is modified using genetic engineering techniques.
CollecTF Documentation
CollecTF Documentation Release 1.0.0 Sefa Kilic August 15, 2016 Contents 1 Curation submission guide 3 1.1 Data.................................................... 3 1.2 Before you start.............................................
Genome Annotation. What Does Annotation Describe??? Genome duplications Genes Mobile genetic elements Small repeats Genetic diversity
Genome Annotation Genome Sequencing Costliest aspect of sequencing the genome o But Devoid of content Genome must be annotated o Annotation definition Analyzing the raw sequence of a genome and describing
srnas of Plants Function o Transcriptional silencing o Posttranscriptional gene silencing
srnas of Plants Small, Non-coding RNAs of Plants Regulatory RNAs that act through gene silencing Two classes of small RNAs (srnas) o microrna (mirnas) Encoded by mirna genes in the genome o small interfering
Evaluation of new synthetic compounds to control Candidatus Liberibacter asiaticus
Evaluation of new synthetic compounds to control Candidatus Liberibacter asiaticus V INTERNATIONAL SYMPOSIUM ON TROPICAL AND SUBTROPICAL FRUIT GROWING / IX INTERNATIONAL PINEAPPLE SYMPOSIUM "FRUTICULTURA
Machine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
Identification and functional modelling of DNA sequence elements of transcription
Thomas Werner joined the GSF National Research Center for Environment and Health in 1986. He has been head of the AG BIODV (bioinformatics group) at GSF since 1988. In 1997 he founded Genomatix software
Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
DEPARTMENT OF BIOCHEMISTRY & MOLECULAR BIOLOGY UNDERGRADUATE POSTER SESSION. Abstract Poster Presentations
DEPARTMENT OF BIOCHEMISTRY & MOLECULAR BIOLOGY UNDERGRADUATE POSTER SESSION Abstract Poster Presentations Thursday, April 1, 2004 Atrium, Biomedical & Physical Sciences Building 3:00 5:00 p.m. Posters
Discovering gene regulatory control using ChIP-chip and ChIP-seq. An introduction to gene regulatory control, concepts and methodologies
Discovering gene regulatory control using ChIP-chip and ChIP-seq An introduction to gene regulatory control, concepts and methodologies Ian Simpson ian.simpson@.ed.ac.uk bit.ly/bio2_2012 The Central Dogma
BIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 21 no. 13 2005, pages 2933 2942 doi:10.1093/bioinformatics/bti473 Sequence analysis MatInspector and beyond: promoter analysis based on transcription factor binding sites
chondroitin sulfate (Td max. ~42 h) laminarin (Td max. ~47 h) mannose (Td max. ~34 h) time [h]
![chondroitin sulfate (Td max. ~42 h) laminarin (Td max. ~47 h) mannose (Td max. ~34 h) time [h]](/thumbs/94/121950038.jpg "chondroitin sulfate (Td max. ~42 h) laminarin (Td max. ~47 h) mannose (Td max. ~34 h) time [h]")
.4 chondroitin sulfate (Td max. ~42 h) laminarin (Td max. ~47 h) mannose (Td max. ~34 h) optical density (6 nm).3.2.1. 5 1 15 2 25 time [h] Supplementary Figure S1 Growth curves of Polaribacter sp. Hel1_33_49.
Transcription factor binding site prediction in vivo using DNA sequence and shape features
Transcription factor binding site prediction in vivo using DNA sequence and shape features Anthony Mathelier, Lin Yang, Tsu-Pei Chiu, Remo Rohs, and Wyeth Wasserman anthony.mathelier@gmail.com @AMathelier
Introduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
Applied Bioinformatics - Lecture 16: Transcriptomics
Applied Bioinformatics - Lecture 16: Transcriptomics David Hendrix Oregon State University Feb 15th 2016 Transcriptomics High-throughput Sequencing (deep sequencing) High-throughput sequencing (also
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
PromSearch: A Hybrid Approach to Human Core-Promoter Prediction
PromSearch: A Hybrid Approach to Human Core-Promoter Prediction Byoung-Hee Kim, Seong-Bae Park, and Byoung-Tak Zhang Biointelligence Laboratory, School of Computer Science and Engineering Seoul National
The role of homeodomain-leucine zipper class I transcription factors in the drought response of wheat. John Creighton Harris
The role of homeodomain-leucine zipper class I transcription factors in the drought response of wheat John Creighton Harris Thesis presented to fulfil the requirements for the degree of Doctor of Philosophy
Phenotypes and genebanks
the importance and challenges of phenotyping Plant Genetic Resources Theo van Hintum 20 pril 2016 Phenomenll COST Workshop, Copenhagen background plant genetic resources conservation why? global effort
Methoden zur Analyse von Transkriptionsfaktoren. Seminar: BCII, Lausen
Methoden zur Analyse von Transkriptionsfaktoren Seminar: BCII, Lausen Gene expression: from transcription to translation Orphanides G, Reinberg D.Cell. 2002 Feb 22;108(4):439-51. Schematic of a gene regulatory
Biology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
Hands-on Session 2: Obtaining Data from On-line Sources
Hands-on Session 2: Obtaining Data from On-line Sources Katherine St. John Lehman College and the Graduate Center City University of New York stjohn@lehman.cuny.edu Katherine St. John City University of
Degenerate site - twofold degenerate site - fourfold degenerate site
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
Nature Biotechnology: doi: /nbt.3943
Supplementary Figure 1. Distribution of sequence depth across the bacterial artificial chromosomes (BACs). The x-axis denotes the sequencing depth (X) of each BAC and y-axis denotes the number of BACs
Regional activities of SEEDNet WG for Industrial crops. PARTNER: Albania. SEEDNet Meeting, Tirana, Albania
Regional activities of SEEDNet WG for Industrial crops. PARTNER: Albania. SEEDNet Meeting, 15.12.Tirana, Albania Belul GIXHARI Albanian Gene Bank AGRICULTURAL UNIVERSITY of TIRANA ALBANIA gixharibelul@yahoo.com,
The TIGR Gene Indices: analysis of gene transcript sequences in highly sampled eukaryotic species
2001 Oxford University Press Nucleic Acids Research, 2001, Vol. 29, No. 1 159 164 The TIGR Gene Indices: analysis of gene transcript sequences in highly sampled eukaryotic species John Quackenbush*, Jennifer
Using mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR
Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known
Analysis of large deletions in human-chimp genomic alignments. Erika Kvikstad BioInformatics I December 14, 2004
Analysis of large deletions in human-chimp genomic alignments Erika Kvikstad BioInformatics I December 14, 2004 Outline Mutations, mutations, mutations Project overview Strategy: finding, classifying indels
TABLE OF CONTENTS. Acknowledgements Table of contents List of abbreviations Executive summary. Chapter 1: Introduction
TABLE OF CONTENTS Acknowledgements Table of contents List of abbreviations Executive summary Molecular aspects of drought tolerance Objectives and major results Tobacco Potatoes Cotton Maize Conclusion
Next-generation analysis of deep sequencing data: Bringing light into the black box of phage display experiments
Next-generation analysis of deep sequencing data: Bringing light into the black box of phage display experiments Dr. Michael Blank (CSO, AptaIT) Biologics 2015; Berlin 02-03 February 1 Accelerating in
Your name: BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07
BSCI410-LIU/Spring 2007 Homework #2 Due March 27 (Tu), 07 KEY 1. What are each of the following molecular markers? (Indicate (a) what they stand for; (b) the nature of the molecular polymorphism and (c)
Object Groups. SRI International Bioinformatics
Object Groups 1 SRI International Bioinformatics Object Groups Collect and save lists of genes, metabolites, pathways Transform, filter, and analyze them Share groups with colleagues Use groups in conjunction
CS273B: Deep learning for Genomics and Biomedicine
CS273B: Deep learning for Genomics and Biomedicine Lecture 2: Convolutional neural networks and applications to functional genomics 09/28/2016 Anshul Kundaje, James Zou, Serafim Batzoglou Outline Anatomy
Albino T-DNA tomato mutant reveals a key function of 1-deoxy-D-xylulose-5-phosphate synthase (DXS1) in plant development and survival
Albino T-DNA tomato mutant reveals a key function of 1-deoxy-D-xylulose-5-phosphate synthase (DXS1) in plant development and survival Manuel García-Alcázar 1,#, Estela Giménez 1,#, Benito Pineda 2, Carmen
Before starting, write your name on the top of each page Make sure you have all pages
Biology 105: Introduction to Genetics Name Student ID Before starting, write your name on the top of each page Make sure you have all pages You can use the back-side of the pages for scratch, but we will
Role of Cover Crops in Field Crop Nematode Management and Soil Health Enhancement
Role of Cover Crops in Field Crop Nematode Management and Soil Health Enhancement Fred Warner, Nematode Diagnostician Mark Sylvester, Field Crop Grower George Bird, Professor Presentation Overview - Cover
Cassava. Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing 4/19/2013
Monitoring transcriptional changes in cassava infected with South African cassava mosaic using next-generation sequencing Farhahna Allie University of the Witwatersrand Plant Biotechnology Laboratory ACGT
Characterization of Genes Related to Hyacinth Bulb Formation Induced by Low Temperature or ABA
Characterization of Genes Related to Hyacinth Bulb Formation Induced by Low Temperature or ABA Kaori Ii-Nagasuga Hiroshi Okubo Department of Vegetable and Floricultural Science Laboratory of Horticultural
APP Auckland University of Technology (AUT)
DECISION Date 21 December 2012 Application code Application type Applicant APP201149 To develop in containment genetically modified organisms under sections 40(1) and 42A of the Hazardous Substances and
Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER
FOR PHARMA & LIFE SCIENCES WHITEPAPER Getting to the Roots IMPROVING RUBBER TREE CROP PRODUCTION THROUGH MARKER-ASSISTED SELECTION OF TARGETED GENOME TYPES. Improving rubber tree crop production through
Molecular Light Switches for Plant Genes
The Plant Cell, Vol. 2, 369-378, May 1990 O 1990 American Society of Plant Physiologists Molecular Light Switches for Plant Genes Philip M. Gilmartin, Laura Sarokin, Johan Memelink, and Nam-Hai Chua Laboratory
Life Science Journal 2014;11(4) Cloning and Expression of Citrate Synthase Gene of Sinapis alba Under Drought Stress
Cloning and Expression of Citrate Synthase Gene of Sinapis alba Under Drought Stress Cai-peng Yue, Ning-ning Zhang, Li-ping An, Qing-dong Wang, Jin-yong Huang * School of Life Sciences, Zhengzhou University,
Motivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
user s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
Supplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
Supplemental Table S1. Gene co-expression analysis using HHT/ASFT (At5g41040) as the bait*
1 2 Supplemental Table S1. Gene co-expression analysis using HHT/ASFT (At5g41040) as the bait* 3 4 5 AGI ID R value GeneChip ID Annotation At5g41040 1.000 249289_at HXXXD-type acyl-transferase family protein