Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away
|
|
- Whitney Ferguson
- 6 years ago
- Views:
Transcription
1 Green Center Computational Core ChIP- Seq Pipeline, Just a Click Away Venkat Malladi Computational Biologist Computational Core Cecil H. and Ida Green Center for Reproductive Biology Science
2 Introduc<on to the Green Center Basic research in female reproductive biology, with a focus on signaling, gene regulation, and genome function. pregnancy parturition stem cells oncology inflammation Key areas: Chromatin structure and gene regulation Epigenetics Nuclear endpoints of cellular signaling pathways Genome organization and evolution DNA replication and repair
3 Who is in the Green Center? Associated with the Department of Obstetrics and Gynecology Consists of 9 main faculty/labs 20 associated faculty/labs Computational Core W. Lee Kraus, Ph.D., Director of the Green Center.
4 Role of the Computa<onal Core Consists of 4 Computational Biologists Analysis of Genomic Sequencing Data Responsibilities Data Quality assurance Perform basic analyses Work with investigator to perform integrative analyses Green Center Computation Team Anusha Nagari Tulip Nandu Venkat Malladi Aishwarya Gogate
5 Challenge: Variety of Assays Supported? ATAC-seq RNA-seq GRO-seq Modified from PLoS Biol 9- e ,2011 (M. Pazin)
6 What is ATAC- seq? Assay for transposase-accessible chromatin using Sequencing (ATAC-Seq): Genomic method that captures open chromatin sites. Buenrostro et al. ( 2013) Nature Methods
7 What is RNA- Seq? RNA Sequencing (RNA-Seq) : RNA-seq measures RNA abundance of mature RNA species in the cell. These experiments contribute to the understanding of how RNA-based mechanisms impact gene regulation. Types: Total RNA polya mrna (Long and short) shrna small RNA microrna polya depleted RNA
8 What is GRO- Seq? Global Run On Sequencing (GRO-Seq) : This is a genomic method that maps the position and orientation of all actively transcribing RNA polymerases. Transcription from all three RNA Polymerases is captured providing transcriptional profiles including: protein coding mrna long non-coding RNAs (lncrnas) enhancer RNAs (ernas) divergent transcription antisense transcription intergenic transcription in both annotated and unannotated regions of the genome. ERα Enhancer Annotated Annotated Intergenic Divergent Antisense Other Genic Hah et al. ( 2011) Cell
9 What is ChIP- Seq? Chromatin immunoprecipitation followed by Sequencing (ChIP-Seq): Identify the binding sites of chromatin-associated proteins. Categories: Transcription factor ChIP-Seq: proteins that associate with specific DNA sequences to influence the rate of transcription Histone ChIP-Seq: measure histone content of chromatin, specifically to the incorporation of particular posttranslational histone modifications in chromatin Park ( 2009) Nature Reviews
10 Considera<on of making a Pipeline 1. Who are the users 2. Define what the pipeline should deliver 3. Identify all input and output files 4. What QA/QC metrics should be available for users 5. Identify all software used in pipeline 6. Breakdown pipeline into discrete steps (based on deliverable files and metrics)
11 Users and Goals Users: Wet lab scientists (Grad Students/Post Docs) Computational Biologists in the Green Center Goals: Allow wet lab scientists to quickly assess the quality and explore their data Allow for easily reproducible analysis within the Green Center
12 Schema: ChIP- seq Pipeline QA Metrics QA Metrics FASTQ (SE/PE) Map bowtie2 BAM Remove Duplicates picard BAM Crosscorrelation Quality fastqc tagalign Fragment size QA Metrics bigwig Call Peaks macs2 narrow Peak
13 FASTQ: Quality Metrics FastQC Repor Summary Basic Statistics Per base sequence quality Per sequence quality scores Per base sequence content Per base GC content Basic Statistics Measure Value Filename HF_K9_GATCAG_L005_R1_001.fastq.gz File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences Filtered Sequences 0 Sequence length 50 %GC 42 Per Base Sequence Quality Per sequence GC content Per base N content Sequence Length Distribution Good quality calls Reasonable quality calls Sequence Duplication Levels Overrepresented sequences Poor quality calls Kmer Content
14 Alignment: Quality Metrics FASTQ File: DNA sequence Aligned File: DNA sequence + Genomic localization Alignment % = No. of aligned reads Total no. of raw reads * 100
15 Uniquely Mapped Reads: Quality Metrics Depth Number of uniquely mapping reads Library Complexity Non-Redundant Fraction (NRF) - Number of distinct uniquely mapping reads (i.e. after removing duplicates) / Total number of reads. PCR Bottlenecking Coefficient 1 (PBC1) PBC1=M1/M_DISTINCT where M1: number of genomic locations where exactly one read maps uniquely M_DISTINCT: number of distinct genomic locations to which some read maps uniquely PCR Bottlenecking Coefficient 2 (PBC2) PBC2= M1/M2 where M1: number of genomic locations where only one read maps uniquely M2: number of genomic locations where two reads map uniquely ENCODE Standards hpps:// standards/chip- seq/
16 Uniquely Mapped Reads: Quality Metrics (cont.) NRF Guidelines PBC1 Guidelines PBC2 Guidelines ENCODE Standards hpps:// standards/chip- seq/
17 Alignment: Quality Metrics Report Sample Information Raw reads Alignment % Control Replicate 1 28,259, % Control Replicate 2 28,892, % Sample 2 Replicate 1 23,239, % Sample 2 Replicate 2 25,637, % Sample 3 Replicate 1 22,713, % Sample 3 Replicate 2 20,419, % Sample 4 Replicate 1 22,617, % Sample 4 Replicate 2 20,068, %
18 Cross- correla<on: Quality Metrics Report Sample 1 Sample 2 R=0.99 R=0.99 R: Pearson correlation coefficient
19 Call Peaks: Quality Metrics Report 1. Peak calls for individual replicates 2. Overlapping peaks between the pooled pseudo replicates 3. Bigwig files (UCSC Genome Browser, IGV )
20 Call Peaks: Quality Metrics Report Visualizing signal tracks (Bigwig files) in UCSC Genome Browser: Franco et al (2015)
21 Working With BioHPC and Astrocyte
22 Crea<ng a Project Create New Project to run analysis
23 Adding Data Select Add Data to this Project...
24 ChIP- Seq Workflow ChIP-Input fastq files Sequence format ChIP TF or Histone fastq files Assembly
25 Run Time of ChIP- Seq Pipeline
26 Thank you! Questions?
Introduction to genome biology
Introduction to genome biology Lisa Stubbs We ve found most genes; but what about the rest of the genome? Genome size* 12 Mb 95 Mb 170 Mb 1500 Mb 2700 Mb 3200 Mb #coding genes ~7000 ~20000 ~14000 ~26000
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationMicroarray Gene Expression Analysis at CNIO
Microarray Gene Expression Analysis at CNIO Orlando Domínguez Genomics Unit Biotechnology Program, CNIO 8 May 2013 Workflow, from samples to Gene Expression data Experimental design user/gu/ubio Samples
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationFunctional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017
Functional Genomics Overview RORY STARK PRINCIPAL BIOINFORMATICS ANALYST CRUK CAMBRIDGE INSTITUTE 18 SEPTEMBER 2017 Agenda What is Functional Genomics? RNA Transcription/Gene Expression Measuring Gene
More informationData and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic
More informationLong and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationSanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
More informationIntroduction to the UCSC genome browser
Introduction to the UCSC genome browser Dominik Beck NHMRC Peter Doherty and CINSW ECR Fellow, Senior Lecturer Lowy Cancer Research Centre, UNSW and Centre for Health Technology, UTS SYDNEY NSW AUSTRALIA
More informationDecoding Chromatin States with Epigenome Data Advanced Topics in Computa8onal Genomics
Decoding Chromatin States with Epigenome Data 02-715 Advanced Topics in Computa8onal Genomics HMMs for Decoding Chromatin States Epigene8c modifica8ons of the genome have been associated with Establishing
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationWhat we ll do today. Types of stem cells. Do engineered ips and ES cells have. What genes are special in stem cells?
Do engineered ips and ES cells have similar molecular signatures? What we ll do today Research questions in stem cell biology Comparing expression and epigenetics in stem cells asuring gene expression
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationDo engineered ips and ES cells have similar molecular signatures?
Do engineered ips and ES cells have similar molecular signatures? Comparing expression and epigenetics in stem cells George Bell, Ph.D. Bioinformatics and Research Computing 2012 Spring Lecture Series
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationA step-by-step guide to ChIP-seq data analysis
A step-by-step guide to ChIP-seq data analysis December 03, 2014 Xi Chen, Ph.D. EMBL-European Bioinformatics Institute Wellcome Trust Sanger Institute Target audience Wet-lab biologists with no experience
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationFigure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
More informationIntroduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis. Jenny Wu
Introduction to Next Generation Sequencing (NGS) Data Analysis and Pathway Analysis Jenny Wu Outline Introduction to NGS data analysis in Cancer Genomics NGS applications in cancer research Typical NGS
More informationMulti-omics in biology: integration of omics techniques
31/07/17 Летняя школа по биоинформатике 2017 Multi-omics in biology: integration of omics techniques Konstantin Okonechnikov Division of Pediatric Neurooncology German Cancer Research Center (DKFZ) 2 Short
More informationRNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
More information2. Outline the levels of DNA packing in the eukaryotic nucleus below next to the diagram provided.
AP Biology Reading Packet 6- Molecular Genetics Part 2 Name Chapter 19: Eukaryotic Genomes 1. Define the following terms: a. Euchromatin b. Heterochromatin c. Nucleosome 2. Outline the levels of DNA packing
More informationPerm-seq: Mapping Protein-DNA Interactions in Segmental Duplication and Highly Repetitive Regions of Genomes with Prior- Enhanced Read Mapping
RESEARCH ARTICLE Perm-seq: Mapping Protein-DNA Interactions in Segmental Duplication and Highly Repetitive Regions of Genomes with Prior- Enhanced Read Mapping Xin Zeng 1,BoLi 2, Rene Welch 1, Constanza
More informationRNA-seq Data Analysis
Lecture 3. Clustering; Function/Pathway Enrichment analysis RNA-seq Data Analysis Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Lecture 1. Map RNA-seq read to genome Lecture
More informationBioinformatics of Transcriptional Regulation
Bioinformatics of Transcriptional Regulation Carl Herrmann IPMB & DKFZ c.herrmann@dkfz.de Wechselwirkung von Maßnahmen und Auswirkungen Einflussmöglichkeiten in einem Dialog From genes to active compounds
More informationRelationship of Gene s Types and Introns
Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution
More informationless sensitive than RNA-seq but more robust analysis pipelines expensive but quantitiatve standard but typically not high throughput
Chapter 11: Gene Expression The availability of an annotated genome sequence enables massively parallel analysis of gene expression. The expression of all genes in an organism can be measured in one experiment.
More informationCourse Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
More informationEcole de Bioinforma(que AVIESAN Roscoff 2014 GALAXY INITIATION. A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech
GALAXY INITIATION A. Lermine U900 Ins(tut Curie, INSERM, Mines ParisTech How does Next- Gen sequencing work? DNA fragmentation Size selection and clonal amplification Massive parallel sequencing ACCGTTTGCCG
More informationAutomated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep
Automated size selection of NEBNext Small RNA libraries with the Sage Pippin Prep DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING PROTEIN EXPRESSION &
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Origin use and efficiency are similar among WT, rrm3, pif1-m2, and pif1-m2; rrm3 strains. A. Analysis of fork progression around confirmed and likely origins (from cerevisiae.oridb.org).
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationAtelier Chip-Seq. Stéphanie Le Gras, IGBMC Strasbourg Violaine Saint-André, Institut Curie Paris Morgane Thomas-Chollier, ENS Paris
Atelier Chip-Seq Stéphanie Le Gras, IGBMC Strasbourg Violaine Saint-André, Institut Curie Paris Morgane Thomas-Chollier, ENS Paris École de bioinformatique AVIESAN-IFB 2017 Get connected to the server
More informationBiologists on the cloud
Biologists on the cloud our experiences using galaxy for next-gen sequencing analyses Karen Reddy, Johns Hopkins University School of Medicine Mo Heydarian, Johns Hopkins University School of Medicine
More informationRNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
More informationAP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
More informationChIP-seq analysis. adapted from J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant
ChIP-seq analysis adapted from J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant http://biow.sb-roscoff.fr/ecole_bioinfo/training_material/chip-seq/documents/presentation_chipseq.pdf A model
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationDNA Transcription. Dr Aliwaini
DNA Transcription 1 DNA Transcription-Introduction The synthesis of an RNA molecule from DNA is called Transcription. All eukaryotic cells have five major classes of RNA: ribosomal RNA (rrna), messenger
More informationIndex. E Electrophoretic Mobility Shift Assay (EMSA), 262 ENCODE project, 223, 224 European Nucleotide Archive (ENA), 34
A Alternative splicing computational analysis, 114 data processing, 106 experimental design, 114 isoform quantification AltAnalyze, 109 CuffDiff, 110 DEXSeq, 108 DiffSplice, 109 exon/transcript isoform,
More informationIPA Advanced Training Course
IPA Advanced Training Course Academia Sinica 2015 Oct Gene( 陳冠文 ) Supervisor and IPA certified analyst 1 Review for Introductory Training course Searching Building a Pathway Editing a Pathway for Publication
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationAnalysis of Microarray Data
Analysis of Microarray Data Lecture 3: Visualization and Functional Analysis George Bell, Ph.D. Senior Bioinformatics Scientist Bioinformatics and Research Computing Whitehead Institute Outline Review
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationChapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6
Chapter 1 Analysis of ChIP-Seq Data with Partek Genomics Suite 6.6 Overview ChIP-Sequencing technology (ChIP-Seq) uses high-throughput DNA sequencing to map protein-dna interactions across the entire genome.
More informationReference genomes and common file formats
Reference genomes and common file formats Overview Reference genomes and GRC Fasta and FastQ (unaligned sequences) SAM/BAM (aligned sequences) Summarized genomic features BED (genomic intervals) GFF/GTF
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationMOLECULAR BIOLOGY OF EUKARYOTES 2016 SYLLABUS
03-442 Lectures: MWF 9:30-10:20 a.m. Doherty Hall 2105 03-742 Advanced Discussion Section: Time and place to be announced Probably Mon 4-6 p.m. or 6-8p.m.? Once we establish who is taking the advanced
More informationRNA-Seq analysis using R: Differential expression and transcriptome assembly
RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification
More informationYou use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationDemo of mrna NGS Concluding Report
Demo of mrna NGS Concluding Report Project: Demo Report Customer: Dr. Demo Company/Institute: Exiqon AS Date: 09-Mar-2015 Performed by Exiqon A/S Company Reg.No.(CVR) 18 98 44 31 Skelstedet 16 DK-2950,
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationQuality assessment and control of sequence data. Naiara Rodríguez-Ezpeleta
Quality assessment and control of sequence data Naiara Rodríguez-Ezpeleta Workshop on Genomics 2014 Quality control is important Some of the artefacts/problems that can be detected with QC Sequencing Sequence
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More information2 Gene Technologies in Our Lives
CHAPTER 15 2 Gene Technologies in Our Lives SECTION Gene Technologies and Human Applications KEY IDEAS As you read this section, keep these questions in mind: For what purposes are genes and proteins manipulated?
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 1: Introduction into high-throughput
More informationIntroduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
More informationDe Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
More informationEuropean Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF)
Guideline for the submission of DNA sequences derived from genetically modified organisms and associated annotations within the framework of Directive 2001/18/EC and Regulation (EC) No 1829/2003 European
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationLecture 9 Controlling gene expression
Lecture 9 Controlling gene expression BIOLOGY Campbell, Reece and Mitchell Chapter 18 334- (352-356) Every cell in your body contains the same number of genes approximately 35, 000 DNA is wound around
More informationPost- sequencing quality evalua2on. or what to do when you get your reads from the sequencer
Post- sequencing quality evalua2on or what to do when you get your reads from the sequencer The fastq file contains informa2on about sequence and quality Read Iden(fier Sequence Quality Sources of Library
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationRNA spike-in controls & analysis methods for trustworthy genome-scale measurements
RNA spike-in controls & analysis methods for trustworthy genome-scale measurements Sarah A. Munro, Ph.D. Genome-Scale Measurements Group ABRF Meeting March 29, 2015 Overview External RNA Controls Consortium
More informationGenome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
More informationAnalysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
More informationIntroduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationPIP-seq. Cells. Permanganate ChIP-Seq
PIP-seq ells Formaldehyde Permanganate 5 Harvest Lyse Sonicate First dapter Ligation 3 3 5 hip Elute Reverse rosslinks Piperidine cleavage 5 3 3 5 Primer Extension Second dapter Ligation 5 3 3 5 Deep Sequencing
More informationDNA Microarray Technology
CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic
More informationNext-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX
Next-Generation Sequencing Gene Expression Analysis Using Agilent GeneSpring GX Technical Overview Introduction RNA Sequencing (RNA-Seq) is one of the most commonly used next-generation sequencing (NGS)
More informationEXECUTIVE SUMMARY GLOBAL GENOMICS AND BIOINFORMATICS RESEARCH INSTITUTE. May 24, 2017
EXECUTIVE SUMMARY GLOBAL GENOMICS AND BIOINFORMATICS RESEARCH INSTITUTE May 24, 2017 Introduction to the Institute Inova Health System Foundation ( Inova ), The Rector and Visitors of the University of
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More informationImpact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,
More informationRNA Structure and the Versatility of RNA. Mitesh Shrestha
RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis
More informationEnsembl Funcgen: A Database and API for Epigenomics and Gene Regulation Data.
Ensembl Funcgen: A Database and API for Epigenomics and Gene Regulation Data. Nathan Johnson Ensembl Regulation EBI is an Outstation of the European Molecular Biology Laboratory.! Workshop Overview http://www.ebi.ac.uk/~njohnson/courses/23.05.2013-
More informationChapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
More informationIntronic RNAs constitute the major fraction of the non-coding RNA in mammalian cells
Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Medicine Faculty Publications Medicine 9-24-2012 Intronic RNAs constitute the major fraction of the
More informationAnalysis of Biological Sequences SPH
Analysis of Biological Sequences SPH 140.638 swheelan@jhmi.edu nuts and bolts meet Tuesdays & Thursdays, 3:30-4:50 no exam; grade derived from 3-4 homework assignments plus a final project (open book,
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationGenome Annotation Genome annotation What is the function of each part of the genome? Where are the genes? What is the mrna sequence (transcription, splicing) What is the protein sequence? What does
More informationRIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP)
Application Note: RIPTIDE HIGH THROUGHPUT RAPID LIBRARY PREP (HT-RLP) Introduction: Innovations in DNA sequencing during the 21st century have revolutionized our ability to obtain nucleotide information
More informationscgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
More informationGene Expression and Heritable Phenotype. CBS520 Eric Nabity
Gene Expression and Heritable Phenotype CBS520 Eric Nabity DNA is Just the Beginning DNA was determined to be the genetic material, and the structure was identified as a (double stranded) double helix.
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationRecombinant DNA: Basics and Advanced Applications
Recombinant DNA: Basics and Advanced Applications 2015/2016 Code: 42895 ECTS Credits: 9 Degree Type Year Semester 4313794 Biochemistry, Molecular Biology and Biomedicine OT 0 A Contact Name: Antonio Casamayor
More information