ELE4120 Bioinformatics. Tutorial 5
|
|
- Jasper Stanley
- 6 years ago
- Views:
Transcription
1 ELE4120 Bioinformatics Tutorial 5 1
2 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2
3 Databases A common situation for alignment is to search through a database to retrieve the similar sequences. Common Databases: GenBank at the National Center for Biological Information(NCBI) RefSeq at NCBI TPA at NCBI UniProt 3
4 NCBI ( Established in 1988 as a National resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information - all for the better understanding of molecular processes affecting human health and diseases. 4
5 5
6 ------What is GenBank: 1.1 GenBank ( GenBank is the NIH genetic sequence database, with more than 20 millions sequences for now. 6
7 The complete release notes for the current version of GenBank are available on the NCBI ftp site. A new release is made every two months. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory (EMBL), and GenBank at NCBI. These three organizations exchange data on a daily basis Submissions to GenBank The WWW-based submission tool, called BankIt, for convenient and quick submission of sequence data. Sequin, NCBI's stand-alone submission software for 7
8 MAC, PC, and UNIX platforms, is available by FTP. When using Sequin, the output files for direct submission should be sent to GenBank by electronic mail Access to GenBank ( GenBank is available for searching at NCBI via several methods. Text and Similarity Searching Information about Access to GenBank 8
9 9
10 1.2 The Reference Sequence (RefSeq) ( Refseq collection aims to provide a comprehensive, integrated, non-redundant set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a baseline for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses. 10
11 11
12 12
13 1.3 Third Party Annotation Sequence Database ( TPA: A database designed to capture experimental or inferential results that support submitter-provided annotation for sequence data that the submitter did not directly determine but derived from GenBank primary data. TPA records are divided into two categories: TPA:experimental: Annotation of sequence data is supported by peer-reviewed wet-lab experimental evidence. TPA:inferential: Annotation of sequence data by inference (where the source 13
14 molecule or its product(s) have not been the subject of direct experimentation). 14
15 1.4 UniProt UniProt (Universal Protein Resource) is the world's most comprehensive catalog of information on proteins. It is a central repository of protein sequence and function created by joining the information contained in Swiss-Prot, TrEMBL, and PIR. UniProt has three parts, each optimized for different uses. The UniProt Knowledgebase (UniProtKB) is the central access point for extensive curated protein information, including function, classification, and cross-reference. The UniProt Reference Clusters (UniRef) databases combine closely related sequences into a single record to speed searches. The UniProt Archive (UniParc) is a comprehensive repository, reflecting the history of all protein sequences. 15
16 16
17 17
18 2. Database Searches GenBank database with more than 20 millions sequences at NCBI Compare a new found gene with similar sequences in database might give us an idea about the new found gene 18
19 Searching sequences that align well with our sequence by calculating its alignment with each sequence in database needs long execution time Many database search algorithm are used instead of alignment scores BLAST, FASTA Fast Not guaranteed to be best match, but with high probability that the return sequences are well aligned with our query sequence 19
20 BLAST algorithm Basic Local Alignment Search Tool Original BLAST searches a sequence from the database for maximal ungapped local alignments For protein or nucleotide sequences Many members of the BLAST family E.g. BLASTP, BLASTN, BLASTX 20
21 21
Types of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationProtein Bioinformatics Part I: Access to information
Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationTwo Mark question and Answers
1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three
More informationGene-centered resources at NCBI
COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving
More informationSequence Databases and database scanning
Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationThe patent examination process: Different approaches to searching at the USPTO
The patent examination process: Different approaches to searching at the USPTO Jackie Cheng Supervisory Patent Examiner Technology Center 3700 Sue Liu Supervisory Patent Examiner Technology Center 1600
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationPROTEOINFORMATICS OVERVIEW
PROTEOINFORMATICS OVERVIEW August 11th 2016 Pratik Jagtap Center for Mass Spectrometry and Proteomics http://www.cbs.umn.edu/msp Outline PROTEOMICS WORKFLOW PEAKLIST PROCESSING Search Databases Overview
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationProduct Applications for the Sequence Analysis Collection
Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a
More informationCompiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology
Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four
More informationI nternet Resources for Bioinformatics Data and Tools
~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.
More informationMaking Sense of DNA and Protein Sequences. Lily Wang, PhD Department of Biostatistics Vanderbilt University
Making Sense of DNA and Protein Sequences Lily Wang, PhD Department of Biostatistics Vanderbilt University 1 Outline Biological background Major biological sequence databanks Basic concepts in sequence
More informationIntroduction to BIOINFORMATICS
Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What
More informationSince 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL
Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality
More informationIntroduc)on to Databases and Resources Biological Databases and Resources
Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationBasic Bioinformatics: Homology, Sequence Alignment,
Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationIntroduction on Several Popular Nucleic Acids Databases
Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological
More informationThis software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationThe Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro
Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation
More informationLast Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background
More informationFUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
More informationGenome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita
Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing
More informationThis practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.
PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,
More informationSequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases
Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around
More informationDownload the Lectin sequence output from
Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).
More informationAgenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence
Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase
More informationSequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned
More informationBioinformatics Course AA 2017/2018 Tutorial 2
UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it
More informationBioinformatics to chemistry to therapy: Some case studies deriving information from the literature
Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:
More informationBioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases
Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationBIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology
BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationG4120: Introduction to Computational Biology
G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationSequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1
Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationBIMM 143: Introduction to Bioinformatics (Winter 2018)
BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST
More informationFiles for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]
BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web
More informationONLINE BIOINFORMATICS RESOURCES
Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationBiological databases an introduction
Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the
More informationKorilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions
KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationGenetics and Bioinformatics
Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s
More informationBioinformatics Databases
Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda
More informationNUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.
NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2
More informationIntroduction to 'Omics and Bioinformatics
Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationB I O I N F O R M A T I C S
B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What
More informationBioinformatics, in general, deals with the following important biological data:
Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationTutorial for Stop codon reassignment in the wild
Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming
More informationAccess to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
More informationAn Introduction to Bioinformatics for Biological Sciences Students
An Introduction to Bioinformatics for Biological Sciences Students Department of Microbiology and Immunology, McGill University Version 2.5 (For the BIOC-300 lab), March 2006 2 AN INTRODUCTION TO BIOINFORMATICS
More informationHC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) HC70AL Spring 2004 An Introduction to Bioinformatics -- Part I By Brandon Le April 6, 2004 What is a Gene? An ordered sequence of nucleotides What are the 4
More informationWhat s New for School Year in Phage Genome Annotation
Phagehunting Program What s New for School Year 2013-14 in Phage Genome Annotation Created by DJS December, 2013. The purpose of this document is to target the most prominent changes and/or updates to
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More informationBrowsing Genomes with Ensembl Genomes
Browsing Genomes with Ensembl Genomes www.ensemblgenomes.org Coursebook http://www.ebi.ac.uk/~blaise/beca BECA- ILRI 16 th October 2013 Chat room: http://tinyurl.com/ensembl-nairobi TABLE OF CONTENTS Introduction
More informationBrowsing Genes and Genomes with Ensembl
Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationab initio and Evidence-Based Gene Finding
ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene
More informationBLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationGlobal Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource
Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information
More informationGetting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER
FOR PHARMA & LIFE SCIENCES WHITEPAPER Getting to the Roots IMPROVING RUBBER TREE CROP PRODUCTION THROUGH MARKER-ASSISTED SELECTION OF TARGETED GENOME TYPES. Improving rubber tree crop production through
More informationGrundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1
More informationWhat is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?
APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon
More informationExercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
More informationWeb-based Bioinformatics Applications in Proteomics
Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed
More informationBioinformatics for Cell Biologists
Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationAnnotation. (Chapter 8)
Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store
More informationWill discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice
Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice integration - web system (V) 1 Touring the Protein Space (outline) 1. Protein Sequence - how rich? How
More informationIntroduction to NGS analyses
Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationIntroduction to Sequencher. Tom Randall Center for Bioinformatics
Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing
More informationFACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE
FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)
More informationPRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5
Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate
More informationA Field Guide to GenBank and NCBI Molecular Biology Resources
A Field Guide to GenBank and NCBI Molecular Biology Resources slightly modified from Peter Cooper ftp://ftp.ncbi.nih.gov/pub/cooper/fieldguide/ Eric Sayers ftp://ftp.ncbi.nih.gov/pub/sayers/field_guide/u_penn/
More informationIntroduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?
More informationA White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment
A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment I. Abstract: The three- year SCan- MarK Explorer Phase I and II NCI Small Business Innovation Research (SBIR) Project
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationAnnotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?
More information