ELE4120 Bioinformatics. Tutorial 5

Size: px
Start display at page:

Download "ELE4120 Bioinformatics. Tutorial 5"

Transcription

1 ELE4120 Bioinformatics Tutorial 5 1

2 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2

3 Databases A common situation for alignment is to search through a database to retrieve the similar sequences. Common Databases: GenBank at the National Center for Biological Information(NCBI) RefSeq at NCBI TPA at NCBI UniProt 3

4 NCBI ( Established in 1988 as a National resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information - all for the better understanding of molecular processes affecting human health and diseases. 4

5 5

6 ------What is GenBank: 1.1 GenBank ( GenBank is the NIH genetic sequence database, with more than 20 millions sequences for now. 6

7 The complete release notes for the current version of GenBank are available on the NCBI ftp site. A new release is made every two months. GenBank is part of the International Nucleotide Sequence Database Collaboration, which comprises the DNA DataBank of Japan (DDBJ), the European Molecular Biology Laboratory (EMBL), and GenBank at NCBI. These three organizations exchange data on a daily basis Submissions to GenBank The WWW-based submission tool, called BankIt, for convenient and quick submission of sequence data. Sequin, NCBI's stand-alone submission software for 7

8 MAC, PC, and UNIX platforms, is available by FTP. When using Sequin, the output files for direct submission should be sent to GenBank by electronic mail Access to GenBank ( GenBank is available for searching at NCBI via several methods. Text and Similarity Searching Information about Access to GenBank 8

9 9

10 1.2 The Reference Sequence (RefSeq) ( Refseq collection aims to provide a comprehensive, integrated, non-redundant set of sequences, including genomic DNA, transcript (RNA), and protein products. RefSeq is a baseline for medical, functional, and diversity studies; they provide a stable reference for genome annotation, gene identification and characterization, mutation and polymorphism analysis, expression studies, and comparative analyses. 10

11 11

12 12

13 1.3 Third Party Annotation Sequence Database ( TPA: A database designed to capture experimental or inferential results that support submitter-provided annotation for sequence data that the submitter did not directly determine but derived from GenBank primary data. TPA records are divided into two categories: TPA:experimental: Annotation of sequence data is supported by peer-reviewed wet-lab experimental evidence. TPA:inferential: Annotation of sequence data by inference (where the source 13

14 molecule or its product(s) have not been the subject of direct experimentation). 14

15 1.4 UniProt UniProt (Universal Protein Resource) is the world's most comprehensive catalog of information on proteins. It is a central repository of protein sequence and function created by joining the information contained in Swiss-Prot, TrEMBL, and PIR. UniProt has three parts, each optimized for different uses. The UniProt Knowledgebase (UniProtKB) is the central access point for extensive curated protein information, including function, classification, and cross-reference. The UniProt Reference Clusters (UniRef) databases combine closely related sequences into a single record to speed searches. The UniProt Archive (UniParc) is a comprehensive repository, reflecting the history of all protein sequences. 15

16 16

17 17

18 2. Database Searches GenBank database with more than 20 millions sequences at NCBI Compare a new found gene with similar sequences in database might give us an idea about the new found gene 18

19 Searching sequences that align well with our sequence by calculating its alignment with each sequence in database needs long execution time Many database search algorithm are used instead of alignment scores BLAST, FASTA Fast Not guaranteed to be best match, but with high probability that the return sequences are well aligned with our query sequence 19

20 BLAST algorithm Basic Local Alignment Search Tool Original BLAST searches a sequence from the database for maximal ungapped local alignments For protein or nucleotide sequences Many members of the BLAST family E.g. BLASTP, BLASTN, BLASTX 20

21 21

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

The patent examination process: Different approaches to searching at the USPTO

The patent examination process: Different approaches to searching at the USPTO The patent examination process: Different approaches to searching at the USPTO Jackie Cheng Supervisory Patent Examiner Technology Center 3700 Sue Liu Supervisory Patent Examiner Technology Center 1600

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

PROTEOINFORMATICS OVERVIEW

PROTEOINFORMATICS OVERVIEW PROTEOINFORMATICS OVERVIEW August 11th 2016 Pratik Jagtap Center for Mass Spectrometry and Proteomics http://www.cbs.umn.edu/msp Outline PROTEOMICS WORKFLOW PEAKLIST PROCESSING Search Databases Overview

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

Making Sense of DNA and Protein Sequences. Lily Wang, PhD Department of Biostatistics Vanderbilt University

Making Sense of DNA and Protein Sequences. Lily Wang, PhD Department of Biostatistics Vanderbilt University Making Sense of DNA and Protein Sequences Lily Wang, PhD Department of Biostatistics Vanderbilt University 1 Outline Biological background Major biological sequence databanks Basic concepts in sequence

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Basic Bioinformatics: Homology, Sequence Alignment,

Basic Bioinformatics: Homology, Sequence Alignment, Basic Bioinformatics: Homology, Sequence Alignment, and BLAST William S. Sanders Institute for Genomics, Biocomputing, and Biotechnology (IGBB) High Performance Computing Collaboratory (HPC 2 ) Mississippi

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Introduction on Several Popular Nucleic Acids Databases

Introduction on Several Popular Nucleic Acids Databases Introduction on Several Popular Nucleic Acids Databases Changmin Liao Library, China West Normal University, Nanchong City, P. R. liaochangminlxh@yahoo.com.cn Abstract-Nucleic acids are major biological

More information

This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part

This software/database/presentation is a United States Government Work under the terms of the United States Copyright Act. It was written as part This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government

More information

Databases in genomics

Databases in genomics Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases

More information

Data Retrieval from GenBank

Data Retrieval from GenBank Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation

More information

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST

Last Update: 12/31/2017. Recommended Background Tutorial: An Introduction to NCBI BLAST BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by T. Cordonnier, C. Shaffer, W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Recommended Background

More information

FUNCTIONAL BIOINFORMATICS

FUNCTIONAL BIOINFORMATICS Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.

More information

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing

More information

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries. PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,

More information

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases

Sequence Databases. Chapter 2. caister.com/bioinformaticsbooks. Paul Rangel. Sequence Databases Chapter 2 Paul Rangel Abstract DNA and Protein sequence databases are the cornerstone of bioinformatics research. DNA databases such as GenBank and EMBL accept genome data from sequencing projects around

More information

Download the Lectin sequence output from

Download the Lectin sequence output from Computer Analysis of DNA and Protein Sequences Over the Internet Part I. IN CLASS Download the Lectin sequence output from http://stan.cropsci.uiuc.edu/courses/cpsc265/ Open these in BioEdit (free software).

More information

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence

Agenda. Web Databases for Drosophila. Gene annotation workflow. GEP Drosophila annotation projects 01/01/2018. Annotation adding labels to a sequence Agenda GEP annotation project overview Web Databases for Drosophila An introduction to web tools, databases and NCBI BLAST Web databases for Drosophila annotation UCSC Genome Browser NCBI / BLAST FlyBase

More information

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University

Sequence Based Function Annotation. Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Usage scenarios for sequence based function annotation Function prediction of newly cloned

More information

Bioinformatics Course AA 2017/2018 Tutorial 2

Bioinformatics Course AA 2017/2018 Tutorial 2 UNIVERSITÀ DEGLI STUDI DI PAVIA - FACOLTÀ DI SCIENZE MM.FF.NN. - LM MOLECULAR BIOLOGY AND GENETICS Bioinformatics Course AA 2017/2018 Tutorial 2 Anna Maria Floriano annamaria.floriano01@universitadipavia.it

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University

Annotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases

Outline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

More information

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)

Genome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M) Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.

More information

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology

BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology BIO4342 Lab Exercise: Detecting and Interpreting Genetic Homology Jeremy Buhler March 15, 2004 In this lab, we ll annotate an interesting piece of the D. melanogaster genome. Along the way, you ll get

More information

COMPUTER RESOURCES II:

COMPUTER RESOURCES II: COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

Why learn sequence database searching? Searching Molecular Databases with BLAST

Why learn sequence database searching? Searching Molecular Databases with BLAST Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results

More information

Sequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1

Sequence Analysis. BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI MAY P. Benos 1 Sequence Analysis (part III) BBSI 2006: Lecture #(χ+3) Takis Benos (2006) BBSI 2006 31-MAY-2006 2006 P. Benos 1 Outline Sequence variation Distance measures Scoring matrices Pairwise alignments (global,

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz]

Files for this Tutorial: All files needed for this tutorial are compressed into a single archive: [BLAST_Intro.tar.gz] BLAST Exercise: Detecting and Interpreting Genetic Homology Adapted by W. Leung and SCR Elgin from Detecting and Interpreting Genetic Homology by Dr. J. Buhler Prequisites: None Resources: The BLAST web

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP

BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in

More information

Biological databases an introduction

Biological databases an introduction Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the

More information

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions

Korilog. high-performance sequence similarity search tool & integration with KNIME platform. Patrick Durand, PhD, CEO. BIOINFORMATICS Solutions KLAST high-performance sequence similarity search tool & integration with KNIME platform Patrick Durand, PhD, CEO Sequence analysis big challenge DNA sequence... Context 1. Modern sequencers produce huge

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

Bioinformatics Databases

Bioinformatics Databases Bioinformatics Databases Dr. Taysir Hassan Abdel Hamid Lecturer, Information Systems Department Faculty of Computer and Information Assiut University taysirhs@aun.edu.eg taysir_soliman@hotmail.com Agenda

More information

NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.

NUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

Bioinformatics, in general, deals with the following important biological data:

Bioinformatics, in general, deals with the following important biological data: Pocket K No. 23 Bioinformatics for Plant Biotechnology Introduction As of July 30, 2006, scientists around the world are pursuing a total of 2,126 genome projects. There are 405 published complete genomes,

More information

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine

Bioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will

More information

Tutorial for Stop codon reassignment in the wild

Tutorial for Stop codon reassignment in the wild Tutorial for Stop codon reassignment in the wild Learning Objectives This tutorial has two learning objectives: 1. Finding evidence of stop codon reassignment on DNA fragments. 2. Detecting and confirming

More information

Access to Information from Molecular Biology and Genome Research

Access to Information from Molecular Biology and Genome Research Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is

More information

An Introduction to Bioinformatics for Biological Sciences Students

An Introduction to Bioinformatics for Biological Sciences Students An Introduction to Bioinformatics for Biological Sciences Students Department of Microbiology and Immunology, McGill University Version 2.5 (For the BIOC-300 lab), March 2006 2 AN INTRODUCTION TO BIOINFORMATICS

More information

HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides

HC70AL Spring An Introduction to Bioinformatics -- Part I. Brandon Le. April 6, What is a Gene? An ordered sequence of nucleotides APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) HC70AL Spring 2004 An Introduction to Bioinformatics -- Part I By Brandon Le April 6, 2004 What is a Gene? An ordered sequence of nucleotides What are the 4

More information

What s New for School Year in Phage Genome Annotation

What s New for School Year in Phage Genome Annotation Phagehunting Program What s New for School Year 2013-14 in Phage Genome Annotation Created by DJS December, 2013. The purpose of this document is to target the most prominent changes and/or updates to

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology

More information

Browsing Genomes with Ensembl Genomes

Browsing Genomes with Ensembl Genomes Browsing Genomes with Ensembl Genomes www.ensemblgenomes.org Coursebook http://www.ebi.ac.uk/~blaise/beca BECA- ILRI 16 th October 2013 Chat room: http://tinyurl.com/ensembl-nairobi TABLE OF CONTENTS Introduction

More information

Browsing Genes and Genomes with Ensembl

Browsing Genes and Genomes with Ensembl Browsing Genes and Genomes with Ensembl Emily Perry Ensembl Outreach Project Leader EMBL-EBI Objectives What is Ensembl? What type of data can you get in Ensembl? How to navigate the Ensembl browser website.

More information

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of

More information

ab initio and Evidence-Based Gene Finding

ab initio and Evidence-Based Gene Finding ab initio and Evidence-Based Gene Finding A basic introduction to annotation Outline What is annotation? ab initio gene finding Genome databases on the web Basics of the UCSC browser Evidence-based gene

More information

BLASTing through the kingdom of life

BLASTing through the kingdom of life Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information

More information

Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER

Getting to the Roots FOR PHARMA & LIFE SCIENCES WHITEPAPER FOR PHARMA & LIFE SCIENCES WHITEPAPER Getting to the Roots IMPROVING RUBBER TREE CROP PRODUCTION THROUGH MARKER-ASSISTED SELECTION OF TARGETED GENOME TYPES. Improving rubber tree crop production through

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA?

What is a Gene? HC70AL Spring An Introduction to Bioinformatics -- Part I. What are the 4 Nucleotides By in DNA? APPENDIX 2 - BIOINFORMATICS (PARTS I AND II) What is a Gene? HC70AL Spring 2004 An ordered sequence of nucleotides An Introduction to Bioinformatics -- Part I What are the 4 Nucleotides By in DNA? Brandon

More information

Exercise I, Sequence Analysis

Exercise I, Sequence Analysis Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt

More information

Web-based Bioinformatics Applications in Proteomics

Web-based Bioinformatics Applications in Proteomics Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice

Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice Will discuss proteins in view of Sequence (I,II) Structure (III) Function (IV) proteins in practice integration - web system (V) 1 Touring the Protein Space (outline) 1. Protein Sequence - how rich? How

More information

Introduction to NGS analyses

Introduction to NGS analyses Introduction to NGS analyses Giorgio L Papadopoulos Institute of Molecular Biology and Biotechnology Bioinformatics Support Group 04/12/2015 Papadopoulos GL (IMBB, FORTH) IMBB NGS Seminar 04/12/2015 1

More information

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1

Comparative Bioinformatics. BSCI348S Fall 2003 Midterm 1 BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to

More information

Introduction to Sequencher. Tom Randall Center for Bioinformatics

Introduction to Sequencher. Tom Randall Center for Bioinformatics Introduction to Sequencher Tom Randall Center for Bioinformatics tarandal@email.unc.edu Introduction Importing, viewing and manipulating chromatographs Trimming chromatographs Assembly into contigs Editing

More information

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE

FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE FACULTY OF BIOCHEMISTRY AND MOLECULAR MEDICINE BIOMOLECULES COURSE: COMPUTER PRACTICAL 1 Author of the exercise: Prof. Lloyd Ruddock Edited by Dr. Leila Tajedin 2017-2018 Assistant: Leila Tajedin (leila.tajedin@oulu.fi)

More information

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5

PRESENTING SEQUENCES 5 GAATGCGGCTTAGACTGGTACGATGGAAC 3 3 CTTACGCCGAATCTGACCATGCTACCTTG 5 Molecular Biology-2017 1 PRESENTING SEQUENCES As you know, sequences may either be double stranded or single stranded and have a polarity described as 5 and 3. The 5 end always contains a free phosphate

More information

A Field Guide to GenBank and NCBI Molecular Biology Resources

A Field Guide to GenBank and NCBI Molecular Biology Resources A Field Guide to GenBank and NCBI Molecular Biology Resources slightly modified from Peter Cooper ftp://ftp.ncbi.nih.gov/pub/cooper/fieldguide/ Eric Sayers ftp://ftp.ncbi.nih.gov/pub/sayers/field_guide/u_penn/

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment

A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment A White Paper on SCan- MarK Explorer The Sophic Cancer Biomarker Knowledge Environment I. Abstract: The three- year SCan- MarK Explorer Phase I and II NCI Small Business Innovation Research (SBIR) Project

More information

BIOINFORMATICS IN BIOCHEMISTRY

BIOINFORMATICS IN BIOCHEMISTRY BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and

More information

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station

Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station Annotation and the analysis of annotation terms. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Library preparation Sequencing Hypothesis testing Bioinformatics 2 Why annotate?

More information