Access to Information from Molecular Biology and Genome Research

Size: px
Start display at page:

Download "Access to Information from Molecular Biology and Genome Research"

Transcription

1 Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005

2 User Community for this information is large and varied All biologists of every persuasion! Biomedicine, zoology, botany, genetics, phylogeny, physiology, ecology, biochemistry, biodiversity Academics, pharma, biotechnology Health, diagnostics, patents, agriculture, foods, agrochemicals, forestry, agriculture, brewing, fisheries Very large numbers of users

3 2,000,000 1,800,000 1,600,000 e.g. USAGE of EBI s WEB SITE Hits Including Ensembl 1,400,000 1,200, million hits/day 1,000, , ,000 20,000 distinct users/month 400, , st 99 2nd 99 3rd 99 4th 99 1st 00 2nd 00 3rd 00 4th 00 1st 01 2nd 01 3rd 01 4th 01 1st 02 2nd 02 3rd 02 4th 02 1st 03 2nd 03 3rd 03 4th 03 1st 04 2nd 04 3rd 04 4th 04

4 Four Aspects of Bioinformatics Infrastructures Standards Data Bases collect, curate and archive experimental data and re-distribute (core & specialist) Annotations (manual & automated) Search & Retrieval Tools and Services Most Data Resources are involved in all 4 aspects

5 Standards & Ontologies For exchange and integration of any data defined Standards and Ontologies are necessary This usually involves whole community in discussions/negotiations, with data providers taking the lead All large data resources have well defined standards and ontologies, which evolve with time for example Genes Gene Ontology Structures mmcif Expression Data MIAME Proteomic Data PSI Metabolome Data in progress Systems Biology - SBML

6 Data Resources For molecular biology and genome research it is possible to define 3 key distinct types of data resources: Core Resources Model Organism Resources Specialist Resources

7 What defines a Core Data Resource? Some combination of the following: Data Collection and curation Collects experimental data from public (now often HTP) Comprehensive In public domain Designated site for data collection agreed by community Curates collected data into archive Provides searchable archive Journal Agreement to require submission of data International Collaboration, involving regular exchange of data 24/7 service Maturity & Stability (of data and resource!) High usage

8 Global Context For example: EMBL/DDBJ/NCBI wwpdb: RCSB/PDB j /MSD UniProt: EBI/SIB/PIR Europe USA Japan

9 Core Molecular Biology Data Resources in Europe EMBL-Bank DNA sequences Reactome Array-Express Microarray Expression Data UniProt Protein Sequences Ensembl Genome Annotation IntAct Protein Interactions MSD Macromolecular Structure Data

10 Core Molecular Biology Data Resources in Europe EMBL-Bank DNA sequences Reactome Array-Express Microarray Expression Data UniProt Protein Sequences Ensembl Genome Annotation IntAct Proteomics & Interactions MSD Macromolecular Structure Data Funded in part by EU

11 Model Organism Data Resources FlyBase - Drosophila Wormbase - c elegans MGD mouse YPD - Yeast Human? Arabidopsis (UK & US) Most funded by US government

12 Other Molecular Data Resources (Non-core/Specialist) These data resources have some or all of the following characteristics: Based on Core Data Resources Confined to one laboratory or small group of individuals Do not collect data from external laboratories Small Computationally derived data Less mature & stable No commitment to be comprehensive No explicit commitment to community (e.g. standards) More specialised (e.g. one protein family)

13 Molecular Biology Database Collection Galperin (2005) NAR 33 D5-D databases listed (+171 since last year!) 14 major categories ~ 30% in Europe First databases this year from Estonia, Greece, Hungary, Turkey, Malaysia, Taiwan, Brazil & Cuba

14 Annotations (Manual & Automated) Manual Annotations within Core Data Resources (e.g. UniProt) Third Party Annotations in Core Data Resources Established mechanisms to allow experimentalists/theoreticians to enter their own annotations in core data resources e.g. EMBL; Distributed Annotations via DAS (Ensembl) EU Network of Excellence for Genome Annotation - BioSapiens Virtual Institute for Genome Annotation i.e. Distributed 26 Contractors/ 14 countries mainly expert bioinformatics laboratories Based on core reference sequence/structure data Develops new tools for annotations Automated Distributed compute (clients and servers)

15 Data Processing, Search & Retrieval Tools Search and Retrieval Systems within Core Data Resources e.g. MSD Many Laboratories develop novel search and retrieval tools for sequences and structures EU Network of Excellence EMBRACE Data Integration Development of tools and programming interfaces to exploit information Tracking and exploiting novel IT/GRID developments

16 Current status of Bioinformatics in Europe: Infrastructure Funding I: EU Currently limited funding for Bioinformatics under Research Infrastructures Action EuroCarbDB Design Study Felics I3 (just submitted to FP6 by EBI/SIB/EPO/Uni Koln) FP6 TEMBLOR under Quality of Life Programme major grant to EBI & partners ( 20 million for 3 years) Funds MSD; ArrayExpress, IntAct [finishing June 2005] EMBnet 26 nodes through Europe many now closed Networks of Excellence BioSapiens Genome Annotations ( 12 million for 5 years) EMBRACE Search & Retrieval Tools ( 8 million for 5 years) Many other research grants with small informatics component

17 Current status of Bioinformatics in Europe: Infrastructure Funding II: EMBL EMBL funds 8 meuros pa for Core Molecular Data Resources at EBI

18 Current status of Bioinformatics in Europe: Infrastructure Funding: National National Funding - To my knowledge there is no national funding for core bioinformatics data resources (except Arabidopsis) One-off grants for specialist data resources awarded to individuals Some National search & training facilities in Europe :- UK CCP11 Collaborative Computing Programme to foster Bioinformatics (software collection - EMBOSS) UK MRC Rosalind Franklin Centre for Genomic Research (closing July) UK escience efforts GRID research (mainly middleware) French Genopoles (attached to experimental labs) German NBCC Bioinformatik-Zentrum in Deutschland & HNB - Helmholtz Network Bioinformatics Swiss Institute of Bioinformatics (SIB & ISB) Finnish CSC (Supercomputer Centre) - provides life-sciences services & support..

19 Challenge Funding Services provided by the Core Resources Bioinformatics is international Core resources are used by everyone Who should pay? National countries do not want to take responsibility for an international effort US has been very pro-active supporting public data resources and making data freely available to all through web therefore commercial solution is not available option EU to date has only funded new projects EMBL provides core funding but limited budget

20 US Bioinformatics Infrastructure Funding Infrastructure for data resources supported by Rolling Funding provided to government laboratories & designated core resources NCBI (for Genbank; Entrez; Omim) UniProt (inc PIR) RCSB (for PDB) Bioinformatics Infrastructure for Large-Scale Analyses (National Partnership for Advanced Computational Infrastructure NPACI)

21 Future Needs:From Molecules, to Cell, to Organisms, to Physiology p53 tumoursuppressor Genome Protein Cell Embryo Fruitfly Mouse Human Development, Ageing Disease

22 Needs for future Service Providers To fulfil these demands Service Providers need: Support for Core Resources To handle data explosion more data - better resources new data - new standards & resources mechanism to identify and support new core resources as they are needed To link to model organism data resources and specialist resources To link to related discipline data resources To Integrate Data for Systems Biology To enhance services to provide easier, quicker access to data, incorporating advances in GRID technologies Adequate virtual environment and installation equipment, systems administration and DBAs to serve data to community To provide scientific and technical support to run data resources & to provide training Cont.

23 Needs for future Service Providers (cont) Support for Specialist resources Coordination of Specialist Resources Links to Core Resources Mechanism to evolve into Core Resource, if appropriate Support for Distributed Annotation Support for Distributed Software Libraries & Coordinated Web Services

24 Proposals to meet these needs In FP7 Infrastructure Funds to support in order of priority: Core Databases - Enhancements/Services New Core Resources Standards Distributed networks of specialised data resources Distributed Annotation Network(s) Tools/libraries & Distributed Web Services?

25 Challenges of Current I3 Infrastructure Funding Instrument for Bioinformatics Current guidelines are based on physical not virtual infrastructures large instrumentation not needed Data are rapidly evolving and diversifying and hence need rapidly evolving platforms for data collection, storage & dissemination Peer review neither possible nor desirable for web-based infrastructures Difficult to raise adequate support for centralised DB and services they provide although everyone uses them No maintenance only creation and enhancements Cumulative cost comparable with Physics, but spent differently: ongoing rather than upfront investment

26 Funding Mechanisms I: Core Data Resources Aim: To support Core Data Resources To provide contribution to creation and enhancement of databases To fund services & access through web needs installation/ equipment/dbs To fund technical support & training to use resources properly Model - one/limited number of sites for DB, but thousands of depositors/users across Europe Instrument: I3 with modified access & enhancement criteria Prioritise: - Through strong links with Life Sciences Thematic Priorities especially for new resources

27 Funding Mechanisms II:Standards Aim: To support establishment of standards for new data Model - Led by limited number of laboratories, but involving whole community Instrument: Design Study in Infrastructures Prioritise: - Through strong links with Life Sciences Thematic Priorities

28 Funding Mechanisms III: Specialist Data Resources Aim: To develop Clusters of Specialist Data Resources E.g individual protein families; immunology databases; Model Organism data resources (eg bacteria, pathogenic organisms) Model distributed databases one in each laboratory (say ~6 on average) Instrument: Integrated Project one partner may provide core infrastructure? Prioritise - by a strong link between infrastructure funding and research priorities in Life Sciences Thematics Priorities

29 Funding Mechanisms IIII: Distributed Annotation/Tools/Web services AIM: Support for Bioinformatics Laboratories to employ their best tools to provide information to all biological community Model Distributed effort in many expert laboratories essentially open system with infrastructure hub provided by one partner Instrument: Network of Excellence perhaps with fewer participants Prioritise: By research themes; by topic (eg transcriptome data) etc

Types of Databases - By Scope

Types of Databases - By Scope Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of

More information

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource

Global Biomolecular Information Infrastructure and Australia. Graham Cameron Director The EMBL Australia Bioinformatics Resource Global Biomolecular Information Infrastructure and Australia Graham Cameron Director The EMBL Australia Bioinformatics Resource What is bioinformatics? Methods, data, IT to exploit biomolecular information

More information

ELE4120 Bioinformatics. Tutorial 5

ELE4120 Bioinformatics. Tutorial 5 ELE4120 Bioinformatics Tutorial 5 1 1. Database Content GenBank RefSeq TPA UniProt 2. Database Searches 2 Databases A common situation for alignment is to search through a database to retrieve the similar

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS Introduction to BIOINFORMATICS Antonella Lisa CABGen Centro di Analisi Bioinformatica per la Genomica Tel. 0382-546361 E-mail: lisa@igm.cnr.it http://www.igm.cnr.it/pagine-personali/lisa-antonella/ What

More information

The EMBL-Bioinformatics and Data-Intensive Informatics

The EMBL-Bioinformatics and Data-Intensive Informatics The EMBL-Bioinformatics and Data-Intensive Informatics Graham Cameron EMBL-EBI What is the EMBL-EBI? Non-profit organization Part of the European Molecular Biology Laboratory Based on the Wellcome Trust

More information

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita

Genome Informatics. Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, Kiyoko F. Aoki-Kinoshita Genome Informatics Systems Biology and the Omics Cascade (Course 2143) Day 3, June 11 th, 2008 Kiyoko F. Aoki-Kinoshita Introduction Genome informatics covers the computer- based modeling and data processing

More information

BIMM 143: Introduction to Bioinformatics (Winter 2018)

BIMM 143: Introduction to Bioinformatics (Winter 2018) BIMM 143: Introduction to Bioinformatics (Winter 2018) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bimm143_w18/ DRAFT: 2017-12-02 (20:48:10 PST

More information

Overview of Health Informatics. ITI BMI-Dept

Overview of Health Informatics. ITI BMI-Dept Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational

More information

Introduction to EMBL-EBI.

Introduction to EMBL-EBI. Introduction to EMBL-EBI www.ebi.ac.uk What is EMBL-EBI? Part of EMBL Austria, Belgium, Croatia, Denmark, Finland, France, Germany, Greece, Iceland, Ireland, Israel, Italy, Luxembourg, the Netherlands,

More information

ELIXIR: data for molecular biology and points of entry for marine scientists

ELIXIR: data for molecular biology and points of entry for marine scientists ELIXIR: data for molecular biology and points of entry for marine scientists Guy Cochrane, EMBL-EBI EuroMarine 2018 General Assembly meeting 17-18 January 2018 www.elixir-europe.org Scales of molecular

More information

B I O I N F O R M A T I C S

B I O I N F O R M A T I C S B I O I N F O R M A T I C S Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be SUPPLEMENTARY CHAPTER: DATA BASES AND MINING 1 What

More information

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro

The Gene Ontology Annotation (GOA) project application of GO in SWISS-PROT, TrEMBL and InterPro Comparative and Functional Genomics Comp Funct Genom 2003; 4: 71 74. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/cfg.235 Conference Review The Gene Ontology Annotation

More information

Genetics and Bioinformatics

Genetics and Bioinformatics Genetics and Bioinformatics Kristel Van Steen, PhD 2 Montefiore Institute - Systems and Modeling GIGA - Bioinformatics ULg kristel.vansteen@ulg.ac.be Lecture 1: Setting the pace 1 Bioinformatics what s

More information

I nternet Resources for Bioinformatics Data and Tools

I nternet Resources for Bioinformatics Data and Tools ~i;;;;;;;'s :.. ~,;;%.: ;!,;s163 ~. s :s163:: ~s ;'.:'. 3;3 ~,: S;I:;~.3;3'/////, IS~I'//. i: ~s '/, Z I;~;I; :;;; :;I~Z;I~,;'//.;;;;;I'/,;:, :;:;/,;'L;;;~;'~;~,::,:, Z'LZ:..;;',;';4...;,;',~/,~:...;/,;:'.::.

More information

PATHWAY ANALYSIS. Susan LM Coort, PhD Department of Bioinformatics, Maastricht University. PET course: Toxicogenomics

PATHWAY ANALYSIS. Susan LM Coort, PhD Department of Bioinformatics, Maastricht University. PET course: Toxicogenomics PATHWAY ANALYSIS Susan LM Coort, PhD Department of Bioinformatics, Maastricht University 1 Data analysis overview Microarray scans Slide based on a slide from J. Pennings, RIVM, NL Image analysis Preprocessing

More information

ONLINE BIOINFORMATICS RESOURCES

ONLINE BIOINFORMATICS RESOURCES Dedan Githae Email: d.githae@cgiar.org BecA-ILRI Hub; Nairobi, Kenya 16 May, 2014 ONLINE BIOINFORMATICS RESOURCES Introduction to Molecular Biology and Bioinformatics (IMBB) 2014 The larger picture.. Lower

More information

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives

European Genome phenome Archive at the European Bioinformatics Institute. Helen Parkinson Head of Molecular Archives European Genome phenome Archive at the European Bioinformatics Institute Helen Parkinson Head of Molecular Archives What is EMBL-EBI? International, non-profit research institute Part of the European Molecular

More information

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature

Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature Bioinformatics to chemistry to therapy: Some case studies deriving information from the literature. Donald Walter August 22, 2007 The Typical Drug Development Paradigm Gary Thomas, Medicinal Chemistry:

More information

Two Mark question and Answers

Two Mark question and Answers 1. Define Bioinformatics Two Mark question and Answers Bioinformatics is the field of science in which biology, computer science, and information technology merge into a single discipline. There are three

More information

ArrayExpress: Quick tour

ArrayExpress: Quick tour Melissa Burke [1] Gene Expression Beginner 0.5 hour This quick tour provides an overview of EMBL-EBI s functional genomics database ArrayExpress. This course was updated in December 2015. An undergraduate-level

More information

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL

Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL Since 2002 a merger and collaboration of three databases: Swiss-Prot & TrEMBL PIR-PSD Funded mainly by NIH (US) to be the highest quality, most thoroughly annotated protein sequence database o A high quality

More information

Introduc)on to Databases and Resources Biological Databases and Resources

Introduc)on to Databases and Resources Biological Databases and Resources Introduc)on to Bioinforma)cs Online Course : IBT Introduc)on to Databases and Resources Biological Databases and Resources Learning Objec)ves Introduc)on to Databases and Resources - Understand how bioinforma)cs

More information

Protein Bioinformatics Part I: Access to information

Protein Bioinformatics Part I: Access to information Protein Bioinformatics Part I: Access to information 260.655 April 6, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Outline [1] Proteins at NCBI RefSeq accession numbers Cn3D to visualize structures

More information

NCBI web resources I: databases and Entrez

NCBI web resources I: databases and Entrez NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table

More information

Elixir: Overview, Progress and Futures

Elixir: Overview, Progress and Futures Elixir: Overview, Progress and Futures 20th Meeting of the EC-US Biotechnology Task Force Barcelona 3 June 2010 Andrew Lyall, ELIXIR Project Manager www.elixir-europe.org ELIXIR: a sustainable infrastructure

More information

Sequence Databases and database scanning

Sequence Databases and database scanning Sequence Databases and database scanning Marjolein Thunnissen Lund, 2012 Types of databases: Primary sequence databases (proteins and nucleic acids). Composite protein sequence databases. Secondary databases.

More information

Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges

Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges Opinion TheScientificWorldJOURNAL (2009) 9, 420 423 TSW Development & Embryology ISSN 1537-744X; DOI 10.1100/tsw.2009.57 Minimum Information About a Microarray Experiment (MIAME) Successes, Failures, Challenges

More information

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015

Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015 Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck

More information

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005

Following text taken from Suresh Kumar. Bioinformatics Web - Comprehensive educational resource on Bioinformatics. 6th May.2005 Bioinformatics is the recording, annotation, storage, analysis, and searching/retrieval of nucleic acid sequence (genes and RNAs), protein sequence and structural information. This includes databases of

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map

More information

Web-based Bioinformatics Applications in Proteomics

Web-based Bioinformatics Applications in Proteomics Web-based Bioinformatics Applications in Proteomics Chiquito Crasto ccrasto@genetics.uab.edu January 30, 2009 NCBI (National Center for Biotechnology Information) http://www.ncbi.nlm.nih.gov/ 1 Pubmed

More information

Introduction to 'Omics and Bioinformatics

Introduction to 'Omics and Bioinformatics Introduction to 'Omics and Bioinformatics Chris Overall Department of Bioinformatics and Genomics University of North Carolina Charlotte Acquire Store Analyze Visualize Bioinformatics makes many current

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists 15 19 March 2010 Developmental Biology and Regnerative Medicine (DBRM) Schedule Monday, March 15 09.00 11.00 Introduction to course and Bioinformatics (L1) D224 Helena

More information

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries.

This practical aims to walk you through the process of text searching DNA and protein databases for sequence entries. PRACTICAL 1: BLAST and Sequence Alignment The EBI and NCBI websites, two of the most widely used life science web portals are introduced along with some of the principal databases: the NCBI Protein database,

More information

Databases/Resources on the web

Databases/Resources on the web Databases/Resources on the web Jon K. Lærdahl jonkl@medisin.uio.no A lot of biological databases available on the web... MetaBase, the database of biological databases (1801 entries) - h p://metadatabase.org

More information

Proteomics: New Discipline, New Resources. Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY

Proteomics: New Discipline, New Resources. Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY Proteomics: New Discipline, New Resources Fred Stoss, University at Buffalo, NERM 2004, Rochester, NY What is Proteomics? Systematic analysis of protein expression of normal and diseased tissues that involves

More information

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science

EECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can

More information

High peformance computing infrastructure for bioinformatics

High peformance computing infrastructure for bioinformatics High peformance computing infrastructure for bioinformatics Scott Hazelhurst University of the Witwatersrand December 2009 What we need Skills, time What we need Skills, time Fast network Lots of storage

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

CSC 121 Computers and Scientific Thinking

CSC 121 Computers and Scientific Thinking CSC 121 Computers and Scientific Thinking Fall 2005 Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors

More information

Chapter 2: Access to Information

Chapter 2: Access to Information Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI

More information

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES

LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES 1 LARGE DATA AND BIOMEDICAL COMPUTATIONAL PIPELINES FOR COMPLEX DISEASES Ezekiel Adebiyi, PhD Professor and Head, Covenant University Bioinformatics Research and CU NIH H3AbioNet node Covenant University,

More information

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools

Introduction and Public Sequence Databases. BME 110/BIOL 181 CompBio Tools Introduction and Public Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 29, 2011 Course Syllabus: Admin http://www.soe.ucsc.edu/classes/bme110/spring11 Reading: Chapters 1, 2 (pp.29-56),

More information

Applied Bioinformatics

Applied Bioinformatics Applied Bioinformatics Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Course overview What is bioinformatics Data driven science: the creation and advancement

More information

1 st transplant user training workshop Versailles, 12th-13th November 2012

1 st transplant user training workshop Versailles, 12th-13th November 2012 trans-national Infrastructure for Plant Genomic Science 1 st transplant user training workshop Versailles, 12th-13th November 2012 Paul Kersey, EMBL-EBI More people, less land Plant genome sequences, 2005

More information

Computers in Biology and Bioinformatics

Computers in Biology and Bioinformatics Computers in Biology and Bioinformatics 1 Biology biology is roughly defined as "the study of life" it is concerned with the characteristics and behaviors of organisms, how species and individuals come

More information

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson

Grundlagen der Bioinformatik Summer Lecturer: Prof. Daniel Huson Grundlagen der Bioinformatik, SoSe 11, D. Huson, April 11, 2011 1 1 Introduction Grundlagen der Bioinformatik Summer 2011 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a) 1.1

More information

Advances in Biomedical Research at Comenius University Bratislava

Advances in Biomedical Research at Comenius University Bratislava Advances in Biomedical Research at Comenius University Bratislava Bratislava, Slovakia What is biomedicine? Biomedicine is a branch of medical science that applies biological and other natural-science

More information

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler

Elixir: European Bioinformatics Research Infrastructure. Rolf Apweiler Elixir: European Bioinformatics Research Infrastructure Rolf Apweiler EMBL-EBI Service Mission To enable life science research and its translation to medicine, agriculture, the bioindustries and society

More information

Engineering Genetic Circuits

Engineering Genetic Circuits Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art

More information

Computational Biology and Bioinformatics

Computational Biology and Bioinformatics Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Changhui (Charles) Yan Old Main 401 F http://www.cs.usu.edu www.cs.usu.edu/~cyan 1 How Old Is The Discipline? "The term bioinformatics is a relatively recent invention, not

More information

G4120: Introduction to Computational Biology

G4120: Introduction to Computational Biology G4120: Introduction to Computational Biology Oliver Jovanovic, Ph.D. Columbia University Department of Microbiology Lecture 3 February 13, 2003 Copyright 2003 Oliver Jovanovic, All Rights Reserved. Bioinformatics

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Dortmund, 16.-20.07.2007 Lectures: Sven Rahmann Exercises: Udo Feldkamp, Michael Wurst 1 Goals of this course Learn about Software tools Databases Methods (Algorithms) in

More information

BGGN 213: Foundations of Bioinformatics (Fall 2017)

BGGN 213: Foundations of Bioinformatics (Fall 2017) BGGN 213: Foundations of Bioinformatics (Fall 2017) Course Instructor: Dr. Barry J. Grant ( bjgrant@ucsd.edu ) Course Website: https://bioboot.github.io/bggn213_f17/ DRAFT: 2017-08-10 (15:02:30 PDT on

More information

Tools, techniques and infrastructure bioinformatics in marine biotechnology

Tools, techniques and infrastructure bioinformatics in marine biotechnology Tools, techniques and infrastructure bioinformatics in marine biotechnology Second Marine Biotechnology ERA-NET Stakeholder Meeting 13 th - 14 th October 2016, Hotel Marivaux, Brussels, Belgium Nils Peder

More information

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics 260.602.01 September 1, 2006 Jonathan Pevsner, Ph.D. pevsner@kennedykrieger.org Teaching assistants Hugh Cahill (hugh@jhu.edu) Jennifer Turney (jturney@jhsph.edu) Meg Zupancic

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....

More information

Dina El-Khishin (Ph.D.) Bioinformatics Research Facility. Deputy Director of AGERI & Head of the Genomics, Proteomics &

Dina El-Khishin (Ph.D.) Bioinformatics Research Facility. Deputy Director of AGERI & Head of the Genomics, Proteomics & Dina El-Khishin (Ph.D.) Deputy Director of AGERI & Head of the Genomics, Proteomics & Bioinformatics Research Facility Agricultural Genetic Engineering Research Institute (AGERI) Giza EGYPT Bioinformatics

More information

Bioinformatics for Proteomics. Ann Loraine

Bioinformatics for Proteomics. Ann Loraine Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data

More information

Data representation for clinical data and metadata

Data representation for clinical data and metadata Data representation for clinical data and metadata WP1: Data representation for clinical data and metadata Inconsistent terminology creates barriers to identifying common clinical entities in disparate

More information

Introduction to BIOINFORMATICS

Introduction to BIOINFORMATICS COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology

Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Bioinformatics Model Answers Compiled by Mr. Nitin Swamy Asst. Prof. Department of Biotechnology Page 1 of 15 Previous years questions asked. 1. Describe the software used in bioinformatics 2. Name four

More information

Biological databases an introduction

Biological databases an introduction Biological databases an introduction By Dr. Erik Bongcam-Rudloff SGBC-SLU 2016 VALIDATION Experimental Literature Manual or semi-automatic computational analysis EXPERIMENTAL Costs Needs skilled manpower

More information

Deakin Research Online

Deakin Research Online Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM

More information

Introduction to ELIXIR Andy Smith, ELIXIR Hub 18 March 2015 Wageningen

Introduction to ELIXIR Andy Smith, ELIXIR Hub 18 March 2015 Wageningen Introduction to ELIXIR Andy Smith, ELIXIR Hub 18 March 2015 Wageningen European Life Sciences Infrastructure for Biological Information www.elixir europe.org ELIXIR connects national bioinformatics centres

More information

ELIXIR connects national centres and EMBL EBI to build a sustainable European infrastructure for biological research data. medicine.

ELIXIR connects national centres and EMBL EBI to build a sustainable European infrastructure for biological research data. medicine. ELIXIR connects national centres and EMBL EBI to build a sustainable European infrastructure for biological research data. medicine agriculture 1 environment bioindustries ELIXIR underpins life science

More information

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks

Introduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional

More information

Biological databases an introduction

Biological databases an introduction Biological databases an introduction By Dr. Erik Bongcam-Rudloff SLU 2017 Biological Databases Sequence Databases Genome Databases Structure Databases Sequence Databases The sequence databases are the

More information

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE

AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS

More information

Databasing Expression with Integrative Biochip Informatics

Databasing Expression with Integrative Biochip Informatics Databasing Expression with Integrative Biochip Informatics Ju Han Kim, M.D., Ph.D., M.S. SNUBiomedical Informatics Seoul Nat t Univ. School of Medicine Databasing Gene Expression Bio-databases Microarray

More information

Interpreting Genome Data for Personalised Medicine. Professor Dame Janet Thornton EMBL-EBI

Interpreting Genome Data for Personalised Medicine. Professor Dame Janet Thornton EMBL-EBI Interpreting Genome Data for Personalised Medicine Professor Dame Janet Thornton EMBL-EBI Deciphering a genome 3 billion bases 4 million variants 21,000 coding variants 10,000 non-synonymous variants 50-100

More information

The University of California, Santa Cruz (UCSC) Genome Browser

The University of California, Santa Cruz (UCSC) Genome Browser The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 8

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Brad Broom Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org bmbroom@mdanderson.org 7

More information

Big picture and history

Big picture and history Big picture and history (and Computational Biology) CS-5700 / BIO-5323 Outline 1 2 3 4 Outline 1 2 3 4 First to be databased were proteins The development of protein- s (Sanger and Tuppy 1951) led to the

More information

Bioinformatics for Cell Biologists

Bioinformatics for Cell Biologists Bioinformatics for Cell Biologists Rickard Sandberg Karolinska Institutet 13-17 May 2013 OUTLINE INTRODUCTION Introduce yourselves HISTORY MODERN What is bioinformatics today? COURSE ONLINE LEARNING OPPORTUNITIES

More information

Klinisk kemisk diagnostik BIOINFORMATICS

Klinisk kemisk diagnostik BIOINFORMATICS Klinisk kemisk diagnostik - 2017 BIOINFORMATICS What is bioinformatics? Bioinformatics: Research, development, or application of computational tools and approaches for expanding the use of biological,

More information

Product Applications for the Sequence Analysis Collection

Product Applications for the Sequence Analysis Collection Product Applications for the Sequence Analysis Collection Pipeline Pilot Contents Introduction... 1 Pipeline Pilot and Bioinformatics... 2 Sequence Searching with Profile HMM...2 Integrating Data in a

More information

EBI web resources I: databases and tools. Yanbin Yin Spring 2013

EBI web resources I: databases and tools. Yanbin Yin Spring 2013 EBI web resources I: databases and tools Yanbin Yin Spring 2013 1 Outline Intro to EBI Databases and web tools UniProt Gene Ontology Hands on PracBce MOST MATERIALS ARE FROM: hkp://www.ebi.ac.uk/training/online/course-

More information

Annotation. (Chapter 8)

Annotation. (Chapter 8) Annotation (Chapter 8) Genome annotation Genome annotation is the process of attaching biological information to sequences: identify elements on the genome attach biological information to elements store

More information

Protein Data Bank (PDB) Archive and the wwpdb Partnership

Protein Data Bank (PDB) Archive and the wwpdb Partnership Protein Data Bank (PDB) Archive and the wwpdb Partnership Stephen K. Burley, M.D., D.Phil. Worldwide Protein Data Bank Co-Leader Director, RCSB Protein Data Bank Rutgers University/UC San Diego wwpdb.org

More information

GS Analysis of Microarray Data

GS Analysis of Microarray Data GS01 0163 Analysis of Microarray Data Keith Baggerly and Kevin Coombes Department of Bioinformatics and Computational Biology UT M. D. Anderson Cancer Center kabagg@mdanderson.org kcoombes@mdanderson.org

More information

State strategies for bioinformatics in BRICs and the UK. Professor Brian Salter

State strategies for bioinformatics in BRICs and the UK. Professor Brian Salter State strategies for bioinformatics in BRICs and the UK Professor Brian Salter This new facility is the embodiment of our investment in big data and bioinformatics. We are not only ensuring that people

More information

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1

Introduction to Bioinformatics for Medical Research. Gideon Greenspan TA: Oleg Rokhlenko. Lecture 1 Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il TA: Oleg Rokhlenko Lecture 1 Introduction to Bioinformatics Introduction to Bioinformatics What is Bioinformatics?

More information

The Integrated Biomedical Sciences Graduate Program

The Integrated Biomedical Sciences Graduate Program The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR

RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR MB 401: RESEARCH METHODOLOGY, BIOSTATISTICS AND IPR Objectives: The overall aim of the course is to deepen knowledge regarding basic concepts of Biostatistics, the research process in occupational therapy

More information

Gene-centered resources at NCBI

Gene-centered resources at NCBI COURSE OF BIOINFORMATICS a.a. 2014-2015 Gene-centered resources at NCBI We searched Accession Number: M60495 AT NCBI Nucleotide Gene has been implemented at NCBI to organize information about genes, serving

More information

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century

Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Perspectives on the Priorities for Bioinformatics Education in the 21 st Century Oyekanmi Nash, PhD Associate Professor & Director Genetics, Genomics & Bioinformatics National Biotechnology Development

More information

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases

Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras. Lecture - 5a Protein sequence databases Bioinformatics Prof. M. Michael Gromiha Department of Biotechnology Indian Institute of Technology, Madras Lecture - 5a Protein sequence databases In this lecture, we will mainly discuss on Protein Sequence

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

Imperial College London Key Research Themes for NBIT and FP7

Imperial College London Key Research Themes for NBIT and FP7 Imperial College London Key Research Themes for NBIT and FP7 Professor Richard I Kitney Imperial College Research Systems and Software Solutions Advanced Information Systems (eg CISs) Systems Analysis

More information

GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data

GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data GNET 744 Biological Sequence Analysis, Protein Structure and Genome-Wide Data This course provides an introduction to basic protein structure/function analyses, sequencing informatics and macromolecular

More information

M a x i m i z in g Value from NGS Analytics in t h e E n terprise

M a x i m i z in g Value from NGS Analytics in t h e E n terprise Global Headquarters: 5 Speen Street Framingham, MA 01701 USA P.508.935.4445 F.508.988.7881 www.idc-hi.com M a x i m i z in g Value from NGS Analytics in t h e E n terprise C U S T O M I N D U S T R Y B

More information

A New Database of Genetic and. Molecular Pathways. Minoru Kanehisa. sequencing projects have been. Mbp) and for several bacteria including

A New Database of Genetic and. Molecular Pathways. Minoru Kanehisa. sequencing projects have been. Mbp) and for several bacteria including Toward Pathway Engineering: A New Database of Genetic and Molecular Pathways Minoru Kanehisa Institute for Chemical Research, Kyoto University From Genome Sequences to Functions The Human Genome Project

More information

EMBL-EBI Overview EMBL-EBI Overview

EMBL-EBI Overview EMBL-EBI Overview EMBL-EBI Overview Welcome Welcome to the European Bioinformatics Institute (EMBL-EBI), a global hub for big data in biology. We promote scientific progress by providing freely available data to the life-science

More information

DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI DOWNLOAD OR READ : UNDERSTANDING BIOINFORMATICS PDF EBOOK EPUB MOBI Page 1 Page 2 understanding bioinformatics understanding bioinformatics pdf understanding bioinformatics Bioinformatics / ËŒ b aéª. oêš

More information