Genome edi3ng with the CRISPR-Cas9 system
|
|
- Scot Bruce
- 6 years ago
- Views:
Transcription
1 CRISPR-Cas9 Genome Edi3ng Bootcamp AHA Council on Func3onal Genomics and Transla3onal Biology Narrated video link: hfps://youtu.be/h18hmftybnq Genome edi3ng with the CRISPR-Cas9 system Kiran Musunuru, MD, PhD, MPH, FAHA FINANCIAL DISCLOSURES: None UNLABELED/UNAPPROVED USES DISCLOSURES: None
2 Genome edi3ng Facilitates knockout or knock-in of muta3ons by introducing a double-strand break at a desired site in genome Drama3cally increases the efficiency of mutagenesis Can be used in vitro and in vivo
3 Double-strand breaks The cell has two methods to repair double-strand breaks (DSBs) Non-homologous end joining (NHEJ) brings two free ends together and rejoins them, error-prone Homology-directed repair (HDR) uses sister chroma3d/chromosome as a template to replace the area of the break via homologous recombina3on
4 Double-strand breaks Can fool the cell into using an exogenously introduced DNA vector as a repair template Can even use a single-strand DNA oligonucleo3de (ssdna oligo) as a repair template If a vector or ssdna oligo harbors a muta3on, can exploit HDR to stably introduce the muta3on into the genome
5 Double-strand breaks Gupta and Musunuru. J Clin Invest 2014; 124:
6 Genome-edi3ng tools Zinc finger nucleases (ZFNs) Meganucleases TAL effector nucleases (TALENs) Clustered regularly interspaced short palindromic repeats (CRISPR) CRISPR-associated 9 (CRISPR-Cas9)
7 The CRISPR-Cas9 system for genome edi3ng (guide RNA) Jinek et al. elife 2013; 2:e00471 Mali et al. Science 2013; 339:823-6 Cong et al. Science 2013; 339:819-23
8 CRISPR-Cas9 Cas9 nuclease remains the same regardless of target DNA Changing nucleo3des in the guide RNA alters the sequence specificity of the CRISPR-Cas9 complex Can make a new guide RNA in the laboratory in one day Can make a large library (genome-wide) at one 3me Mixing Cas9 with more than one guide RNA allows for mul3plexing targe3ng mul3ple sites at once
9 Knocking out genes with CRISPR-Cas9 CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC GACTGATGCACCAGAT GCCTCACATGGTGGGGATCGTTTG \ 20-bp protospacer / S. pyogenes CACAGTGGTGCTAAACGTGC guide RNA Cas9 protein G GTGTCACCACGTAATGCACG Genera3on of a double-strand break at genomic site??????gagtgtaccacccctagcaaac CTGACTACGTGGTCTAGTGT??????????????????CTCACATGGTGGGGATCGTTTG GACTGATGCACCAGATCACA???????????? Non-homologous end joining CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC CTGACTACGTGGTCTAGTGTCACCACGTAA---ACGCGGAGTGTACCACCCCTAGCAAAC CTGACTACGTGGTCTAGTGTCACCACGT-----ACGCGGAGTGTACCACCCCTAGCAAAC CTGACTACGTGGTCTAGTGTCACCACG CGCGGAGTGTACCACCCCTAGCAAAC wild-type vs. indels/frameshies
10 Knocking in variants with CRISPR-Cas9 CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC GACTGATGCACCAGAT GCCTCACATGGTGGGGATCGTTTG \ 20-bp protospacer / S. pyogenes CACAGTGGTGCTAAACGTGC guide RNA Cas9 protein G GTGTCACCACGTAATGCACG Genera3on of a double-strand break at genomic site??????gagtgtaccacccctagcaaac CTGACTACGTGGTCTAGTGT??????????????????CTCACATGGTGGGGATCGTTTG GACTGATGCACCAGATCACA???????????? Homology-directed repair using DNA template (double-strand vector, ssdna oligo) CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC CTGACTACGTGGTCTAGTGTCACCACGTAATTCACGCGGAGTGTACCACCCCTAGCAAAC wild-type vs. site-specific mutagenesis
11 Genera3ng knockout mice with CRISPR-Cas9 Cas9 mrna, guide RNA (grna) AAAA mutagenesis embryo transfer zygote injec3on blastocyst PCR screening 3 weeks to make knockout mice up to 100% efficiency knockout mice
12 Disease modeling in stem cells with CRISPR-Cas9 genome edi3ng wild-type hpsc or ipsc with muta3on mutant hpsc or corrected ipsc ipsc = induced pluripotent stem cells differen3a3on hpsc = human pluripotent stem cells (ipsc or human embryonic stem cells) phenotypic comparisons
13 On-target vs. off-target effects CRISPR-Cas9 can be very efficient as much as 100% mutagenesis in some applica3ons Along with on-target mutagenesis, there can be offtarget mutagenesis elsewhere in the genome Off-target effects thought to be most likely to happen at sites with sequence similarity to on-target site
14 CRISPR-Cas9 systems Streptococcus pyogenes Cas9 - the standard Cas9 used for virtually all research applica3ons to date - well-characterized on-target, off-target effects Staphylococcus aureus Cas9 - smaller than S. pyogenes Cas9, can be packaged in AAV for in vivo delivery - similar on-target efficiency, possibly less off-target effects (Ran et al., Nature 2015)
15 Introduc3on of Cas9 and guide RNA into cells Ligate two short oligos into plasmid encoding guide RNA = pguide Streptococcus pyogenes U6 promoter G(N) 20 guide RNA Fixed plasmid encoding Cas9 and green fluorescent protein (GFP) = pcas9_gfp CAG promoter Cas9 (from S. pyogenes) 2A GFP Plasmids available from Addgene; other S. pyogenes CRISPR-Cas9 plasmids are available
16 Introduc3on of Cas9 and guide RNA into cells Ligate two short oligos into plasmid encoding guide RNA = psaguide Staphylococcus aureus U6 promoter G(N) 21 guide RNA Fixed plasmid encoding Cas9 and green fluorescent protein (GFP) = psacas9_gfp CAG promoter Cas9 (from S. aureus) 2A GFP Plasmids available from Addgene; other S. aureus CRISPR-Cas9 plasmids are available
17 Targe3ng a site in the genome CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC GACTGATGCACCAGAT GCCTCACATGGTGGGGATCGTTTG \ 20-bp protospacer / S. pyogenes CACAGTGGTGCTAAACGTGC guide RNA Cas9 protein G GTGTCACCACGTAATGCACG Rules for S. pyogenes CRISPR guide RNA design: 1. The protospacer is 20 basepairs in length 2. The protospacer must be posi3oned just before a 3-bp element matching the sequence NGG (N = any nucleo3de) called the protospacer-adjacent mo3f (PAM) 3. The 5 por3on of the guide RNA matches the protospacer sequence, so that it can bind to the complementary strand of DNA 4. To be expressed efficiently from the U6 promoter, the guide RNA sequence must begin with a G 5. Thus, the guide RNA should start with G followed by the 20-bp protospacer = G(N) 20
18 Targe3ng a site in the genome CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC GACTGATGCACCAGAT GCCTCACATGGTGGGGATCGTTTG \ 20-bp protospacer / S. pyogenes CACAGTGGTGCTAAACGTGC guide RNA Cas9 protein G GTGTCACCACGTAATGCACG Picking a target site: break 1. The double-strand break occurs 3 basepairs upstream of the PAM 2. Muta3ons tend to occur right at the site of the double-strand break 3. Cas9 guide RNA complexes can bind on either DNA strand, so check both the forward and reverse strands for possible protospacers/pams 4. Try to pick a guide RNA sequence that will posi3on the double-strand break as close as possible to the site of the desired muta3on (whether an indel or a knock-in variant) 5. Oeen there will be several reasonable choices 6. If possible, avoid GC-rich protospacers (increased chance of off-target effects)
19 Targe3ng a site in the genome CTGACTACGTGGTCTAGTGTCACCACGTAATGCACGCGGAGTGTACCACCCCTAGCAAAC GACTGATGCACCAGA GCCTCACATGGTGGGGATCGTTTG \ 21-bp protospacer / S. aureus TCACAGTGGTGCTAAACGTGC guide RNA Cas9 protein G AGTGTCACCACGTAATGCACG break Rules for S. aureus CRISPR guide RNA design: 1. Similar to rules for S. pyogenes CRISPR design, but 2. The protospacer is 21 basepairs in length 3. The protospacer should be posi3oned just before a 5-bp element matching the PAM sequence NNGRR (N = any nucleo3de, R = G or A), ideally NNGRRT 4. The 5 por3on of the guide RNA matches the protospacer sequence, so that it can bind to the complementary strand of DNA 5. To be expressed efficiently from the U6 promoter, the guide RNA sequence must begin with a G 6. Thus, the guide RNA should start with G followed by the 21-bp protospacer = G(N) 21
20 Tips for iden3fying target site If trying to knock out a gene, pick a target site in the first coding exon (or, if the gene appears to have mul3ple alterna3ve transcripts in UCSC Genome Browser, pick the earliest coding exon that is shared by all transcripts) If trying to knock in a variant, the site selec3on will be constrained should be within bp of the desired variant, and ideally less
21 Tips for iden3fying target site Use cdna sequence (con3nuous coding sequence) to determine the target site and the consequence of a muta3on can download from GenBank Use genome sequence to iden3fy op3mal protospacer/pam sites can download from UCSC Genome Browser If cdna sequence is used to find protospacer/pam sites, will not account for intronic sequences may not successfully target the genome
22 Example Familial combined hypolipidemia Loss-of-func3on muta3ons in the ANGPTL3 gene S17X muta3on (Ser17Ter) is the most commonly reported Task: design S. pyogenes guide RNAs to target the site of the muta3on, both for knockout of the ANGPTL3 gene as well as to knock in the specific muta3on
23 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... S17X muta3on = TCC! TGA No NGG sequences (PAMs) near the muta3on site Mul3ple CCN sequences (reverse PAMs)
24 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... PAM #1: protospacer = ATTCTGGAGGAAATAACTAG Double-strand break occurs 10 bp away from muta3on site, protospacer overlaps muta3on site (reducing recleavage of site, once muta3on is introduced)
25 Reducing re-cleavage by CRISPR-Cas9 Overlap of protospacer and/or PAM with the muta3on site results in a mismatch(es) aeer knock-in One or two protospacer mismatches should reduce but may not eliminate re-cleavage Protospacer mismatches close to PAM will generally reduce re-cleavage more than those away from PAM Disrup3on of PAM (no longer NGG) should eliminate re-cleavage
26 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... PAM #2: protospacer = ATTGTCTTGATCAATTCTGG Double-strand break occurs 1 bp away from muta3on site, protospacer overlaps muta3on site (reducing recleavage of site, once muta3on is introduced)
27 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... PAM #3: protospacer = TGAATTGTCTTGATCAATTC Double-strand break occurs 4 bp away from muta3on site, PAM overlaps muta3on site (reducing re-cleavage of site, once muta3on is introduced)
28 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... PAM #2: protospacer = ATTGTCTTGATCAATTCTGG Best choice on paper, but ideally all three candidates should be tested for DSB ac3vity in a human cell line (e.g., HEK 293 cells) to iden3fy the best guide RNA
29 Example PAM #2: protospacer = ATTGTCTTGATCAATTCTGG To design oligonucleo3des to insert into pguide: First, add G to the beginning of the protospacer to allow transcrip3on by U6 promoter: GATTGTCTTGATCAATTCTGG This is the sequence that needs to be incorporated at the 5 end of the guide RNA
30 Example GATTGTCTTGATCAATTCTGG To design oligonucleo3des to insert into pguide: Second, use the following templates: 5 -CACC-GNNNNNNNNNNNNNNNNNNNN-3 3 -CNNNNNNNNNNNNNNNNNNNN-CAAA-5 These two oligos can be annealed together to form a small insert that can be ligated into pguide
31 Example GATTGTCTTGATCAATTCTGG Templates: 5 -CACC-GNNNNNNNNNNNNNNNNNNNN-3 3 -CNNNNNNNNNNNNNNNNNNNN-CAAA-5 Oligonucleo3des (can buy these): 5 -CACCGATTGTCTTGATCAATTCTGG-3 5 -AAACCCAGAATTGATCAAGACAATC-3
32 Example Upon crea3on of the pguide vector with the guide RNA targe3ng ANGPTL3 S17X site, can be used for: - knockout: since the site is so close to the beginning of the gene, any indel will truncate the protein - knock-in of muta3on: if used with a single-strand DNA oligonucleo3de as a repair template, HDR will allow for knock-in at a low frequency; however, NHEJ will s3ll be ac3ve and result in indels/knockouts at some frequency
33 Example To design single-strand DNA oligonucleo3de for knock-in, start with the mutant nucleo3de(s) and then add flanking genome sequences on either side of the site to serve as homology arms Should use homology arms 40 nucleo3des in length Can use ssdna oligos as long as 200 nucleo3des
34 Example ANGPTL3 coding sequence (from genome sequence) ATGTTCACAATTAAGCTCCTTCTTTTTATTGTTCCTC TAGTTATTTCCTCCAGAATTGATCAAGACAATTCATC ATTTGATTCTCTATCTCCAGAGCCAAAATCAAGATTT GCTATGTTAGACGATGTAAAAATTTTAGCCAATG... S17X muta3on = TCC! TGA ssdna oligo (can buy this) = 5 -ATTAAGCTCCTTCTT TTTATTGTTCCTCTAGTTATTTCCTGAAGAATTGATC AAGACAATTCATCATTTGATTCTCTATCTC-3
35 Assessing efficacy The last step is to design PCR primers to amplify the region surrounding the target site (several hundred basepair length is sufficient, as long as the target site is in the center of the amplicon) CEL I endonuclease or T7 endonuclease I (T7EI) assay (detects DNA mismatches within a PCR product) to determine the efficacy of mutagenesis DNA sequencing to iden3fy specific muta3ons
CRISPR/Cas9 Genome Editing: Transfection Methods
CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the
More informationGenome editing. Knock-ins
Genome editing Knock-ins Experiment design? Should we even do it? In mouse or rat, the HR-mediated knock-in of homologous fragments derived from a donor vector functions well. However, HR-dependent knock-in
More informationApplications of Cas9 nickases for genome engineering
application note genome editing Applications of Cas9 nickases for genome engineering Shuqi Yan, Mollie Schubert, Maureen Young, Brian Wang Integrated DNA Technologies, 17 Commercial Park, Coralville, IA,
More informationUser Instructions:Transfection-ready CRISPR/Cas9 Reagents. Target DNA. NHEJ repair pathway. Nucleotide deletion. Nucleotide insertion Gene disruption
User Instructions:Transfection-ready CRISPR/Cas9 Reagents Background Introduction to CRISPR/Cas9 genome editing In bacteria and archaea, clustered regularly interspaced short palindromic repeats (CRISPR)
More informationCRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing
CRISPR/Cas9: Tools and Applications for Eukaryotic Genome Editing Fei Ann Ran Broad Institute Cambridge, Massachusetts ran@fas.harvard.edu I will provide some background on the CRISPR/Cas9 technology,
More informationYou use the UCSC Genome Browser (www.genome.ucsc.edu) to assess the exonintron structure of each gene. You use four tracks to show each gene:
CRISPR-Cas9 genome editing Part 1: You would like to rapidly generate two different knockout mice using CRISPR-Cas9. The genes to be knocked out are Pcsk9 and Apoc3, both involved in lipid metabolism.
More informationImproving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm
Improving CRISPR-Cas9 Gene Knockout with a Validated Guide RNA Algorithm Anja Smith Director R&D Dharmacon, part of GE Healthcare Imagination at work crrna:tracrrna program Cas9 nuclease Active crrna is
More informationGetting started with CRISPR: A review of gene knockout and homology-directed repair
Getting started with CRISPR: A review of gene knockout and homology-directed repair Justin Barr Product Manager, Functional Genomics Integrated DNA Technologies 1 Agenda: Getting started with CRISPR Background
More informationSupplementary Materials
Supplementary Materials Supplementary Methods Supplementary Discussion Supplementary Figure 1 Calculated frequencies of embryo cells bearing bi-allelic alterations. Targeted indel mutations induced by
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationGenome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.
TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome
More informationLectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
More informationHumanized Cas9 endonuclease expression lentivirus for CRISPR. Cat# Product Name Amounts
Humanized Cas9 endonuclease expression lentivirus for CRISPR Cat# Product Name Amounts LVP681 LVP681-PBS LVP682 LVP682-PBS LVP683 LVP683-PBS LVP678 LVP678-PBS LVP679 LVP679-PBS LVP680 LVP680-PBS LVP707
More informationCRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology. Tips for Planning Your CRISPR/Cas9 Experiments
CRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology Tips for Planning Your CRISPR/Cas9 Experiments feature article CRISPR/Cas9 and Targeted Genome Editing: A New Era in Molecular Biology
More informationInnovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050
Innovative Trait Development Tools in Plant Breeding will be Crucial for Doubling Global Agricultural Productivity by 2050 Greg Gocal, Ph.D., Senior Vice President, Research and Development CRISPR Precision
More informationGroups of new plant breeding techniques
WORKSHOP COMPERATIVE SITUATION OF NEW PLANT BREEDING TECHNIQUES 12-13 SEPTEMBER 2011 SEVILLE, SPAIN Groups of new plant breeding techniques Maria Lusser Joint Research Centre, European Commission Workshop
More informationApplication Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors
Application Note: Generating GFP-Tagged Human CD81 Tetraspanin Protein Using SBI s PrecisionX SmartNuclease System And HR Tagging Vectors Table of Contents: I. Background Pg. 1 II. Analysis of Gene Target
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationWebinar: Genome Editing using Nucleofector Technology
Pharma&Biotech BioResearch Webinar: Genome Editing using Nucleofector Technology Efficient Transfection of ZFN, TALEN and CRISPR/Cas In collaboration with: Lonza Walkersville, Inc., Walkersville, MD 21793
More informationOptimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing
Optimized, chemically-modified crrna:tracrrna complexes for CRISPR gene editing Mark Behlke MD, PhD Chief Scientific Officer February 24, 2016 1 Implementing CRISPR/Cas9 gene editing 2 To focus on RNA
More informationNew methods for gene engineering in animals
New methods for gene engineering in animals Technical Journal Club Special Series on Laboratory Animal Science Caihong Zhu 07.06.2016 Overview I. Definition of gene engineering II. History of gene engineering
More informationSequence Annotation & Designing Gene-specific qpcr Primers (computational)
James Madison University From the SelectedWorks of Ray Enke Ph.D. Fall October 31, 2016 Sequence Annotation & Designing Gene-specific qpcr Primers (computational) Raymond A Enke This work is licensed under
More informationUse of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.
Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred
More informationMouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology
Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions
More informationGenome Editing using Nucleofector Technology Technical Reference Guide
BioResearch Genome Editing using Nucleofect Technology Technical Reference Guide This guideline provides a brief background on various genome editing tools and describes how to establish Lonza s Nucleofect
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationRecently developed genomic editing
doi:10.1038/mt.2015.54 Genome Editing Technologies: Defining a Path to Clinic Genomic Editing: Establishing Preclinical Toxicology Standards Bethesda, Maryland 10 June 2014 Jacqueline Corrigan-Curay 1,
More informationSite-directed Mutagenesis
Site-directed Mutagenesis Applications Subtilisin (Met à Ala mutation resistant to oxidation) Fluorescent proteins Protein structure-function Substrate trapping mutants Identify regulatory regions/sequences
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationEfficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage
Zhang et al. Genome Biology (2017) 18:35 DOI 10.1186/s13059-017-1164-8 RESEARCH Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage Jian-Ping Zhang
More informationRescue of high-specificity Cas9 variants using sgrnas with matched 5 nucleotides
Kim et al. Genome Biology (2017) 18:218 DOI 10.1186/s13059-017-1355-3 METHOD Rescue of high-specificity Cas9 variants using sgrnas with matched 5 nucleotides Sojung Kim 1, Taegeun Bae 1,2, Jaewoong Hwang
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationProtocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection
Protocol for cloning SEC-based repair templates using Gibson assembly and ccdb negative selection Written by Dan Dickinson (daniel.dickinson@austin.utexas.edu) and last updated January 2018. A version
More informationCRISPR Applications: Mouse
CRISPR Applications: Mouse Lin He UC-Berkeley Advantages of mouse as a model organism similar to human Can be genetically manipulated Isogenic and congenic genetic background An accelerated lifespan. Well-characterized
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More informationTALEN and CRISPR/Cas Genome Editing Systems: Tools of Discovery
TALEN and CRISPR/Cas Genome Editing Systems: Tools of Discovery A. A. Nemudryi 1,2,3,, K. R. Valetdinova 1,2,3,4,, S. P. Medvedev 1,2,3,4, S. M. Zakian 1,2,3,4* 1 Institute of Cytology and Genetics, Siberian
More informationVersatility and performance of Lipofectamine Stem Transfection Reagent
PPLICTION NOTE Stem Transfection Reagent Versatility and performance of Stem Transfection Reagent Introduction The ability of stem cells to self-renew and differentiate into various specialized cell types
More informationBen- Shahar Lab CRISPR/RMCE Protocol May 2015
Ben- Shahar Lab CRISPR/RMCE Protocol May 2015 1. Before you begin a. Useful CRISPR overview for beginners: https://www.addgene.org/crispr/guide/ b. This protocol combines techniques described in these
More informationFatchiyah
Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing
More informationDefining and improving the genomewide specificities of CRISPR Cas9 nucleases
APPLICATIONS OF NEXT-GENERATION SEQUENCING Defining and improving the genomewide specificities of CRISPR Cas9 nucleases Shengdar Q. Tsai and J. Keith Joung Abstract CRISPR Cas9 RNA-guided nucleases are
More informationMouse Genetic Engineering David Ornitz Department of Developmental Biology
Mouse Genetic Engineering David Ornitz Department of Developmental Biology Novosibirsk, Russia Time line for mouse genetic engineering Development of chimeras between embryos with different genotypes Genetically
More informationPrimePCR Assay Validation Report
Gene Information Gene Name SRY (sex determining region Y)-box 6 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SOX6 Human This gene encodes a member of the
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More informationAlt-R CRISPR-Cas9 System:
genome editing user guide Alt-R CRISPR-Cas9 System: Cationic lipid delivery of CRISPR ribonucleoprotein complex into mammalian cells See what more we can do for you at www.idtdna.com. For Research Use
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationProtocol for tissue-specific gene disruption in zebrafish
Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationExpanding the genetic editing tool kit: ZFNs, TALENs, and CRISPR-Cas9
Review The Journal of Clinical Investigation Expanding the genetic editing tool kit: ZFNs, TALENs, and CRISPR-Cas9 Rajat M. Gupta and Kiran Musunuru Department of Stem Cell and Regenerative Biology, Harvard
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationMCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
More informationSome types of Mutagenesis
Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine
More informationGenome Engineering and Haploid Technology in Crop Plants
Genome Engineering and Haploid Technology in Crop Plants Jochen Kumlehn Plant Reproductive Biology Leibniz Institute of Plant Genetics and Crop Plant Research (IPK) Gatersleben Genetic modifications in
More informationPlant Genome Modification Technologies and Applications Amitabh Mohanty DuPont Pioneer
Plant Genome Modification Technologies and Applications Amitabh Mohanty DuPont Pioneer International Conference on New Plant Breeding Molecular Technologies Technology Development And Regulation, Oct 9-,
More informationHighly efficient genome engineering in flowering plants ~ Development of a rapid method to knockout genes in Arabidopsis thaliana ~
Highly efficient genome engineering in flowering plants ~ Development of a rapid method to knockout genes in Arabidopsis thaliana ~ December 5, 2016 Plant biologists at ITbM, Nagoya University have developed
More informationSupplemental Protocols Gagnon et al., 2014
Last updated April 15th 2014 There may be a more up-to-date version of this protocol on our website http://labs.mcb.harvard.edu/schier/index.html Protocol Page Flowchart for Cas9-mediated mutagenesis 1
More informationTALENs and CRISPR/Cas9 for Rice-Genome Editing
TALENs and CRISPR/Cas9 for Rice-Genome Editing Bing Yang Iowa State University Ames, Iowa byang@iastate.edu Rice, Oryza sativa L., is an important staple crop that feeds more than half of the world s population.
More informationCRISPR RNA-guided activation of endogenous human genes
CRISPR RNA-guided activation of endogenous human genes The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published Version
More informationNucleosome Positioning and Organization Advanced Topics in Computa8onal Genomics
Nucleosome Positioning and Organization 02-715 Advanced Topics in Computa8onal Genomics Nucleosome Core Nucleosome Core and Linker 147 bp DNA wrapping around nucleosome core Varying lengths of linkers
More informationPHENOTYPIC characterization of mutations is the most
REVIEW GENETICS TOOLBOX A Mouse Geneticist s Practical Guide to CRISPR Applications Priti Singh, John C. Schimenti, 1 and Ewelina Bolcun-Filas Department of Biomedical Sciences, Cornell University, Ithaca,
More informationLarge scale genome editing for. Senior Scientist, GenScript
Large scale genome editing for metabolic engineering of E. coli YifanLi Li, Ph.D PhD Senior Scientist, GenScript Metabolic engineering Cell factory Remove inhibition Substrate Overexpressing pathway genes
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationGenome-wide Target Specificity of CRISPR
Genome-wide Target Specificity of CRISPR Jin-Soo Kim Dept of Chemistry, Seoul National Univ. Center for Genome Engineering, Institute for Basic Science http://gel.snu.ac.kr 1 Programmable Nucleases CRISPR/Cas-derived
More informationGenome Editing Technology - Principle -
Effective Date: 31.10.2017 Doc ID: 20290213 Version: 1.0 Status: Approved Planned Effective Date: 31-Oct-2017 00:00 CET (Server Date) Genome Editing Technology - Principle - Rationale Genome editing is
More informationSynthetic Biology TOOLS TO SUPPORT DESIGN AND ASSEMBLY
Synthetic iology TOOLS TO SUPPORT DESIGN ND SSEMLY 0 0 0 SYNTHETIC IOLOGY Synthetic iology Tools to support design and assembly The goal of synthetic biology, in which genes and proteins are viewed as
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationPrimePCR Assay Validation Report
Gene Information Gene Name laminin, beta 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID LAMB3 Human The product encoded by this gene is a laminin that
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationjetcrispr RNP transfection reagent PROTOCOL
jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationEnhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationProtocols for cloning SEC-based repair templates using SapTrap assembly
Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a
More informationPrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
More informationCompoZr Transporter Knockout Cell Lines
biotransport CompoZr Transporter Knockout Cell Lines Assessment of Substrates with Functionally Knocked Out Transporters MDR1, BCRP and MRP2 biotransport CompoZr Transporter Knockout Cell Lines The Increasing
More informationBIOHAZARD RISK ASSESSMENT
BIOHAZARD RISK ASSESSMENT NAME: DATE: TITLE OF ACTIVITY OR PROJECT: BRIEF DESCRIPTION OF THE BIOLOGICAL AND ITS TREATMENT: DURATION OF ACTIVITY OR PROJECT: FACILITY TO BE USED (Campus, Building and Room
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
More informationPrecisionX Multiplex grna Cloning Kit. Cat. # CAS9-GRNA-KIT. User Manual
PrecisionX Multiplex grna Cloning Kit Store at -20 C upon receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing
More informationChapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
More informationTargeted modification of gene function exploiting homology directed repair of TALENmediated double strand breaks in barley
Targeted modification of gene function exploiting homology directed repair of TALENmediated double strand breaks in barley Nagaveni Budhagatapalli a, Twan Rutten b, Maia Gurushidze a, Jochen Kumlehn a,
More informationOptimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University
Optimization of RNAi Targets on the Human Transcriptome Ahmet Arslan Kurdoglu Computational Biosciences Program Arizona State University my background Undergraduate Degree computer systems engineer (ASU
More informationReview Article Is BAC Transgenesis Obsolete? State of the Art in the Era of Designer Nucleases
Journal of Biomedicine and Biotechnology Volume 2012, Article ID 308414, 5 pages doi:10.1155/2012/308414 Review Article Is BAC Transgenesis Obsolete? State of the Art in the Era of Designer Nucleases J.
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationQuick reference guide
Quick reference guide Our Invitrogen GeneArt CRISPR Search and Design Tool allows you to search our database of >600,000 predesigned CRISPR guide RNA (grna) sequences or analyze your sequence of interest
More informationQuantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationDesigning TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0
Designing TaqMan MGB Probe and Primer Sets for Gene Expression Using Primer Express Software Version 2.0 Overview This tutorial details how a TaqMan MGB Probe can be designed over a specific region of
More informationAntisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationExamining the Nucleotide Preference of the Linker Domain in Engineered Tev-mTALENs
Western University Scholarship@Western Electronic Thesis and Dissertation Repository September 2015 Examining the Nucleotide Preference of the Linker Domain in Engineered Tev-mTALENs Brendon C. McDowell
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationA CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish
Developmental Cell Supplemental Information A CRISPR/Cas9 Vector System for Tissue-Specific Gene Disruption in Zebrafish Julien Ablain, Ellen M. Durand, Song Yang, Yi Zhou, and Leonard I. Zon % larvae
More information