MICROBIOTA: FROM MICROBIOME TO FUNCTIONS. Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014
|
|
- Roxanne McKinney
- 6 years ago
- Views:
Transcription
1 MICROBIOTA: FROM MICROBIOME TO FUNCTIONS Atelier «Outils et modèles d étude du microbiote Intestinal» LYONBIOPÔLE/CENS 17 Novembere 2014 Artem Khlebnikov Microbiota The new frontier of biomedicine 2000, Human Genome 2010, Human Microbiome $3,8B investment drove $796B in economic impact 310,000 jobs? Source: Economic impact of the human Genome Project, Battelle Technology, May
2 Next Challenge For every question, a right technology Source: Computational meta'omics for microbial community studies, Segata N et al. Mol Syst Biol 2013;9:666 3 BIOASTER Technology Institute Snapshot The world s first technology institute in infectious diseases and microbiology An open innovation alliance between industry and academic research leaders A unique mission: create disruptive technologies that could radically improve the way people prevent, diagnose and treat microbial-related diseases. A team of experts in life sciences and engineering that conducts crossdisciplinary public-private R&D programs An independent non profit organization that reinvests all its earnings in innovation 4 2
3 Collaborative Approach A comprehensive offer 1 objective 4 targeted areas 5 key assets Solving technology bottlenecks met by industrial partners & SMEs Antimicrobials Vaccines Diagnostics Pre/Probiotics In-house & academic partners scientific expertise Cutting edge technologies Project management Financial leverage Independent meeting place for cross - collaborations 5 Laboratories & Offices A rapid rise PARIS, Institut Pasteur o 600 m 2, (250 m 2 BSL 1 & BSL2 Labs) LYON, Charles Mérieux & La Doua campuses o 820 m2 (390 m2 BSL1 and BSL2 Labs) o Access to the BSL4 Jean Mérieux Lab 2014 BIOASTER 1 o New Facilites in Lyon o 3600 m2 (labs 2200 m2, BSL1, BSL2 and BSL3) o Access to the BSL4 Jean Mérieux Lab Q
4 A New Age of Open Innovation A unique place for collaboration Technology one stop shop Scientific one stop shop Financial one stop shop One point access to technology toolbox 7 technology platforms A highly collaborative and interdisciplinary environment Academic research leaders World class network Expert team combining PhD, MD & PharmD, hundreds of publications and patents Co-investment in R&D projects proposed by partners French government commitment sharing the risk of disruptive innovation Contribution to EU-funded projects 7 Technological Approach For each problem the right combination MULTI-OMICS MULTI-PARAMETRIC DATA INTEGRATION & ANALYSIS The right technology/analysis for each problem faced the development of antimicrobials, vaccines, diagnostics, pre/probiotics PREDICTIVE MODELS 8 4
5 Microbiota Technology focus GENOMICS De novo genome sequencing Targeted/Shotgun Metagenomics TRANSCRIPTOMICS Metatranscriptomics ANIMAL MODELS Controlled rodents MICROBIOTA DATA STORAGE & COMPUTING Multi-parameter data integration PROTEOMICS Top-down & bottom-up proteomics METABOLOMICS Untargeted & targeted metabolomics (fluxomics, lipidomics) 9 Genomics & Transcriptomics TECHNOLOGY APPLICATIONS Genomics & Transcriptomics 454 GS J PGM MiSeq Proton C1 GeneChip System MICROBIAL GENOMICS Small genomes TRANSCRIPTOMICS Qubit DropSense TapeStation Molecular biology 1 Manager 1 Engineer 1 Technician CCIN2P3 StepOne RESOURCES BSL 2 + (100 m 2 ) Biomark ncounter Bioinformatics 3 Engineers Statistics 1 Biostatistician De novo Resequencing Q Assembly/Mapping Variant Calling Variant Annotation Genome annotation Target Metagenomics WGS Q Q Taxonomic annotation Community structure analyses Functional analyses Pathway analyses CONTACT Frederic Reynier, PhD, frederic.reynier@bioaster.org Manager Genomics and Transcriptomics Core facility Phone: +33 (0) / +33 (0) BIOASTER, Domilyon, 321, avenue Jean Jaurès, Lyon Host/ pathogens Q Gene expression analysis Novel transcripts identification Novel isoforms Alternative splice sites Rare transcripts 10 5
6 Animal models & imaging Animal models & imaging Capabilities/Technologies APPLICATIONS Microbiota : Controlled intestinal Malnutrition Obesity Inflammatory Bowel Diseases Q Quantification, virulence, bacterial transformation Infectious diseases mouse models : Nosocomial Infection Zoonosis Q Different Animal models / routes of inoculation: IV IN SC IM Ins: RESOURCES 1 Manager 2Animal Techs, Lyon + 2 Animal Techs, Lyon 1 Engineer, Lyon + 1 Engineer, Lyon BSL2 BSL3 1 Engineer, Paris 1 Animal Tech, Paris CONTACT Andrea Tamellini, DVM, andrea.tamellini@bioaster.org Manager Animal models & imaging Core facility Phone: +33 (0) / +33 (0) BIOASTER, Domilyon, 321 avenue Jean Jaurès, Lyon Q Data storage & high performance computing TECHNOLOGY APPLICATIONS Data storage and high performance computing High throughput analysis Q Machine specific analysis Workflow development Workstation on demand Bioinformatic services RESOURCES 1 Manager Critical services Highly secure computing 1 System Admininistrator, Lyon 1 Support engineer, Lyon 1 Dev. Engineer, Lyon 1 System Administrator, Paris 1 Dev. engineer Paris Q CONTACT Nicolas Sapay, PhD, nicolas.sapay@bioaster.org Support engineer Information technology, bioinformatics & systems biology Phone: +33 (0) / +33 (0) BIOASTER, Domilyon, 321 avenue Jean Jaurès, Lyon 12 6
7 Metabolomics & Proteomics TECHNOLOGY APPLICATIONS Metabolomics & Proteomics Proteomics Partners METABOLOMICS FLUXOMICS Posttranslational Modifications TARGETED UNTARGETED MTA Finger printing Metabolite Profiling LIPIDOMICS Identification RESOURCES 1 Manager PROTEOMICS Quantification Characterization Sample preparation & Automation Proteomics Partners 1 MS Engineer 1 Technician 1 MS lab 1 NMR lab 1 NMR Engineer 1 Bioinformatician Biosafety Environment P2 & P3 (2015) CONTACT Frédéric Béquet, PhD, frederic.bequet@bioaster.org Manager Metabolomics & Proteomics Corefacility Phone: +33 (0) / +33 (0) BIOASTER, ISA, 5 rue de la Doua, Villeurbanne 13 Microbiota profiling Integrated applications in metagenomics, from clinical sample to data analysis Genomics & Transcriptomics Characterized Unknown DNA ISOLATION PROTOCOLS DNA/RNA extraction from stool, blood and saliva samples 16S sample analysis Workflow DATA ANALYSIS 16S sequence data analysis Bioinformatics/statistics specialists Automated pipelines Visualization tools MULTIPLE NGS PLATFORMS 16S sample analysis with MiSeq, PGM or 454 GS FLX COMPUTING INFRASTUCTURE Partnership with CNRS-CCIN2P3 Access to the computer farm and cloud infrastructures Access to the file storage and database clusters DUAL-INDEX SEQUENCING STRATEGY Capable to multiplex up to 384 samples in one MiSeq run 14 7
8 Microbiota profiling Integrated applications in metabolomics, from clinical sample to data analysis Unknown FULLY AUTOMATED SAMPLE PREPARTION Stool, blood samples Characterized Metabolomics Workflow DATA INTEGRATION Metabolite confirmation Structure elucidation Metabolomics & Proteomics GLOBAL METABOLOMICS ANALYTICS NMR,CE-MS,HRMS-MS/MS NMR HRMS MS/MS CE MS Metabolite Profiling Metabolic Fingerprinting COMPUTING INFRASTUCTURE Partnership with CNRS-CCIN2P3 Access to the computer farm and cloud infrastructures Access to the file storage and database clusters DATA ANALYSIS State of the art chemometric tools in house development & analysts Visualization tools 15 PROJECT Controlled Microbiota Lactobacilli probiotic validation Immune system Gut interface Metabolism Probiotic to evaluate NUTRITION INTESTINAL MICROBIOME PROBIOTICS Develop a controlled murine model Provide experimental evidence underlying allegations for the use of Lactobacilli probiotic for nutritional intervention to promote juvenile growth in population at risk of protein malnutrition Reproduction Life Science Company Standard Microbiota Germ free Controlled Microbiota Status: Execution 16 8
9 FIND US AT 9
Microbial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Alla L Lapidus, Ph.D. SPbSU St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as "the study of
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Explore the Ion S5 and Ion S5 XL Systems Adopting next-generation sequencing (NGS) in your lab is now simpler than ever The Ion S5
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationThe Integrated Biomedical Sciences Graduate Program
The Integrated Biomedical Sciences Graduate Program at the university of notre dame Cutting-edge biomedical research and training that transcends traditional departmental and disciplinary boundaries to
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More information2014 APHL Next Generation Sequencing (NGS) Survey
APHL would like you to complete the Next Generation Sequencing (NGS) in Public Health Laboratories Survey. The purpose of this survey is to collect information on current capacities for NGS testing and
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationA Novel Approach to BSL-4 Research: Establishing a Clinical Core Services Group in High Containment
A Novel Approach to BSL-4 Research: Establishing a Clinical Core Services Group in High Containment Catherine M. Jett, Contractor Tunnell Government Services, Inc. Integrated Research Facility, Frederick,
More informationEmerging Focus. Nutrigenomics. Department of Nutritional Sciences Faculty of Life Sciences
Emerging Focus Nutrigenomics Emerging Focus Nutrigenomics The Emerging Focus Nutrigenomics A New Research Group at the of the University of Vienna Overview Nutrigenomics is the study of the response of
More informationGrowing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend
Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel
More informationApplied Blue Biotechnology Master
Applied Blue Biotechnology Master 1/8 Applied Blue Biotechnology Master Field : Sciences, Technologies, Santé Initial training Continuing training Block/release program 60 ECTS credits 2 semesters Course
More information+ + + MALARIA HIV/AIDS TUBERCULOSIS LEISHMANIASIS CHAGAS DISEASE DENGUE EBOLA ZIKA
At the Center for Infectious Disease Research, we use systems biology approaches and cutting-edge technologies to accelerate the development of life-saving drugs, diagnostics and treatments for the world
More informationSmart India Hackathon
TM Persistent and Hackathons Smart India Hackathon 2017 i4c www.i4c.co.in Digital Transformation 25% of India between age of 16-25 Our country needs audacious digital transformation to reach its potential
More informationWELCOME. Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS)
WELCOME Norma J. Nowak, PhD Executive Director, NY State Center of Excellence in Bioinformatics and Life Sciences (CBLS) Director, UB Genomics and Bioinformatics Core (GBC) o o o o o o o o o o o o Grow
More informationHuman Microbiome Project: First Map of the World Within Us. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Human Microbiome Project: First Map of the World Within Us Immune disorders: The new epidemic Gut microbiota: health and disease Disease Health Human Microbiome Project: The concept of superorganism :
More informationMarie Skłodowska-Curie European Fellowship
Marie Skłodowska-Curie European Fellowship Expression of Interest Application Form 2017 This form must be completed for Expressions of Interest (EoIs) to the Marie Skłodowska-Curie European Fellowship
More informationMay Microbiome Modulation. Assaf Oron, CBO Biomed Conference Tel Aviv, May 2017
May 2017 Microbiome Modulation Assaf Oron, CBO Biomed Conference Tel Aviv, May 2017 Microbiome A revolutionary cure Linda, lives in California 2010 Was treated with antibiotics due to a severe urinary
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationBioinformatics and computational tools
Bioinformatics and computational tools Etienne P. de Villiers (PhD) International Livestock Research Institute Nairobi, Kenya International Livestock Research Institute Nairobi, Kenya ILRI works at the
More informationMETAGENOMICS. Aina Maria Mas Calafell Genomics
METAGENOMICS Aina Maria Mas Calafell Genomics Introduction Microbial communities Primary role in biogeochemical systems Study of microbial communities 1.- Culture-based methodologies Only isolated microbes
More informationBioinformatics Specialist
Bioinformatics Specialist At a Glance Bioinformatics specialists use their knowledge of computers and math to collect, analyze, and store biological data. Search by Cluster Computers & Telecom Science
More informationOutline and learning objectives. From Proteomics to Systems Biology. Integration of omics - information
From to Systems Biology Outline and learning objectives Omics science provides global analysis tools to study entire systems How to obtain omics - What can we learn Limitations Integration of omics - In-class
More informationIon S5 and Ion S5 XL Systems
Ion S5 and Ion S5 XL Systems Targeted sequencing has never been simpler Introducing the Ion S5 and Ion S5 XL systems Now, adopting next-generation sequencing in your lab is simpler than ever. The Ion S5
More informationMICROBIOMICS Current and future tools of the trade
MICROBIOMICS Current and future tools of the trade Ingeborg Klymiuk Core Facility Molecular Biology ZMF - CENTER FOR MEDICAL RESEARCH Medical University Graz MICROBIOMICS DEFINITION OF OMIC TECHNOLOGIES
More informationThe Institute of Microbiology of the Czech Academy of Sciences is looking for. four POSTDOCTORAL FELLOW positions in the fields of:
4 Postdoctoral Fellow positions in microbiology, molecular biology and ecology The Institute of Microbiology of the Czech Academy of Sciences, Prague, Czech Republic The Institute of Microbiology of the
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationCurrent and emerging services in proteomics and metabolomics through the Center for Mass Spectrometry and Proteomics
Current and emerging services in proteomics and metabolomics through the Center for Mass Spectrometry and Proteomics Pratik Jagtap, PhD Managing Director, CMSP z.umn.edu/cmsppresents Who are we? Center
More informationE2ES to Accelerate Next-Generation Genome Analysis in Clinical Research
www.hcltech.com E2ES to Accelerate Next-Generation Genome Analysis in Clinical Research whitepaper April 2015 TABLE OF CONTENTS Introduction 3 Challenges associated with NGS data analysis 3 HCL s NGS Solution
More informationSequencing the Astronaut Microbiome. Hernán Lorenzi PhD. July 17 th, 2014 The J. Craig Venter Institute
Sequencing the Astronaut Microbiome Hernán Lorenzi PhD. July 17 th, 2014 The J. Craig Venter Institute The human microbiome, an organ within the human body Number of cells Number of genes A healthy human
More informationIMGM Laboratories GmbH. Sales Manager
IMGM Laboratories GmbH Dr. Jennifer K. Kuhn Sales Manager About IMGM Laboratories IMGM Laboratories was founded in 2001 IMGM operates as professional provider of advanced genomic services from research
More informationThe Five Key Elements of a Successful Metabolomics Study
The Five Key Elements of a Successful Metabolomics Study Metabolomics: Completing the Biological Picture Metabolomics is offering new insights into systems biology, empowering biomarker discovery, and
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationAn introduction into 16S rrna gene sequencing analysis. Stefan Boers
An introduction into 16S rrna gene sequencing analysis Stefan Boers Microbiome, microbiota or metagenomics? Microbiome The entire habitat, including the microorganisms, their genomes (i.e., genes) and
More informationNATIONAL INSTITUTE OF ANIMAL BIOTECHNOLOGY (NIAB)
Advertisement No 1/2014 NATIONAL INSTITUTE OF ANIMAL BIOTECHNOLOGY (NIAB) (An Autonomous Institute of the Dept. of Biotechnology, Ministry of Science & Technology, Government of India) D. No. 1-121/1,
More informationELIXIR-GREECE Babis Savakis ELIXIR-GREECE kick-off meeting NHRF, Athens 18 May 2018
ELIXIR-GREECE Babis Savakis ELIXIR-GREECE kick-off meeting NHRF, Athens 18 May 2018 www.elixir-greece.org ELIXIR Membership ELIXIR-Greece CERTH U. of Thessaloniki U. of Ioannina Thessaloniki Alexandroupolis
More informationBBMRI.NL A story of Sharing Eline Slagboom Molecular Epidemiology, Leiden University Medical Center Brussel 20 Juni 2017
BBMRI.NL A story of Sharing Eline Slagboom Molecular Epidemiology, Leiden University Medical Center Brussel 20 Juni 2017 BBMRI-NL TOWARDS A NATIONAL BIOBANKING INFRASTRUCTURE Founded in 2009 as the Dutch
More informationLeonardo Mariño-Ramírez, PhD NCBI / NLM / NIH. BIOL 7210 A Computational Genomics 2/18/2015
Leonardo Mariño-Ramírez, PhD NCBI / NLM / NIH BIOL 7210 A Computational Genomics 2/18/2015 The $1,000 genome is here! http://www.illumina.com/systems/hiseq-x-sequencing-system.ilmn Bioinformatics bottleneck
More informationInfectious Disease Omics
Infectious Disease Omics Metagenomics Ernest Diez Benavente LSHTM ernest.diezbenavente@lshtm.ac.uk Course outline What is metagenomics? In situ, culture-free genomic characterization of the taxonomic and
More informationMicrogravity Alters Host Immune Responses in vitro: Pan-omics Approaches
Microgravity Alters Host Immune Responses in vitro: Pan-omics Approaches Nabarun Chakraborty Integrative System Biology Program US Army Center for Environmental Health Research Fort Detrick, MD, 21702
More informationGoals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
More informationTrans-omics for a better life
Trans-omics for a better life History From 1% to World Leading The largest genomic organization in the world Focus on research and applications in the healthcare, agriculture, conservation, and environmental
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationDNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
More informationProteomics and Cancer
Proteomics and Cancer Japan Society for the Promotion of Science (JSPS) Science Dialogue Program at Niitsu Senior High School Niitsu, Niigata September 4th 2006 Vladimir Valera, M.D, PhD JSPS Postdoctoral
More informationMaximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y. Report Price Publication date
F o r a c l e a r e r m a r k e t p e r s p e c t i v e Early Stage Drug Safety Strategies & Risk Management Maximizing opportunities towards achieving clinical success D R U G D I S C O V E R Y Report
More informationMICROBIO, IMMUN, PATHOLOGY-MIP (MIP)
Microbio, Immun, Pathology-MIP (MIP) 1 MICROBIO, IMMUN, PATHOLOGY-MIP (MIP) Courses MIP 101 Introduction to Human Disease (GT-SC2) Credits: 3 (3-0-0) Survey of human systems and diseases. Additional Information:
More informationTowards unbiased biomarker discovery
Towards unbiased biomarker discovery High-throughput molecular profiling technologies are routinely applied for biomarker discovery to make the drug discovery process more efficient and enable personalised
More informationRECRUITMENTS OF SCIENTISTS: DIRECT RECRUITMENT OR ON DEPUTATION. Areas of specialization as essential qualifications: [Advt. No.NABI/02/2017/Rectt.
National Agri-Food Biotechnology Institute (NABI) (Department of Biotechnology, Ministry of Science and Technology, Govt of India) Knowledge city, Sector-81, Mohali, (Punjab), India-140306 Web: www.nabi.res.in
More informationGenomic solutions for complex disease
Genomic solutions for complex disease Power your with our genomic solutions Access a breadth of applications. Gain a depth of insights. To enhance their understanding of complex disease, researchers are
More informationPersonalized Medicine
Personalized Medicine Dr. Pablo Mentzinis, Director Government Relations, SAP SE Courtesy by Dominik Bertram, Marc von der Linden, Péter Adorján, SAP June 2016 1. Traditional medicine vs. personalized
More informationBIOCRATES Life Sciences AG Short Company Presentation
BIOCRATES Life Sciences AG Short Company Presentation Dr. Alexandra C. Gruber MBA MMFin Director Business Development / Marketing Austria Showcase Life Science Japan, Tokyo, December 2010 BIOCRATES Life
More informationIntroducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration
Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration 1 2 Translational Informatics Overview Precision s suite of services is
More informationAdmera Health RUO Services
Admera Health RUO Services Services 1. RNA-Seq... 2 2. Single-cell RNAseq (scrna-seq)... 3 3. Whole Exome Sequencing (WES)... 4 4. Whole Genome Sequencing (WGS)... 5 5. Whole Genome Bisulfite Sequencing
More informationBiologics. Biologics. The Centre for Process Innovation. From innovation to commercialisation
Biologics Biologics The Centre for Process Innovation From innovation to commercialisation The Centre for Process Innovation From innovation to commercialisation The High Value Manufacturing Catapult is
More informationLecture 23: Metabolomics Technology
MBioS 478/578 Bioinformatics Mark Lange Lecture 23: Metabolomics Technology Definitions and Background Technologies Nuclear Magnetic Resonance Mass Spectrometry General Introduction Fourier-Transform Mass
More informationGENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)
TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS
More informationThe 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential
The 150+ Tomato Genome (re-)sequence Project; Lessons Learned and Potential Applications Richard Finkers Researcher Plant Breeding, Wageningen UR Plant Breeding, P.O. Box 16, 6700 AA, Wageningen, The Netherlands,
More informationGut microbial colonization in day old chicks. Henri Woelders DirkJan Schokker Mari A. Smits
Gut microbial colonization in day old chicks Henri Woelders DirkJan Schokker Mari A. Smits Trends Robustness; Resilience. Ability to keep healthy, or recover from disease (with minimal human intervention).
More informationBioinformatics Analysis of Nano-based Omics Data
Bioinformatics Analysis of Nano-based Omics Data Penny Nymark, Pekka Kohonen, Vesa Hongisto and Roland Grafström Hands-on Workshop on Nano Safety Assessment, 29 th September, 2016, National Technical University
More informationIBBL: Introduction to Biobanks and their services
IBBL: Introduction to Biobanks and their services HighTech meets Health, Oss (NL), 15 th June 2017 Monica Marchese, PhD Biomarker Validation Scientist AN ACCREDITED & CERTIFIED BIOBANK INFRASTRUCTURE FOR
More informationCarl Woese. Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life
METAGENOMICS Carl Woese Used 16S rrna to developed a method to Identify any bacterium, and discovered a novel domain of life His amazing discovery, coupled with his solitary behaviour, made many contemporary
More informationIntroduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER
MICROBIOLOGY 220 Spring 2014 TTh Section Professor: Scott Rose Text: Microbiology; An Introduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER Jan. 23 Introduction
More informationSingle Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time
More informationATIP Avenir Program 2018 Young group leader
ATIP Avenir Program 2018 Young group leader Important dates - October 17th (4 pm) 2017 : opening of the registrations online - November 23 th 2017: deadline for the online submission, the mailing of the
More informationUCF, College of Medicine BS Biotechnology MS Biotechnology/MBA Professional Science Masters Program in Biotechnology/MBA
UCF, College of Medicine BS Biotechnology MS Biotechnology/MBA Professional Science Masters Program in Biotechnology/MBA Dr. Henry Daniell Pegasus Professor & University Board of Trustee Chair Dept. Mol.
More informationMetagenomics of the Human Intestinal Tract
Metagenomics of the Human Intestinal Tract http://www.metahit.eu This presentation is licensed under the Creative Commons Attribution 3.0 Unported License available at http://creativecommons.org/licenses/by/3.0/
More informationBACKGROUNDER. Results of Genomics Technology Platforms 2016 Competition for Operations Support and Technology Development Funds
January 23, 2018 BACKGROUNDER Results of Genomics Technology Platforms 2016 Competition for Operations Support and Technology Development Funds Genome Canada and partners are pleased to invest approx.
More informationDepartment of Research Evaluation. Theory and Approaches of Genomics Complexity TAGC
Department of Research Evaluation report on the research unit: Theory and Approaches of Genomics Complexity TAGC under the supervision of the following institutions and research bodies: Aix-Marseille Université
More informationMicrobiology, Molecular Biology and Biochemistry
Microbiology, Molecular Biology and Biochemistry Bruce L. Miller, Interim Dept. Head, Dept. of Microbiology, Molecular Biology and Biochemistry (142 Life Sc. Bldg. 83844-3052; phone 208/885-7966; mmbb@uidaho.edu;
More informationExam MOL3007 Functional Genomics
Faculty of Medicine Department of Cancer Research and Molecular Medicine Exam MOL3007 Functional Genomics Tuesday May 29 th 9.00-13.00 ECTS credits: 7.5 Number of pages (included front-page): 5 Supporting
More informationGenomic Medicine in France
Genomic Medicine in France Catherine Nguyen, PhD Director ITMO GGB Genetic, Genomic & Bioinformatic Advancing Disease Modeling in Animal-Based research in Support of Precision Medecine: a Workshop ILAR
More informationPAREXEL GENOMIC MEDICINE SERVICES. Applying genomics to enhance your drug development journey
PAREXEL GENOMIC MEDICINE SERVICES Applying genomics to enhance your drug development journey YOUR JOURNEY. OUR MISSION. Genomic expertise to simplify the route to product approval and maximize patient
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationMulti-omics analysis powered by massive data integration
Multi-omics analysis powered by massive data integration RE(ACT) congress 08-02-2018 Kristina Hettne, PhD BioSemantics Group, Human Genetics LEIDEN UNIVERSITY MEDICAL CENTER Duchenne muscular dystrophy
More information13 th Annual Microbial Sciences Symposium
13 th Annual Microbial Sciences Symposium April 16, 2016 Knafel Gymnasium Radcliffe Institute for Advanced Studies Harvard University Cambridge, MA Microbial Sciences Initiative at Harvard Introduction
More informationAccess to Information from Molecular Biology and Genome Research
Future Needs for Research Infrastructures in Biomedical Sciences Access to Information from Molecular Biology and Genome Research DG Research: Brussels March 2005 User Community for this information is
More informationProduct selection guide Ion S5 and Ion S5 XL Systems
Product selection guide Ion S5 and s Cancer genomics research Molecular profiling Ion AmpliSeq Ready-to-Use Panels Ion AmpliSeq Comprehensive Cancer Panel Cat. No. 4477685 Ion AmpliSeq Made-to-Order Panels
More informationOverview of Health Informatics. ITI BMI-Dept
Overview of Health Informatics ITI BMI-Dept Fellowship Week 5 Overview of Health Informatics ITI, BMI-Dept Day 10 7/5/2010 2 Agenda 1-Bioinformatics Definitions 2-System Biology 3-Bioinformatics vs Computational
More informationMicrobiome Analysis. Research Day 2012 Ranjit Kumar
Microbiome Analysis Research Day 2012 Ranjit Kumar Human Microbiome Microorganisms Bad or good? Human colon contains up to 100 trillion bacteria. Human microbiome - The community of bacteria that live
More informationDeveloping an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL
Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That
More informationOMNIgene GUT stabilizes the microbiome profile at ambient temperature for 60 days and during transport
OMNIgene GUT stabilizes the microbiome profile at ambient temperature for 60 days and during transport Evgueni Doukhanine, Anne Bouevitch, Ashlee Brown, Jessica Gage LaVecchia, Carlos Merino and Lindsay
More informationUnderstanding life WITH NEXT GENERATION PROTEOMICS SOLUTIONS
Innovative services and products for highly multiplexed protein discovery and quantification to help you understand the biological processes that shape life. Understanding life WITH NEXT GENERATION PROTEOMICS
More informationDiagnostics gathering intelligence to fight antimicrobial resistance
Diagnostics gathering intelligence to fight antimicrobial resistance Arjon van Hengel European Commission DG Research and Innovation, Health Directorate Unit "Fighting Infectious Diseases and Advancing
More informationInnovative Technology and Its Contribution to Biobanking
Global Biobank Week Stockholm, September 13th - 15th, 2017 Innovative Technology and Its Contribution to Biobanking Kurt Zatloukal M.D. Institute of Pathology Medical University of Graz Austria Drivers
More informationKinase Activity: a total solution
Kinase Activity: a total solution Protein arrays for multiplex kinetic measurements Robust Instrumentation User friendly software Kinetic data at your fingertips! PamGene s novel platform for profiling
More informationMRC Stratified Medicine Initiative
MRC Stratified Medicine Initiative Jonathan Pearce Medical Research Council, Translational Programme Manager Pharmacogenetics and Stratified Medicine Network Conference : 14 th January 2015 Stratified
More informationFacilitating local production for improved access to in vitrodiagnostics. Tuberculosis. Ruth McNerney. Ruth McNerney & Rosanna Peeling
Tuberculosis Facilitating local production for improved access to in vitrodiagnostics Ruth McNerney & Rosanna Peeling Ruth McNerney London School of Hygiene & Tropical Medicine Department of Pathogen Molecular
More informationHow much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
More informationBIOLOGICAL BASIS OF PUBLIC HEALTH BMS505, Fall 2012 Syllabus
Course Director: BIOLOGICAL BASIS OF PUBLIC HEALTH BMS505, Fall 2012 Syllabus Location and meeting times Mo/We 10:30am 11:50am, George Auditorium Martin Tenniswood, PhD Department of Biomedical Sciences
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationCourse Descriptions. BIOL: Biology. MICB: Microbiology. [1]
Course Descriptions BIOL: Biology http://www.calendar.ubc.ca/vancouver/courses.cfm?code=biol [1] BIOL 112 (3) Biology of the Cell The principles of cellular and molecular biology using bacterial and eukaryotic
More informationUSING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS
USING HPC CLASS INFRASTRUCTURE FOR HIGH THROUGHPUT COMPUTING IN GENOMICS Claude SCARPELLI Claude.Scarpelli@cea.fr FUNDAMENTAL RESEARCH DIVISION GENOMIC INSTITUTE Intel DDN Life Science Field Day Heidelberg,
More informationTRANSFORMING GLOBAL GENETIC DATA INTO MEDICAL DECISIONS
TRANSFORMING GLOBAL GENETIC DATA INTO MEDICAL DECISIONS THE DOORS ARE OPEN: FEEL FREE TO COME IN CENTOGENE UNLOCKS THE POWER OF GENETIC INSIGHTS TO IMPROVE THE QUALITY OF LIFE OF PATIENTS WITH GENETIC
More informationMetagenomics in Medicine Towards Disease early Diagnosis and Personalized Treatment
Metagenomics in Medicine Towards Disease early Diagnosis and Personalized Treatment Mohamed El-Hadidi, PhD. Assistant Professor of Bioinformatics, CIT School, Nile University, Egypt. Head of Bioinformatics
More information2018 Media Kit. Table of Contents Click the links above to jump to the desired page
2018 Media Kit The American Society for Microbiology is the oldest and largest single life science membership organization in the world. Membership has grown from 59 scientists in 1899 to more than 39,000
More informationBSc Minors in English
BSc Minors in English Wageningen University Overview BSc Minors for Exchange Students All minors presented on this information sheet are taught in English. For more information please surf to: www.wageningenuniversity.nl/minors
More information