Introduction to Plant Genome and Gene Structure. Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC
|
|
- Alexandra Stokes
- 6 years ago
- Views:
Transcription
1 Introduction to Plant Genome and Gene Structure Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC
2 Defining genome Coined by Hans Winkler (1920) as genom(e) by joining gene and chromosome Lederberg and McCray (2001) defines Genome as the complete gene compliment or the total DNA amount per haploid chromosome set RGDU at Community of Practices CARDI June 18-21, 2007 (GCP_BIOTEC)
3 Brief history of genome size study in plants (Estimates of DNA amounts) Early studies are based on analysis of isolated nuclei or cell suspension Led to the use of the term C value (Swift 1950b) These studies dealt only with relative DNA contents and did not provide estimates of absolute DNA mass The first estimate of the absolute amount of DNA in the nuclear genome of a plant was done for Lilium species Genome size the mass (in picgrams,, pg - 1 ) of DNA per haploid nucleus
4 Brief history of genome size study in plants (Estimates of DNA amounts) (A) Zingeria biebersteiniana a monocot species with chromosome 2n = 4 (B) Voanioala gerardii a rainforest palm from Madagascar with a chromosome count of 2n = 600 MICHAEL D. BENNETT* Proc. Natl. Acad. Sci. USA Vol. 95,pp , March 1998
5 Brief history of genome size study in plants (Estimates of DNA amounts) Examples of DNA amounts and chromosome sizes. (A) Brachyscome dishrosomatica 2n = 4, 1c= 1,.1 pg (B) Myriophyllum spicatum 2n = 14, 1c = 0.3 pg (C) Fritillaria sp. 2n = 14, 1c = 65 pg (D) Selaginella kraussiana 2n = 40, 1c = 0.36 pg (E) Equisetum variegatum 2n = 216, 1c = 30.4 pg T. Ryan Gregory The evolution of the genome (2005)
6 Brief history of genome size study in plants (Main areas of focus in early genome size studies) Developing methods for estimating plant genome size and testing and proving their accuracy. Exploration of the ranges in genome size in different groups and at various taxonomic levels. Investigating genome size variation through the (a) mechanism responsible, (b) rates of change, and (c) evolutionary significance to resolve the so called C-C value paradox.
7 Brief history of genome size study in plants (Main areas of focus in early genome size studies) Constancy and the origin of the C-value DNA constancy hypothesis Swift (1950a) referred to classes of DNA as Class I being the common diploid value Class II as Class 1C value representing the haploid DNA content. C-value paradox the DNA/cell does not correspond to the total gene content of the organism
8 Brief history of genome size study in plants (Main areas of focus in early genome size studies) T. Ryan Gregory Paleobiology, 30(2), 2004, pp
9 Brief history of genome size study in plants (Impact of molecular revolution on genome size research) Molecular work on DNA sequences gave insight on the structure and content of individual genomes but at the same time have inhibitory effect on genome size research such as Strong emphasis on DNA C values per se began to fade and in 1980s s it was almost impossible to obtain grant funding to estimate genome size The revelation of repetitive DNA sequences believed to cause potential changes in copy number led to reports of substantial intraspecific variation (violating the rule of DNA constancy) such as those related to developmental, environmental and geographical factors. Led to the necessity of second wave of careful measurements proving that intraspecific variation is due to technichal artifacts are challenges posted to genome size researchers (
10 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Study of molecular basis of genome evolution in plants Allow investigation and comparison of different taxa (ex. subspecies indica and japonica)
11 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Allow investigation and comparison of different species within families (Oryza,, Sorghum, Zea)
12 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Allow investigation and comparison of difference between families (Poaceae( and Brassicaceae) Reveal the key molecular mechanisms involved in the gain and/or loss of DNA resulting in changes in genome size
13 Patterns in plant genome size evolution (The extent of variation in plant taxa)
14 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants) Repetitive DNA in plants is composed of transposable elements (TEs( TEs) Class I RNA-mediated mode of transposition Retrotransposons characterized by long terminal repeats (LTRs( LTRs) Retroposons lacks terminal repeats (non-ltr retroelements) ) and use reverse transcriptase to transpose through an RNA intermediate
15 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants)
16 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants) Repetitive DNA in plants is composed of transposable elements (TEs) Class II DNA- mediated mode of transposition Helitrons Mutator-like elements Miniature inverted repeat transposable elements (MITES)
17 How do plant genome sizes evolve? (What triggers the spread of transposable elements?) Transcriptional activation can be induced by experimental manipulations of various biotic and abiotic stresses like Wounding, tissue culture and disease attack Adaptation to water availability in Hordeum, (Vicient et al.1999a) rice (Jiang( et al. 2003)
18 How do plant genome sizes evolve? (What triggers the spread of transposable elements?) Polyploidization and interspecific hybridization may trigger TEs amplification in Nicotiana (Comai,, 2000)
19 How do plant genome sizes evolve? Satellite DNA Tandemly arranged repeats of identical or similar sequences Variable in size but the most common monomeric units are bp and bp Two smaller unit of satellite DNA Minisatellites (10-40 bp repeats) Microsatellites (2-6 bp repeats) (Satellite DNA)
20 How do plant genome sizes evolve? (Genome size increase by polyploidy) Polyploidy results from combining three or more basic chromosome sets or genomes in one nucleus Prominent mode of speciation C-value and basic genome size are not equivalent, thus C-value C must be indicated as 1Cx-value to indicate the basic genome size (Greilhuber( et al. 2005)
21 How do plant genome sizes evolve? (Mechanisms of genome size decrease) Unequal intrastrand homologous recombination Occurs between the long terminal repeats of LTR-retrotransposons that leads to the deletion of internal DNA segment Illegitimate recombination Recombination that does not require the participation of a reca protein or large (>50 bp) ) stretches of sequence homology Loss of DNA during the repair of double stranded breaks Often accompanied by DNA deletions
22 Intraspecific variation in genome size (Intraspecific variation and speciation) Speciation may occur without any change in C-value C and likewise, variation in DNA amount can also precede reproductive isolation and morphological diversification Speciation was thought to depend mainly on changes in informational genes. Comparative genomics revealed constancy in this part of the genome and non-coding sequences determine diversity and suggested to play major role in plant speciation.
23 Intraspecific variation in genome size (Intraspecific variation and speciation)
24 Intraspecific variation in genome size (Intraspecific variation and speciation)
25 Methodology for estimating genome size in plants (Complete genome sequencing) Arabidopsis thaliana dicot plant that was sequenced through the Arabidopsis Genome Initiative in 1997 and whose complete sequence was made public in 2000 The genome size was estimated as 125 megabases (Mb) based on the size of the sequenced regions (115.4 Mb) plus the roughly 10 Mb for the unsequenced centromere.
26 From DNA sequence to gene discovery
27 DNA
28 DNA DNA is a molecule which encodes genetic information. It is a long, coiled, double-stranded chain of interlocking base-pairs called a double-helix helix. There are four types of bases in DNA: A (adenine), T (thymine),, G (guanine),, and C (cytosine). The order of the bases in a DNA strand, called the sequence, creates a code for information: the DNA code 'ATC' has a different meaning than the code 'TCA,' and so on.
29 DNA Structure
30 DNA Structure
31 DNA Structure
32 DNA Structure
33 Central Dogma of Molecular Biology
34 Gene A gene is a section of the DNA strand that carries the instructions for a specific function. For example, the 'globin' globin' ' genes contain instructions for making the hemoglobin protein, which is the protein which allows our blood to carry oxygen throughout the body. Humans have about 50,000 different genes, which work together in complex ways to control much of what our bodies do. While we all have the same genes, there are different versions of many genes, called alleles. For example, while most people have genes which give them pigmented (coloured) eyes, there are multiple alleles for specific eye colors. Each person has particular combination of alleles for eye color, for hair color, etc.,, which makes him or her genetically unique.
35 Gene structure
36 Eukaryotic Gene Expression
37 Eukaryotic Gene Complexity Enhancers - A DNA element that strongly stimulates transcription of a gene or genes. Usually found upstream from the genes they influence.
38 Eukaryotic Gene Complexity Promoters a DNA sequence to which RNA polymerase binds prior to initiation of transcription. Usually found just upstream from the transcription start site of a gene.
39 Eukaryotic Gene Complexity 5 UTRs - A region of a gene which h is transcribed into mrna, becoming the 5' end of the message, but which does not contain protein coding sequence. The 5'-untranslated region is the portion of the DNA starting from the cap site and extending to the base just before the ATG translation initiation codon. While not itself translated, this region may have sequences which alter the translation efficiency of the mrna, or which affect the stability of the mrna
40 Eukaryotic Gene Complexity Introns - intervening sequences in the gene that are removed in the formation of the functional mrna. Usually includes noncoding sequence but there are instances of alternative processing where sequences can be both introns and exons.
41 Eukaryotic Gene Complexity Exons - sequences in the gene that are found in the functional mrna. Includes coding sequence but may also include non-coding sequence.
42 Eukaryotic Gene Complexity 3 UTR - A region of the DNA which is transcribed into mrna and becomes the 3' end or the message, but which does not contain protein coding sequence. Everything between the stop codon and the polya tail is considered to be 3' untranslated. The 3' untranslated region may affect the translation efficiency of the mrna or the stability of the mrna. It also has sequences which are required for the addition of the poly(a) tail to the message (including one known as the "hexanucleotide", AAUAAA).
43 Mutation Mutation - A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene.
44 Nature of mutations Substitution mutations - convert one type of base pair into another. G-C to A-T and A-T to G-C changes are referred to as transition mutations (replacement of a purine to pyrimidine base pair by a purine to pyrimidebase pair). G-C to C-G, G-C to T-A, A-T to T- A, and A-T to C-G are called transversions (replacement of a purine-pyrimidine base pair by a pyrimidinepurine base pair). Although transitions are more common than transversions, both kinds of mutations occur as a consequence of replication errors, both can result from chemical damage to DNA, and both have been implicated as causative factors in inherited genetic disease and cancer. Single nucleotide changes can change the codon to that of another amino acid, thus altering the protein. In addition, such changes can also create a stop codon
45 Nature of mutations
46 Small insertions/deletions - comprise a second relatively common class of mutation. Genetic changes of this sort involve insertion or loss of a small number of contiguous base pairs (one to several hundred). Nature of mutations
47 Nature of mutations
48 Nature of mutations
49 Nature of mutations
Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationMBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization
Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More information13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationLecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6
Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationWe have. Learned the structure of DNA. Talked about DNA replication and all of the complicated vocabulary that goes with it
Do Now 1. What enzyme inserts new DNA nucleotides during replication? 2. Name 2 other important players in DNA replication and their function. 3. In what direction can DNA polymerase add nucleotides? 4.
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationNUCLEIC ACIDS AND PROTEIN SYNTHESIS
NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationChapter 12 Reading Questions
Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationUnit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg
Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg 248-255 Which genes are transcribed on the chromosomes are carefully regulated at many points. Watch this! https://www.youtube.com/watch?v=oewozs_jtgk
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationHonors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless
Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationDNA & RNA. Chapter Twelve and Thirteen Biology One
DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine
More informationCHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationChapter 6 MOLECULAR BASIS OF INHERITANCE
Chapter 6 MOLECULAR BASIS OF INHERITANCE 1mark each 1. Why is the ADA enzyme required in our body? 2. Which is not required for polypeptide synthesis: Termination codon, mrna, peptidyl tranferase, rrna?
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationName Class Date. Practice Test
Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationMolecular Genetics Student Objectives
Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source
More informationHow does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger.
How does the human genome stack up? Organism Human (Homo sapiens) Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster) Yeast (S. cerevisiae) Bacterium
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationChapter 19. Control of Eukaryotic Genome. AP Biology
Chapter 19. Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationBiology Evolution Dr. Kilburn, page 1 Mutation and genetic variation
Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationChapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins
KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationSection 14.1 Structure of ribonucleic acid
Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationAlgorithms in Bioinformatics
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular
More informationOutline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage
Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationAP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?
The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationMolecular Genetics Quiz #1 SBI4U K T/I A C TOTAL
Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More informationDegenerate site - twofold degenerate site - fourfold degenerate site
Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationBiology Chapter 12 Test: Molecular Genetics
Class: Date: ID: A Biology Chapter 12 Test: Molecular Genetics True/False Indicate whether the statement is true or false. 1. RNA polymerase has to bind to DMA for an enzyme to be synthesized. 2. The only
More informationBIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More informationDNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base
DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationBiological Sciences 50 Practice Exam 2
NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.
More informationChapter 13: RNA and Protein Synthesis. Dr. Bertolotti
Chapter 13: RNA and Protein Synthesis Dr. Bertolotti Essential Question How does information flow from DNA to RNA to direct the synthesis of proteins? How does RNA differ from DNA? RNA and protein synthesis
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More information1/6/2014. Welcome Back! Do now:
Welcome Back! Do now: 1/6/2014 -Discuss with your shoulder partners What was your favorite thing you did over winter break? -Take out your EOC Sample Questions any questions for me right now? Agenda: DNA
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationDNA: The Molecule Of Life
DNA: The Molecule Of Life Introductory Concepts -One unique set of DNA in an organism is termed its genome (link to fig 1-3) -DNA is the main component of chromosomes -Humans are diploid organisms, with
More informationGenetics and Genomics in Medicine Chapter 1. Questions & Answers
Genetics and Genomics in Medicine Chapter 1 Multiple Choice Questions Questions & Answers Question 1.1 In a DNA double helix each type of base forms a stable base pair with only one type of base. When
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationName: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine?
BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham 1. What is the base pair rule for DNA? RNA? 2. What is the sugar found in RNA called? 3. is replaced by the base uracil in RNA? 4. What
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationLecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6
Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationChapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.
Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions
More informationCHAPTER 21 GENOMES AND THEIR EVOLUTION
GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More information