Introduction to Plant Genome and Gene Structure. Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC

Size: px
Start display at page:

Download "Introduction to Plant Genome and Gene Structure. Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC"

Transcription

1 Introduction to Plant Genome and Gene Structure Dr. Jonaliza L. Siangliw Rice Gene Discovery Unit, BIOTEC

2 Defining genome Coined by Hans Winkler (1920) as genom(e) by joining gene and chromosome Lederberg and McCray (2001) defines Genome as the complete gene compliment or the total DNA amount per haploid chromosome set RGDU at Community of Practices CARDI June 18-21, 2007 (GCP_BIOTEC)

3 Brief history of genome size study in plants (Estimates of DNA amounts) Early studies are based on analysis of isolated nuclei or cell suspension Led to the use of the term C value (Swift 1950b) These studies dealt only with relative DNA contents and did not provide estimates of absolute DNA mass The first estimate of the absolute amount of DNA in the nuclear genome of a plant was done for Lilium species Genome size the mass (in picgrams,, pg - 1 ) of DNA per haploid nucleus

4 Brief history of genome size study in plants (Estimates of DNA amounts) (A) Zingeria biebersteiniana a monocot species with chromosome 2n = 4 (B) Voanioala gerardii a rainforest palm from Madagascar with a chromosome count of 2n = 600 MICHAEL D. BENNETT* Proc. Natl. Acad. Sci. USA Vol. 95,pp , March 1998

5 Brief history of genome size study in plants (Estimates of DNA amounts) Examples of DNA amounts and chromosome sizes. (A) Brachyscome dishrosomatica 2n = 4, 1c= 1,.1 pg (B) Myriophyllum spicatum 2n = 14, 1c = 0.3 pg (C) Fritillaria sp. 2n = 14, 1c = 65 pg (D) Selaginella kraussiana 2n = 40, 1c = 0.36 pg (E) Equisetum variegatum 2n = 216, 1c = 30.4 pg T. Ryan Gregory The evolution of the genome (2005)

6 Brief history of genome size study in plants (Main areas of focus in early genome size studies) Developing methods for estimating plant genome size and testing and proving their accuracy. Exploration of the ranges in genome size in different groups and at various taxonomic levels. Investigating genome size variation through the (a) mechanism responsible, (b) rates of change, and (c) evolutionary significance to resolve the so called C-C value paradox.

7 Brief history of genome size study in plants (Main areas of focus in early genome size studies) Constancy and the origin of the C-value DNA constancy hypothesis Swift (1950a) referred to classes of DNA as Class I being the common diploid value Class II as Class 1C value representing the haploid DNA content. C-value paradox the DNA/cell does not correspond to the total gene content of the organism

8 Brief history of genome size study in plants (Main areas of focus in early genome size studies) T. Ryan Gregory Paleobiology, 30(2), 2004, pp

9 Brief history of genome size study in plants (Impact of molecular revolution on genome size research) Molecular work on DNA sequences gave insight on the structure and content of individual genomes but at the same time have inhibitory effect on genome size research such as Strong emphasis on DNA C values per se began to fade and in 1980s s it was almost impossible to obtain grant funding to estimate genome size The revelation of repetitive DNA sequences believed to cause potential changes in copy number led to reports of substantial intraspecific variation (violating the rule of DNA constancy) such as those related to developmental, environmental and geographical factors. Led to the necessity of second wave of careful measurements proving that intraspecific variation is due to technichal artifacts are challenges posted to genome size researchers (

10 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Study of molecular basis of genome evolution in plants Allow investigation and comparison of different taxa (ex. subspecies indica and japonica)

11 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Allow investigation and comparison of different species within families (Oryza,, Sorghum, Zea)

12 Brief history of genome size study in plants (Genome size studies in the post-genomic era) Large scale genome sequencing program Allow investigation and comparison of difference between families (Poaceae( and Brassicaceae) Reveal the key molecular mechanisms involved in the gain and/or loss of DNA resulting in changes in genome size

13 Patterns in plant genome size evolution (The extent of variation in plant taxa)

14 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants) Repetitive DNA in plants is composed of transposable elements (TEs( TEs) Class I RNA-mediated mode of transposition Retrotransposons characterized by long terminal repeats (LTRs( LTRs) Retroposons lacks terminal repeats (non-ltr retroelements) ) and use reverse transcriptase to transpose through an RNA intermediate

15 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants)

16 How do plant genome sizes evolve? (Sequences responsible for the range of genome sizes encountered in plants) Repetitive DNA in plants is composed of transposable elements (TEs) Class II DNA- mediated mode of transposition Helitrons Mutator-like elements Miniature inverted repeat transposable elements (MITES)

17 How do plant genome sizes evolve? (What triggers the spread of transposable elements?) Transcriptional activation can be induced by experimental manipulations of various biotic and abiotic stresses like Wounding, tissue culture and disease attack Adaptation to water availability in Hordeum, (Vicient et al.1999a) rice (Jiang( et al. 2003)

18 How do plant genome sizes evolve? (What triggers the spread of transposable elements?) Polyploidization and interspecific hybridization may trigger TEs amplification in Nicotiana (Comai,, 2000)

19 How do plant genome sizes evolve? Satellite DNA Tandemly arranged repeats of identical or similar sequences Variable in size but the most common monomeric units are bp and bp Two smaller unit of satellite DNA Minisatellites (10-40 bp repeats) Microsatellites (2-6 bp repeats) (Satellite DNA)

20 How do plant genome sizes evolve? (Genome size increase by polyploidy) Polyploidy results from combining three or more basic chromosome sets or genomes in one nucleus Prominent mode of speciation C-value and basic genome size are not equivalent, thus C-value C must be indicated as 1Cx-value to indicate the basic genome size (Greilhuber( et al. 2005)

21 How do plant genome sizes evolve? (Mechanisms of genome size decrease) Unequal intrastrand homologous recombination Occurs between the long terminal repeats of LTR-retrotransposons that leads to the deletion of internal DNA segment Illegitimate recombination Recombination that does not require the participation of a reca protein or large (>50 bp) ) stretches of sequence homology Loss of DNA during the repair of double stranded breaks Often accompanied by DNA deletions

22 Intraspecific variation in genome size (Intraspecific variation and speciation) Speciation may occur without any change in C-value C and likewise, variation in DNA amount can also precede reproductive isolation and morphological diversification Speciation was thought to depend mainly on changes in informational genes. Comparative genomics revealed constancy in this part of the genome and non-coding sequences determine diversity and suggested to play major role in plant speciation.

23 Intraspecific variation in genome size (Intraspecific variation and speciation)

24 Intraspecific variation in genome size (Intraspecific variation and speciation)

25 Methodology for estimating genome size in plants (Complete genome sequencing) Arabidopsis thaliana dicot plant that was sequenced through the Arabidopsis Genome Initiative in 1997 and whose complete sequence was made public in 2000 The genome size was estimated as 125 megabases (Mb) based on the size of the sequenced regions (115.4 Mb) plus the roughly 10 Mb for the unsequenced centromere.

26 From DNA sequence to gene discovery

27 DNA

28 DNA DNA is a molecule which encodes genetic information. It is a long, coiled, double-stranded chain of interlocking base-pairs called a double-helix helix. There are four types of bases in DNA: A (adenine), T (thymine),, G (guanine),, and C (cytosine). The order of the bases in a DNA strand, called the sequence, creates a code for information: the DNA code 'ATC' has a different meaning than the code 'TCA,' and so on.

29 DNA Structure

30 DNA Structure

31 DNA Structure

32 DNA Structure

33 Central Dogma of Molecular Biology

34 Gene A gene is a section of the DNA strand that carries the instructions for a specific function. For example, the 'globin' globin' ' genes contain instructions for making the hemoglobin protein, which is the protein which allows our blood to carry oxygen throughout the body. Humans have about 50,000 different genes, which work together in complex ways to control much of what our bodies do. While we all have the same genes, there are different versions of many genes, called alleles. For example, while most people have genes which give them pigmented (coloured) eyes, there are multiple alleles for specific eye colors. Each person has particular combination of alleles for eye color, for hair color, etc.,, which makes him or her genetically unique.

35 Gene structure

36 Eukaryotic Gene Expression

37 Eukaryotic Gene Complexity Enhancers - A DNA element that strongly stimulates transcription of a gene or genes. Usually found upstream from the genes they influence.

38 Eukaryotic Gene Complexity Promoters a DNA sequence to which RNA polymerase binds prior to initiation of transcription. Usually found just upstream from the transcription start site of a gene.

39 Eukaryotic Gene Complexity 5 UTRs - A region of a gene which h is transcribed into mrna, becoming the 5' end of the message, but which does not contain protein coding sequence. The 5'-untranslated region is the portion of the DNA starting from the cap site and extending to the base just before the ATG translation initiation codon. While not itself translated, this region may have sequences which alter the translation efficiency of the mrna, or which affect the stability of the mrna

40 Eukaryotic Gene Complexity Introns - intervening sequences in the gene that are removed in the formation of the functional mrna. Usually includes noncoding sequence but there are instances of alternative processing where sequences can be both introns and exons.

41 Eukaryotic Gene Complexity Exons - sequences in the gene that are found in the functional mrna. Includes coding sequence but may also include non-coding sequence.

42 Eukaryotic Gene Complexity 3 UTR - A region of the DNA which is transcribed into mrna and becomes the 3' end or the message, but which does not contain protein coding sequence. Everything between the stop codon and the polya tail is considered to be 3' untranslated. The 3' untranslated region may affect the translation efficiency of the mrna or the stability of the mrna. It also has sequences which are required for the addition of the poly(a) tail to the message (including one known as the "hexanucleotide", AAUAAA).

43 Mutation Mutation - A mutation is a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene.

44 Nature of mutations Substitution mutations - convert one type of base pair into another. G-C to A-T and A-T to G-C changes are referred to as transition mutations (replacement of a purine to pyrimidine base pair by a purine to pyrimidebase pair). G-C to C-G, G-C to T-A, A-T to T- A, and A-T to C-G are called transversions (replacement of a purine-pyrimidine base pair by a pyrimidinepurine base pair). Although transitions are more common than transversions, both kinds of mutations occur as a consequence of replication errors, both can result from chemical damage to DNA, and both have been implicated as causative factors in inherited genetic disease and cancer. Single nucleotide changes can change the codon to that of another amino acid, thus altering the protein. In addition, such changes can also create a stop codon

45 Nature of mutations

46 Small insertions/deletions - comprise a second relatively common class of mutation. Genetic changes of this sort involve insertion or loss of a small number of contiguous base pairs (one to several hundred). Nature of mutations

47 Nature of mutations

48 Nature of mutations

49 Nature of mutations

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018

Lecture 2: Biology Basics Continued. Fall 2018 August 23, 2018 Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization

MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription. Gene Organization. Genome. Objectives: Gene Organization Overview & Recap of Molecular Biology before the last two sections MBioS 503: Section 1 Chromosome, Gene, Translation, & Transcription Gene Organization Joy Winuthayanon, PhD School of Molecular Biosciences

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

Protein Synthesis

Protein Synthesis HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription.

13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. 13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. The Role of RNA 1. Complete the table to contrast the structures of DNA and RNA. DNA Sugar Number of Strands Bases

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928

II. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928 HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA

More information

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6

Lecture Overview. Overview of the Genetic Information. Marieb s Human Anatomy and Physiology. Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Marieb s Human Anatomy and Physiology Marieb Hoehn Chapter 3 DNA & RNA Protein Synthesis Lecture 6 Lecture Overview The Genetic Information Structure of DNA/RNA DNA Replication Overview of protein synthesis

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

From DNA to Protein: Genotype to Phenotype

From DNA to Protein: Genotype to Phenotype 12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each

More information

We have. Learned the structure of DNA. Talked about DNA replication and all of the complicated vocabulary that goes with it

We have. Learned the structure of DNA. Talked about DNA replication and all of the complicated vocabulary that goes with it Do Now 1. What enzyme inserts new DNA nucleotides during replication? 2. Name 2 other important players in DNA replication and their function. 3. In what direction can DNA polymerase add nucleotides? 4.

More information

From Gene to Protein

From Gene to Protein 8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

NUCLEIC ACIDS AND PROTEIN SYNTHESIS

NUCLEIC ACIDS AND PROTEIN SYNTHESIS NUCLEIC ACIDS AND PROTEIN SYNTHESIS DNA Cell Nucleus Chromosomes is a coiled double helix carrying hereditary information of the cell Contains the instructions for making from 20 different amino acids

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Chapter 12 Reading Questions

Chapter 12 Reading Questions Chapter 12 Reading Questions Name Section 11 In Frederick Griffith s experiment, what four substances were given to laboratory mice, and what was the result of each? 4. Which result was surprising, and

More information

Molecular Genetics of Disease and the Human Genome Project

Molecular Genetics of Disease and the Human Genome Project 9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg

Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg Unit 6 DNA ppt 3 Gene Expression and Mutations Chapter 8.6 & 8.7 pg 248-255 Which genes are transcribed on the chromosomes are carefully regulated at many points. Watch this! https://www.youtube.com/watch?v=oewozs_jtgk

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Adv Biology: DNA and RNA Study Guide

Adv Biology: DNA and RNA Study Guide Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless

Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless Honors Biology Reading Guide Chapter 10 v Fredrick Griffith Ø When he killed bacteria and then mixed the bacteria remains with living harmless bacteria some living bacteria cells converted to disease causing

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

Ch 10 Molecular Biology of the Gene

Ch 10 Molecular Biology of the Gene Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read

More information

DNA & RNA. Chapter Twelve and Thirteen Biology One

DNA & RNA. Chapter Twelve and Thirteen Biology One DNA & RNA Chapter Twelve and Thirteen Biology One I. DNA Structure A. DNA monomers = nucleotides *1. sugar bonded to PO4 & one of four possible nitrogen bases 2. bases = Adenine, Guanine, Cytosine, Thymine

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?

Bio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes? Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology

More information

Chapter 6 MOLECULAR BASIS OF INHERITANCE

Chapter 6 MOLECULAR BASIS OF INHERITANCE Chapter 6 MOLECULAR BASIS OF INHERITANCE 1mark each 1. Why is the ADA enzyme required in our body? 2. Which is not required for polypeptide synthesis: Termination codon, mrna, peptidyl tranferase, rrna?

More information

DNA RNA PROTEIN SYNTHESIS -NOTES-

DNA RNA PROTEIN SYNTHESIS -NOTES- DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there

More information

Name Class Date. Practice Test

Name Class Date. Practice Test Name Class Date 12 DNA Practice Test Multiple Choice Write the letter that best answers the question or completes the statement on the line provided. 1. What do bacteriophages infect? a. mice. c. viruses.

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Molecular Genetics Student Objectives

Molecular Genetics Student Objectives Molecular Genetics Student Objectives Exam 1: Enduring understanding 3.A: Heritable information provides for continuity of life. Essential knowledge 3.A.1: DNA, and in some cases RNA, is the primary source

More information

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger.

How does the human genome stack up? Genomic Size. Genome Size. Number of Genes. Eukaryotic genomes are generally larger. How does the human genome stack up? Organism Human (Homo sapiens) Laboratory mouse (M. musculus) Mustard weed (A. thaliana) Roundworm (C. elegans) Fruit fly (D. melanogaster) Yeast (S. cerevisiae) Bacterium

More information

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.

Chapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc. Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,

More information

Chapter 19. Control of Eukaryotic Genome. AP Biology

Chapter 19. Control of Eukaryotic Genome. AP Biology Chapter 19. Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics

The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics

I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation

More information

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation

Biology Evolution Dr. Kilburn, page 1 Mutation and genetic variation Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also

More information

Nucleic acids and protein synthesis

Nucleic acids and protein synthesis THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one

More information

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins

Chapter 8 From DNA to Proteins. Chapter 8 From DNA to Proteins KEY CONCEPT Section 1 DNA was identified as the genetic material through a series of experiments. Griffith finds a transforming principle. Griffith experimented with the bacteria that cause pneumonia.

More information

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA

DNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA 21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule

More information

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.

Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How

More information

Section 14.1 Structure of ribonucleic acid

Section 14.1 Structure of ribonucleic acid Section 14.1 Structure of ribonucleic acid The genetic code Sections of DNA are transcribed onto a single stranded molecule called RNA There are two types of RNA One type copies the genetic code and transfers

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Ch 12.DNA and RNA.Biology.Landis

Ch 12.DNA and RNA.Biology.Landis Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the

More information

Algorithms in Bioinformatics

Algorithms in Bioinformatics Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline Central Dogma of Molecular

More information

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage

Outline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated

More information

Griffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?

Griffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments? Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.

More information

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off?

AP Biology. The BIG Questions. Chapter 19. Prokaryote vs. eukaryote genome. Prokaryote vs. eukaryote genome. Why turn genes on & off? The BIG Questions Chapter 19. Control of Eukaryotic Genome How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?

More information

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL

Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Name: Molecular Genetics Quiz #1 SBI4U K T/I A C TOTAL Part A: Multiple Choice (15 marks) Circle the letter of choice that best completes the statement or answers the question. One mark for each correct

More information

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1

Lesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1 Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments

More information

Degenerate site - twofold degenerate site - fourfold degenerate site

Degenerate site - twofold degenerate site - fourfold degenerate site Genetic code Codon: triple base pairs defining each amino acid. Why genetic code is triple? double code represents 4 2 = 16 different information triple code: 4 3 = 64 (two much to represent 20 amino acids)

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Biology Chapter 12 Test: Molecular Genetics

Biology Chapter 12 Test: Molecular Genetics Class: Date: ID: A Biology Chapter 12 Test: Molecular Genetics True/False Indicate whether the statement is true or false. 1. RNA polymerase has to bind to DMA for an enzyme to be synthesized. 2. The only

More information

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

BIOLOGY 205 Midterm II - 19 February Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT? BIOLOGY 205 Midterm II - 19 February 1999 Name Multiple choice questions 4 points each (Best 12 out of 13). 1. Each of the following statements are correct regarding Eukaryotic genes and genomes EXCEPT?

More information

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test

DNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery

More information

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base

DNA Structure DNA Nucleotide 3 Parts: 1. Phosphate Group 2. Sugar 3. Nitrogen Base DNA,, RNA,, AND PROTEIN SYNTHESIS DNA Deoxyribonucleic Acid Enables cells to have different forms and perform different functions Primary functions of DNA: Store and transmit genetic information that tells

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

Biological Sciences 50 Practice Exam 2

Biological Sciences 50 Practice Exam 2 NAME: Fall 2005 TF: Biological Sciences 50 Practice Exam 2 A. Be sure to write your name on the top of each of page of the examination. B. Write each answer only on the same page as the pertinent question.

More information

Chapter 13: RNA and Protein Synthesis. Dr. Bertolotti

Chapter 13: RNA and Protein Synthesis. Dr. Bertolotti Chapter 13: RNA and Protein Synthesis Dr. Bertolotti Essential Question How does information flow from DNA to RNA to direct the synthesis of proteins? How does RNA differ from DNA? RNA and protein synthesis

More information

Chapter 8: DNA and RNA

Chapter 8: DNA and RNA Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play

More information

1/6/2014. Welcome Back! Do now:

1/6/2014. Welcome Back! Do now: Welcome Back! Do now: 1/6/2014 -Discuss with your shoulder partners What was your favorite thing you did over winter break? -Take out your EOC Sample Questions any questions for me right now? Agenda: DNA

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

DNA: The Molecule Of Life

DNA: The Molecule Of Life DNA: The Molecule Of Life Introductory Concepts -One unique set of DNA in an organism is termed its genome (link to fig 1-3) -DNA is the main component of chromosomes -Humans are diploid organisms, with

More information

Genetics and Genomics in Medicine Chapter 1. Questions & Answers

Genetics and Genomics in Medicine Chapter 1. Questions & Answers Genetics and Genomics in Medicine Chapter 1 Multiple Choice Questions Questions & Answers Question 1.1 In a DNA double helix each type of base forms a stable base pair with only one type of base. When

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Name: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine?

Name: Period: Date: BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham. 5. What two bases are classified as purines? pyrimidine? BIOLOGY HONORS DNA REVIEW GUIDE (extremely in detail) by Trung Pham 1. What is the base pair rule for DNA? RNA? 2. What is the sugar found in RNA called? 3. is replaced by the base uracil in RNA? 4. What

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6

Lecture Overview. Overview of the Genetic Information. Chapter 3 DNA & RNA Lecture 6 Visual Anatomy & Physiology First Edition Martini & Ober Chapter 3 DNA & RNA Lecture 6 Lecture Overview What is the cell s genetic information? How/where is the genetic information stored in eukaryotic

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation.

Chapter 12 Packet DNA 1. What did Griffith conclude from his experiment? 2. Describe the process of transformation. Chapter 12 Packet DNA and RNA Name Period California State Standards covered by this chapter: Cell Biology 1. The fundamental life processes of plants and animals depend on a variety of chemical reactions

More information

CHAPTER 21 GENOMES AND THEIR EVOLUTION

CHAPTER 21 GENOMES AND THEIR EVOLUTION GENETICS DATE CHAPTER 21 GENOMES AND THEIR EVOLUTION COURSE 213 AP BIOLOGY 1 Comparisons of genomes provide information about the evolutionary history of genes and taxonomic groups Genomics - study of

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information