Les ARN de l Horloge et L Horloge des ARN. Franck Delaunay University of Nice and CNRS, France
|
|
|
- Kathlyn Marianna Jones
- 6 years ago
- Views:
Transcription
1 Les ARN de l Horloge et L Horloge des ARN Franck Delaunay University of Nice and CNRS, France Marseille 3 oct 27
2 Circadian rhythms Bioluminescence Photosynthesis Hatching Locomotor activity Sleepwake cycle Body temperature Hormonal secretion Metabolism Liver regeneration
3 Cortisol and melatonin % of mean level Cortisol Melatonin Clock hours COSINOR Cortisol : acrophase at 9:35, p<,1 Melatonin : acrophase at 3:2, p<,1
4 The mamalian circadian system Oscillateur central Synchroniseurs internes neurotransmetteurs, hormones, comportement et alimentation Oscillateurs locaux
5 Circadian system and pathology Jetlag Sleep Central oscillators Cardiovascular Diseases Shift work Stress Internal synchronisers Local oscillators neurotransmitters, hormones, behaviour and feeding Metabolic syndrome Cancer Aging Depression
6
7 Per et Tim are rhythmically transcribed in Drosophila
8 Per genes are ryhtmically expressed in suprachiasmatic nuclei CT1 CT22 Per2
9 The Clock mutation in mouse
10
11 CLOCK and PER are bhlhpas proteins
12 BMAL1 is a CLOCK partner control
13 The CLOCK:BMAL1 heterodimer activates the mper1 promoter
14 A simplified model for mammalian circadian oscillators Synchronisers Cytoplasm CKIε/δ PER P P CRY PER P P Nucleus PER CKIε/δ CLOCK BMAL1 Ebox Cry1/2 ~ CLOCK BMAL1 Ebox ~ Per1/2 CLOCK BMAL1 CLOCK BMAL1 Ebox Bmal1 ~ Clock ~ Reverbα RORα RORE RORα RORE REV ERBα Output signals
15 More clock genes? Paralogs of known clock genes Bmal2 Npas2 RORβ, RORγ Reverbβ Per3 New clock components VPAC2 receptor CK2 GSK3β Fbxl3 (Overtime, Afterhours) PP5, PP1 (phosphatases) Orange
16 Virtually all cells of the body contain a circadian clock Drosophila peripheral tissues SCN Rat immortalized fibroblasts Reverbα 36B time (h) 5 % serum % serum
17 How clock genes do control physiological outputs in peripheral organs? ? Clockdependent physiology
18 Summary of circadian gene expression profiling in mammalian tissues Tissue Technology Protocol Statistics Cycling transcripts Reference SCN Affymetrix Affymetrix DD LD/DD cosopt cosine fit Panda (22) Ueda (22) Liver Affymetrix Affymetrix Affymetrix Affymetrix cdna Affymetrix DD LD/DD DD DD LD DD cosopt cosine fit autocorrelation spectral anova cosopt Panda (22) Ueda (22) Storch (22) Akhtar (22) Kita (22) Miller (27) Heart/Aorta Affymetrix Affymetrix DD DD autocorrelation cosopt Storch (22) Rudic (25) Muscle Pineal Kidney Adrenals Affymetrix cdna cdna Affymetrix DD LD LD DD cosopt anova anova cosopt Miller (27) Humphrie (22) Kita (22) Oster (26) Fibroblasts Affymetrix cdna Serum shock Serum shock spectral corrcos Grundschober (21) Duffield (22)
19 Circadian gene expression is highly tissuespecific SCN liver heart liver Panda et al.; Ueda et al. 22 Storch et al. 22
20 Microarray analysis of liver circadian gene expression total RNA biotinylated RNA MAS4/CF pools of 1 livers every 4h for 24 h LD 12:12 affymetrix MGU74Av genes (2 chips) ADI ADI ADI ZT ZT4 ZT8 ZT12 ZT16 ZT2 ZT ZT4 ZT8 ZT12 ZT16 ZT RGSr/36B4 lipine1/36b4 Cyp4a141/36B4 Y Y CYP4a14 36B4 Lipin 36B4 RGSr 36B4 248 rhythmic transcripts (4% of the expressed genes) ZT ZT4 ZT8 ZT12 ZT16 ZT2 Y
21 Phase and functional clustering of liver circadian transcripts Transport 9% Circadian clock 2% Cytoskeleton 2% Transcripts Nb ZT time Transcription factors 8% Cell growth/death 6% Metabolism 7% Heat shock/chaperone 2% Enzymes 1% Protein synthesis and degradation 2% Others 5% Transduction 7% Unknown 4%
22 Stra13 circadian expression in mouse peripheral organs Liver Stra13 36B4 Stra13 36B4 Heart Kidney Stra13 / 36B Liver CT4 CT Heart CT4 CT12 Stra13 36B4 Stra13 36B4 Lung Y Circadian time Stra13 / 36B Kidney CT4 CT Lung CT4 CT12
23 Normalizedluciferaseactivy A principle function of Stra13 is to regulate clockcontrolled genes Circadian time 4 12 Functional clustering of Stra13 target genes Stra13 / wildtype unknown 37% metabolism 17% detoxification 1% serum proteins miscellaneous 7% proteolysis 1% cell growth immunity 7% 5% 7% Affy MGU74Av2 Rma/SAM 2 CCGs out of 42 targets Metabolism: Hmgcr Detoxification: Cyp2a4, Alas1 Serum proteins: Igfbp1 Cell growth: Erbb3 Immunity: Raet1 Proteolysis: Ctss 14 28
24 Normalizedluciferaseactivy STRA13 represses CLOCK:BMAL1 dependent transcripitional activation 25 Stra13(E3E4)3x::Luc Stra13(E3E4)m3x::Luc Normalized luciferase activity pcdna Clock:Bmal1 Cry1 Stra13
25 Stra13 circadian regulation is abolished in tumors liver GOS tumor Stra13 36B Y Zeitgeber time Zeitgeber time Zeitgeber time Zeitgeber time
26 Cell cycle genes circadian regulation Circadian gene expression datasets Cyclin D1, D3, G2, I Wee1 Gadd45α, Gadd45γ p21 CDK4 Gs2 EGFR PI3K Analysis of clock mutant mice Per2 Cyclin A, D1 Gadd45α cmyc Cry1/Cry2 Wee1 Clock/Clock p21 p27 Wee1 Chk1, Chk2 ERα CDK2 Cyclin D3, E1 TGFβR, EGFR
27 The circadian clock regulates p21 expression in the mouse liver LD DD p21/36b p21/36b ZT2 ZT ZT4 ZT8 ZT12 ZT16 ZT2 Zeitgeber time CT2 CT CT4 CT8 CT12 CT16 CT2 Circadian time
28 p21 is overexpressed and not rhythmic in peripheral tissues from Bmal1 / mice 6 Liver 24 Heart Bmal1 / p21/36b Bmal1 / p21/36b ZT ZT4 ZT8 ZT12 Zeitgeber time ZT16 WT ZT2 4 ZT ZT4 ZT8 ZT12 Zeitgeber time ZT16 WT ZT2 p53/36b4 p53 expression WT Bmal1 /
29 The p21 gene contains two conserved RORE elements Mouse Human GGCTGTCtAGGTCAGCTaA GGCTGTCcAGGTCAGCTgC E1 introre CAGTGACCTATTTGGC GG CAGTGACCTATTTGGC TG Mouse Human E2 p21 gene prorore RORE: binding sites for ROR and REVERB nuclear orphan receptors
30 The p21 intronic RORE is functional Cotransfection assay Model for p21 rhythmic transcription Fold increase p21 gene 4 RORγ RORα4 2 introre introremut pcdna RORα4 RORγ REVERBα REVERBβ prorore E1 REVERBα REVERBβ BMAL1 introre E2
31 Schibler Science 23
32 Conclusion (p21) p21 expression is a clock output p21 is dramatically overexpressed in Bmal1 / mice ROR and REVERB nuclear orphan receptors mediate the circadian transcription of p21 BMAL1 is required for normal hepatocyte proliferation Circadian gating of cell division cycle operating at the G1 progession level in liver CyclinB CDC2 G2 Wee1 S M G E2F E2F G RB RB P p21 CyclinD CDK4/6 Cyclin E CDK2
33 Conclusion (general) Genomics identify reliably CCGs Circadian gene expression is extensive and tissue specific (51 %) Putative molecular links between the cell division cycle and the circadian system HT sequencing, proteomics, activity Many cancer relevant organs remain to be analyzed
A Genome wide RNAi Screen. in Human Cells. Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1
A Genome wide RNAi Screen for Modifiers of the Circadian Clock in Human Cells Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1 Pagkapol Y. Pongsawakul,2
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis
Impact of Retinoic acid induced-1 (Rai1) on Regulators of Metabolism and Adipogenesis The mammalian system undergoes ~24 hour cycles known as circadian rhythms that temporally orchestrate metabolism, behavior,
Delay in Feedback Repression by Cryptochrome 1 Is Required for Circadian Clock Function
Delay in Feedback Repression by Cryptochrome 1 Is Required for Circadian Clock Function Maki Ukai-Tadenuma, 1,8 Rikuhiro G. Yamada, 1,8 Haiyan Xu, 4 Jürgen A. Ripperger, 5 Andrew C. Liu, 4 and Hiroki R.
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Experimental design for analyzing molecular circadian rhythms in mouse lung. (a) Schematic depiction of microarray time series analysis to identify the circadian
SUPPLEMENTARY DATA. Supplementary Table 1. Sequences of qpcr primers.
Supplementary Table 1. Sequences of qpcr primers. Lpl Fatp1 (Slc27a1) Fatp4 (Slc27a4) Cd36 Acsl1 Gpam Agpat2 Dgat1 Dgat2 Plin1 Atgl Hsl Mgll Lpin1 Got2 Cav1 Cav2 Fitm2 Nr1h2 Nr1h3 Acsl4 Acsl5 Agpat6 Agpat9
Supporting Information
Supporting Information Lande-Diner et al. 10.1073/pnas.1305980110 SI Text Because of the complex history of nomenclature regarding Mediator subunits and differences in protein names between mammals and
Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
Introduction to Microarray Analysis
Introduction to Microarray Analysis Methods Course: Gene Expression Data Analysis -Day One Rainer Spang Microarrays Highly parallel measurement devices for gene expression levels 1. How does the microarray
Mechanisms of embryonic stem cell division and differentiation
Mechanisms of embryonic stem cell division and differentiation Josephine Wbite.'.... Department of Molecular Biosciences (Biochemistry) The University of Adelaide Adelaide, South Australia Submitted for
Differential display of DNA-binding proteins reveals heat-shock factor 1 as a circadian transcription factor
Differential display of DNA-binding proteins reveals heat-shock factor 1 as a circadian transcription factor Hans Reinke, 1 Camille Saini, 1 Fabienne Fleury-Olela, 1 Charna Dibner, 1 Ivor J. Benjamin,
CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
Section C: The Control of Gene Expression
Section C: The Control of Gene Expression 1. Each cell of a multicellular eukaryote expresses only a small fraction of its genes 2. The control of gene expression can occur at any step in the pathway from
Role of REV-ERBα in the regulation of lung inflammation
Role of REV-ERBα in the regulation of lung inflammation A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health 2016 Marie
Gene expression analysis. Gene expression analysis. Total RNA. Rare and abundant transcripts. Expression levels. Transcriptional output of the genome
Gene expression analysis Gene expression analysis Biology of the transcriptome Observing the transcriptome Computational biology of gene expression sven.nelander@wlab.gu.se Recent examples Transcriptonal
Transcription Translation Of Hereditary
Transcription Translation Of Hereditary Instructions Into Specific Proteins Nucleus of the cell is the location of its hereditary instructions (DNA). Define the terms transcription and translation and
Judy Wieber. Department of Computational Biology. May 28, 2008
Review III: Cellular Processes Judy Wieber BBSI @ Pitt 2008 Department of Computational Biology University it of Pittsburgh School of Medicine i May 28, 2008 Outline Metabolism Cell cycle Transcription
Microarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 4 th February 2009 Aims To give a biologistʼs view of microarray experiments To explain the technologies involved To describe typical microarray experiments
Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
Microarray Informatics
Microarray Informatics Donald Dunbar MSc Seminar 31 st January 2007 Aims To give a biologist s view of microarray experiments To explain the technologies involved To describe typical microarray experiments
Mouse Models to Investigate Cell Cycle and Cancer Prof. Philipp Kaldis
Mouse Models to Investigate Institute of Molecular and Cell Biology (IMCB) Cell Division and Cancer Laboratory, Proteos 3-09 Singapore 138673 1 2 Crystal structure of Cdk2/ cyclin A A.A Russo et al., (1996)
Gene expression DNA RNA. Protein DNA. Replication. Initiation Elongation Processing Export. DNA RNA Protein. Transcription. Degradation.
Gene expression DNA RNA Protein DNA DNA Degradation RNA Degradation Protein Replication Transcription Translation Initiation Elongation Processing Export Initiation Elongation Processing Targeting Chapter
Introduction to Genome Biology
Introduction to Genome Biology Sandrine Dudoit, Wolfgang Huber, Robert Gentleman Bioconductor Short Course 2006 Copyright 2006, all rights reserved Outline Cells, chromosomes, and cell division DNA structure
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency.
Supplementary Figure 1, related to Figure 1. GAS5 is highly expressed in the cytoplasm of hescs, and positively correlates with pluripotency. (a) Transfection of different concentration of GAS5-overexpressing
BS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
Thyroid hormone transcriptome and cerebellum development.
Thyroid hormone transcriptome and cerebellum development. 1) Developmental biology: General concepts 2) Genomic data: mouse and human genomes global view 3) A biological problem: mouse cerebellum and thyroid
Symbol Accession Found in Human Red Blood Cell database?
SUPPLEMENTARY INFORMATION doi:1.138/nature972 Symbol Accession Found in Human Red Blood Cell database? ARNTL (BMAL1) NP_125443 No CLOCK AAB83969 No CRY1 NP_66 No CRY2 AAH35161 No PER1 AAG1149 No PER2 NP_73728
Practice Exam A. Briefly describe how IL-25 treatment might be able to help this responder subgroup of liver cancer patients.
Practice Exam 2007 1. A special JAK-STAT signaling system (JAK5-STAT5) was recently identified in which a gene called TS5 becomes selectively transcribed and expressed in the liver upon induction by a
Transcriptomics. Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona
Transcriptomics Marta Puig Institut de Biotecnologia i Biomedicina Universitat Autònoma de Barcelona Central dogma of molecular biology Central dogma of molecular biology Genome Complete DNA content of
Supplementary Figure 1. GST pull-down analysis of the interaction of GST-cIAP1 (A, B), GSTcIAP1
Legends Supplementary Figure 1. GST pull-down analysis of the interaction of GST- (A, B), GST mutants (B) or GST- (C) with indicated proteins. A, B, Cell lysate from untransfected HeLa cells were loaded
Cell Cycle. Trends in Cell Biology
Cell Cycle Trends in Cell Biology Cyclic proteolysis Two distinct enzyme complexes proteolysis of cyclin-cdk complexes SCF (Skp1-Cul1-F box) Ubiquitylation and destruction of G1/S-cyclins and CKI proteins
NAME TA SEC Problem Set 5 FRIDAY October 29, 2004
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29,
7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
Quick Review of Protein Synthesis
Collin College BIOL. 2401 Quick Review of Protein Synthesis. Proteins and Protein Synthesis Proteins are the molecular units that do most of the work in a cell. They function as molecular catalysts, help
BIOL 461/ 661 Cell Biology 4 Credits Instructor: Dr. Kristin O Brien. T/TH 11:30-1:00, Irving I 208 Office hours: M 9-10, TH 3-4
BIOL 461/ 661 Cell Biology 4 Credits Instructor: Dr. Kristin O Brien Prerequisites: BIOL 362 Principals of Genetics Office: 226 Arctic Health CHEM 321 Organic Chemistry Laboratory: 229 Arctic Health T/TH
Discussion 42 The regulatory functions of chromatin such as transcription, replication and recombination occur at two levels (von Kries et a/., 1991).
DISCUSSION Discussion 42 The regulatory functions of chromatin such as transcription, replication and recombination occur at two levels (von Kries et a/., 1991). The first level involves the binding of
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.
Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP
Year III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
Cellular Reprogramming and Controllability of Complex Systems
Cellular Reprogramming and Controllability of Complex Systems University of Maryland and ISR April 25, 2016 Roger Brockett John A. Paulson School of Engineering and Applied Science Harvard University 1
Announcement Structure Analysis
Announcement Structure Analysis BSC 4439/BSC 5436: Biomedical Informatics: Structure Analysis Spring 2019, CB117 Monday and Wednesday 12:00 1:15pm Office hour: Monday and Wednesday 1:15 2pm Topics include
Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
How to deal with the microarray results.
How to deal with the microarray results. Britt Gabrielsson PhD RCEM, Div of metabolism and cardiovascular research Department of Medicine The Sahlgrenska Academy at Göteborg University and then we will
The genetic code of gene regulatory elements
The genetic code of gene regulatory elements Ivan Ovcharenko Computational Biology Branch National Center for Biotechnology Information National Institutes of Health October 23, 2008 Outline Gene deserts
Genetic Basis of Development & Biotechnologies
Genetic Basis of Development & Biotechnologies 1. Steps of embryonic development: cell division, morphogenesis, differentiation Totipotency and pluripotency 2. Plant cloning 3. Animal cloning Reproductive
Name AP Biology Mrs. Laux Take home test #11 on Chapters 14, 15, and 17 DUE: MONDAY, DECEMBER 21, 2009
MULTIPLE CHOICE QUESTIONS 1. Inducible genes are usually actively transcribed when: A. the molecule degraded by the enzyme(s) is present in the cell. B. repressor molecules bind to the promoter. C. lactose
CircadiOmics: Integrating Circadian Genomics, Transcriptomics, Proteomics, and Metabolomics
CircadiOmics: Integrating Circadian Genomics, Transcriptomics, Proteomics, and Metabolomics Vishal R Patel, Kristin Eckel-Mahan, Paolo Sassone-Corsi, Pierre Baldi Supplementary Figure 1: CircadiOmics Webserver
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes
OriGene GFC-Arrays for High-throughput Overexpression Screening of Human Gene Phenotypes High-throughput Gene Function Validation Tool Introduction sirna screening libraries enable scientists to identify
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
Supplementary Figure 1 (related to Figure 1, 2 and Table 1)
Supplementary Figure 1 (related to Figure 1, 2 and Table 1) Role of E75 in regulating circadian rhythms. (A) E75 mrna expression in TG 27 controls, TG 27 >NE-30-49-10, TG 27 >UAS-E75 (II), TG 27 >UAS-E75
WB: AB1786P. 75kDa. 63kDa. 48kDa
in vitro electroporation The cell suspension (1X1 6 cells) was mixed with plasmid 1 μg pcdn3.1 intact vector or pcdn3.1 human drd3 in Opti-MEM Media (GICO). The expression plasmid of pcdn3.1 was obtained
2. Real-time reporter gene assay by photon counting system. 3. Real-time reporter gene assay by imaging system.
Real-time Reporter Gene Assay Progress of real-time reporter assay using bioluminescence protein gene. 1. Typical reporter protein in Japan. 1. Typical reporter protein in Japan. 2. Real-time reporter
A Survey of Genetic Methods
IBS 8102 Cell, Molecular, and Developmental Biology A Survey of Genetic Methods January 24, 2008 DNA RNA Hybridization ** * radioactive probe reverse transcriptase polymerase chain reaction RT PCR DNA
Regulation of the cell cycle
Regulation of the cell cycle Dr. F. Neuschäfer-Rube Cyclin-dependent Kinases (CDKs) Cyclin-dependent kinases: Motors and switches of the cell cycle Dr. F. Neuschäfer-Rube The cell cyle M S The cell cyle
Mechanism of action-1
Mechanism of action-1 receptors: mediators of hormone action, membrane associated vs. intracellular receptors: measurements of receptor - ligand interaction, mechanism surface-receptors: kinases, phosphatases,
1/24/2012. Cell. Plasma Membrane
Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division Cell Basic unit of structure and function in body
Computational Genomics
Computational Genomics Introduction to cell biology, genomics, development, and probability Eric Xing Lecture 1a, January 18, 2007 Reading: Chap. 1, DTM book Introduction to cell biology, functional genomics,
RayBio Human PPAR-gamma Transcription Factor Activity Assay Kit
RayBio Human PPAR-gamma Transcription Factor Activity Assay Kit Catalog #: TFEH-PPARg User Manual Jan 5, 2018 3607 Parkway Lane, Suite 200 Norcross, GA 30092 Tel: 1-888-494-8555 (Toll Free) or 770-729-2992,
Additional levels of regulation
Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) P. Matthias, May 26th, 2010 Additional levels of regulation Gene organization/localization Allelic exclusion AIRE: a
Bi8 Lecture 19. Review and Practice Questions March 8th 2016
Bi8 Lecture 19 Review and Practice Questions March 8th 2016 Common Misconceptions Where Words Matter Common Misconceptions DNA vs RNA vs Protein Su(H) vs Su(H) Replication Transcription Transcribed vs
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes
Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional
Additional Practice Problems for Reading Period
BS 50 Genetics and Genomics Reading Period Additional Practice Problems for Reading Period Question 1. In patients with a particular type of leukemia, their leukemic B lymphocytes display a translocation
TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue
It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
supplementary information
DOI: 10.1038/ncb2116 Figure S1 CDK phosphorylation of EZH2 in cells. (a) Comparison of candidate CDK phosphorylation sites on EZH2 with known CDK substrates by multiple sequence alignments. (b) CDK1 and
Network System Inference
Network System Inference Francis J. Doyle III University of California, Santa Barbara Douglas Lauffenburger Massachusetts Institute of Technology WTEC Systems Biology Final Workshop March 11, 2005 What
Goals of pharmacogenomics
Goals of pharmacogenomics Use drugs better and use better drugs! People inherit/exhibit differences in drug: Absorption Metabolism and degradation of the drug Transport of drug to the target molecule Excretion
SUPPLEMENTARY INFORMATION
18Pura Brain Liver 2 kb 9Mtmr Heart Brain 1.4 kb 15Ppara 1.5 kb IPTpcc 1.3 kb GAPDH 1.5 kb IPGpr1 2 kb GAPDH 1.5 kb 17Tcte 13Elov12 Lung Thymus 6 kb 5 kb 17Tbcc Kidney Embryo 4.5 kb 3.7 kb GAPDH 1.5 kb
ANNOUNCEMENTS. HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134)
ANNOUNCEMENTS HW2 is due Thursday 2/4 by 12:00 pm. Office hours: Monday 12:50 1:20 (ECCH 134) Lectures 6 8 Outline Stem Cell Division - symmetric - asymmetric Stem cell lineage potential - pluripotent
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
How To Choose a GeneCopoeia Luciferase System. Ed Davis, Ph.D.
TECHNICAL NOTE How To Choose a GeneCopoeia Luciferase System Ed Davis, Ph.D. Introduction Luciferase reporter systems are invaluable tools for several applications, including regulation of gene expression
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
Chapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
Computational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
GENE EXPRESSSION. Promoter sequence where RNA polymerase binds. Operator sequence that acts as a switch (yellow) OPERON
GENE EXPRESSSION 1 GENE REGULATION IN PROKARYOTES Bacteria can turn genes on or off depending on their environment Prokaryotes have operons clusters of related genes and regulatory sequences Promoter sequence
Nature Structural & Molecular Biology: doi: /nsmb.3018
Supplementary Figure 1 Validation of genetic complementation assay in Bmal1 / Per2 Luc fibroblasts. (a) Only Bmal1, not Bmal2, rescues circadian rhythms from cells. Cells expressing various Bmal constructs
Lecture 8: Transgenic Model Systems and RNAi
Lecture 8: Transgenic Model Systems and RNAi I. Model systems 1. Caenorhabditis elegans Caenorhabditis elegans is a microscopic (~1 mm) nematode (roundworm) that normally lives in soil. It has become one
Interpretation requires context making sense out of gene lists and networks. Philip Zimmermann, ETH Zurich / NEBION AG
Interpretation requires context making sense out of gene lists and networks Philip Zimmermann, ETH Zurich / NEBION AG 1 Importance of context 2 Importance of context 3 Importance of context What does this
PRINCIPLES O F NUCLEAR STRUCTUR E AND FUNCTIO N. Peter R. Cook
PRINCIPLES O F NUCLEAR STRUCTUR E AND FUNCTIO N Peter R. Cook Preface xii i Acknowledgments xv 1. SOME PRINCIPLES 1 Overview of the Cell Nucleus 1 Box 1-1. Discovery of Cells, Nuclei, and DNA 2 A Sense
Cellular signal transduction II. TGF-ß, the growth factor which inhibits growth?
Cellular signal transduction II TGF-ß, the growth factor which inhibits growth? Transforming growth factor ß (TGF-ß) Growth factor Stimulation of adhesion independent cell proliferation by tumor cells
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
There are four phases: M = mitosis is when chromosomes become condensed and separate and the cell divides: visible changes. ~ 1 hr.
The cell cycle in eukaryotes Jason Kahn, Biochem 465 Spring 2006 (Mostly from Alberts et al., Molecular Biology of the Cell, 2002). The book is available for free on line at http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4
Gene Expression Analysis with Pathway-Centric DNA Microarrays
Gene Expression Analysis with Pathway-Centric DNA Microarrays SuperArray Bioscience Corporation George J. Quellhorst, Jr. Ph.D. Manager, Customer Education Topics to be Covered Introduction to DNA Microarrays
Disease Clinical features Genotype
Disease Clinical features Genotype Alpha 1 Antitrypsin deficiency (A1ATD) Patient 1 65 year old caucasian male, liver transplant recipient, explant biopsy confirmed A1ATD induced liver cirrhosis Patient
BIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
LIVER FIBROSIS; NOVEL FINDINGS ABOUT THE MECHANISM OF EXCESSIVE COLLAGEN SYNTHESIS
LIVER FIBROSIS; NOVEL FINDINGS ABOUT THE MECHANISM OF EXCESSIVE COLLAGEN SYNTHESIS BRANKO STEFANOVIC COM FSU GRAND ROUNDS 2009 PREVALENCE OF LIVER FIBROSIS IN USA 1 IN 679 PEOPLE; 400,000 PEOPLE IN USA
Progress and Future Directions in Integrated Systems Toxicology. Mary McBride Agilent Technologies
Progress and Future Directions in Integrated Systems Toxicology Mary McBride Agilent Technologies 1 Toxicity testing tools of the late 20 th century Patchwork approach to testing dates back to the 1930
ZBED6 the birth of a transcription factor in placental mammals. Wild Boar X domestic pig intercross initiated 1989
the birth of a transcription factor in placental mammals Wild Boar X domestic pig intercross initiated 1989 X Göran Andersson F1 X F1 Swedish University of Agricultural Sciences ALLBIO- Scilife-UPPNEX-BILS
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION
BEST PRACTICES IN MOUSE TISSUE SAMPLE PREPARATION FOR RNA EXTRACTION WITH PRECELLYS EVOLUTION The lab mouse is the most commonly used mammalian model system for genetic research. Scientists from a wide
Therapeutic RNA editing by Axiomer editing oligonucleotides
Therapeutic RN editing by xiomer editing oligonucleotides Forward looking statements This presentation contains forward-looking statements that involve substantial risks and uncertainties. ll statements,
GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
CRISPR: A Simple Tool for Answering Complex Questions
CRISPR: A Simple Tool for Answering Complex Questions www.bcm.edu/cbass c_bass@bcm.edu 713-798-8987 CRISPR-Cas systems CRISPRs: Clustered Regularly Interspaced Short Palindromic Repeats Cas: The accompanying
Chapter 11: Regulation of Gene Expression
Chapter Review 1. It has long been known that there is probably a genetic link for alcoholism. Researchers studying rats have begun to elucidate this link. Briefly describe the genetic mechanism found
Resources. This lecture Campbell and Farrell's Biochemistry, Chapter 12
TRANSLATION 1 Resources This lecture Campbell and Farrell's Biochemistry, Chapter 12 2 The big question How is the nucleotide sequence of mrna translated into the amino acid sequence of a protein? 3 General
Supplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
9. What proteins will be affected by mutations in the trans-acting elements? Cis-acting elements?
6. What regulates the expression of a gene? 7. What are the cis- and trans-acting elements? 8. Can a deficiency in a trans-acting element be overcome by the addition of another copy of the gene to a cell?
Supplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
Proteomics. Areas of Application for Proteomics. Most Commonly Used Proteomics Techniques: Limitations: Examples
Proteomics Areas of Application for Proteomics Most Commonly Used Proteomics Techniques: Antibody arrays Protein activity arrays 2-D gels ICAT technology SELDI Limitations: protein sources surfaces and
Cryptochromes Define a Novel Circadian Clock Mechanism in Monarch Butterflies That May Underlie Sun Compass Navigation
Cryptochromes Define a Novel Circadian Clock Mechanism in Monarch Butterflies That May Underlie Sun Compass Navigation Haisun Zhu 1, Ivo Sauman 2, Quan Yuan 1, Amy Casselman 1, Myai Emery-Le 1, Patrick
System-Driven and Oscillator-Dependent Circadian Transcription in Mice with a Conditionally Active Liver Clock
System-Driven and Oscillator-Dependent Circadian Transcription in Mice with a Conditionally Active Liver Clock Benoît Kornmann 1, Olivier Schaad 2, Hermann Bujard 3, Joseph S. Takahashi 4, Ueli Schibler