2. Real-time reporter gene assay by photon counting system. 3. Real-time reporter gene assay by imaging system.
|
|
- Godfrey Hodges
- 6 years ago
- Views:
Transcription
1 Real-time Reporter Gene Assay Progress of real-time reporter assay using bioluminescence protein gene. 1. Typical reporter protein in Japan. 1. Typical reporter protein in Japan. 2. Real-time reporter gene assay by photon counting system. 3. Real-time reporter gene assay by imaging system.
2 Feature of Bioluminescence Reporter Assay Photo: Dr. Osamu Shimomura Aequorea aequorea Photo: Dr. K. Ogho Valugula hilugendorfii GFP Firefly Photo: Dr. K. Niwa Luciola lateralis
3 Bioluminescence Reporter Gene Photo: Dr. V. Viviani Railroad worm
4 Oxidation of Luciferin & Coelenterazine Luciferin 620nm 560nm Provided by Dr.H.Akiyama Coelenterazine Coelenteramide O 2 Renilla Luciferase +CO 2 +hν
5 Dual Reporter Assay Promoter A Luciferase Promoter B Renilla Luciferase D-Luciferin Coelenterazine Cell Lysis of cells Luciferase Activity Renilla Luciferase Activity
6 Multi-Color Reporter Assay Promoter 1 Red-Luciferase Promoter 2 Orange-Luciferase Promoter 3 Green-Luciferase Cell Culture D-Luciferin measurement of Luminescence Intensity Red Orange Lysis of Cells Green
7 Advanced Method of Quantitative Color Detection Sample Optical filter unit F0 PMT Relative Counts (F0) = G+O+R
8 Advanced Method of Quantitative Color Detection Sample Optical filter unit F1 Relative Counts (F1) = Κf 1g G+Κf 1o O+Κf 1r R PMT Κf1g : Transmittance of green luminescence of f1 filter
9 Advanced Method of Quantitative Color Detection Sample Optical filter unit F0 F2 PMT Relative Counts (F2) = Κf 2g G+Κf 2o O+Κf 2r R
10 Advanced Method of Quantitative Color Detection Sample F G Optical filter unit F1 = κf1gκf1oκf1rf1r O F0 F1 F2 F2 κf2gκf2oκf2rf2r R PMT F : Measurement value κ : Transmittance of each color light of each optical filter G, O, R : Each color light
11 Promoter Real-Time Reporter Assay (Live Cell Reporter Assay) Luciferase gene Living Cell Reporter vector Luciferin (in the culture medium) Continuous and real-time measurement of light Luciferase mrna Endogenous gene Intensity Time
12 Luminometer for real-time reporter assay in living cell Kronos (AB-2500) 35mm Culture Dishes on Turntable Keeping Constant Temperature (20-45 ) Photomultiplier Tube
13 Temperature Stability Sensor in dish 40 Setting on the new dish 35 Dish temp Sensor in kronos 30 Temp( ) Temp( ) Room temp Tim e(sec) /12/26 12:00: /12/28 12:00: /12/ /01/01 12:00:00 12:00:00 Time and Date 2007/01/03 12:00: /01/05 12:00:00 Preset Temperature : 37
14 CO 2 Concentration ) % 3 ( 2 O C ) % ( 2 O C Time(hr) Time(hr)
15 Procedure Addition of Luciferin Culture Cell (Reporter gene transfected ) Setting Parameters on PC Setting Dishes in Kronos Click Mouse to Start
16 Output Data on PC Microsoft Excel is not included the product
17 1 PC Can Control 5 Sets of Kronos USB HUB 8 samples 8 samples 8 samples 8 samples 40 samples 8 samples
18 Feedback loop for circadian rhythms Positive elements: Clock, Bmal1 Negative elements: Per1, Per2, Cry1,Cry2 suprachiasmatic nuclei (SCN) Seoul National Uni., I. Kwon et al. Mol. Cell. Biol., 26, (2006) Per Per mrna Cry mrna Per 1 Clock Repression Bmal E-box CACGTG Cry Cry Clock Bmal E-box Repression Dr. S. Honnma, Hokkaido Uni.
19 Monitoring Circadian Rhythm by Kronos Per1 prom. Luciferase Transfection Stimulation(by Dex) Medium change and Addition of Luciferin Rat-1 fibroblast cell Relative light intensity / 45sec Day Measurement by Kronos Dr. Y.Nakajima, National Institute of Advanced Industrial Science and Technology (AIST)
20 Self-sustained circadian rhythms in SCN SCN section of mouse transgenic for Per1-Luciferase (300µm) RLU/min Millicell Days Dr.Ken-ichi Honma, Hokkaido Uni. Reporter: Per1 Promoter-FLuc Medium : DMEM, 10mM HEPES, 0.1mM D-Luciferin K
21 Real-Time Dual Color Reporter Assay Relative Counts of Per2-Gluc and SV40-Rluc Relative Counts of Per2-Gluc matrix calculation Filtered Relative Counts of Per2-Gluc and SV40-Rluc Cell :NIH3T3 Reporter: Rer2 Promoter-Gluc, SV40-RLuc Medium : DMEM, 10%FBS Transfection: Rer2 Promoter-Gluc 1µg, SV40-Rluc 0.2µg Relative Counts of SV40-Rluc Dr. Y. Nakajima, AIST
22 Small interference RNA Control GDF-8-siRNA sirna(negative contorol) Growth and Differentiation Factor 8(GDF-8): TGF-β superfamily Cell :chicken embryonic myoblasts Reporter: GDF- 8(Myostatin) Promoter-pGL3 luc Medium : Opti-MEM, 7.5%knockout serum replacement Transfection:50pmol GDF-8-siRNA, Lipofectamine2000 Normalization time:20hr Fujimori Sato et. al., Am J Physiol Cell Physiol, 291, C538-C545(2006) Dr. M. Hattori, Kyusyu Uni.
23 The promoter activity of growth hormone by Thyroid hormone(t3) 100nM T3 10nM T3 1nM T3 Cell :GH3 (rat pituitary adenoma cell ) Reporter:GH Promoter-Fluc Medium : OPTI-MEM T. Enomoto, ATTO Corp. Ref: Y.Tanahashi et.al. Anal. Biochem. 289, (2001)
24 Real-time Imaging System in Living Cell ATTO Cellgraph
25 Incubation system Culture Dish Heat Glass CO 2 Objective lens
26 Collective efficiency and transmission of opitcal system Optics for focusing onto CCD η = 1 1 sin2 θ 2 η : Objective Lens θ = 1 1 NA2 2 Collective Efficiency Cell NA : numerical aperture (NA=nsinθ) n : refractive index NA η (%)
27 High Sensitive & Low Noise Cooled CCD Exposure time : 10min Image brightness on the drawn line Dark Image Cooled CCD Camera Cellgraph
28 Focus adjustment PTGR-Cytosol, (x20 lens) Focus Control Dr.Y.Nakajima AIST SV40-PTGRm-Cytosol in NIH3T3-3-4 cells 200 mm LH2K in 10% FBS, 25 mm Hepes +100 X20 lens 3 min exposure 20 mmstep Kronos: 1 x 108 (No.1)
29 The best Luciferase(Eluc) for cell imaging Bioluminescence imaging of ELuc and FLuc in NIH3T3 cells Fluc(Conventional) Eluc(New) x5.6 lens 3 min exposure High Quantum Yield in Cell Dr.Y.Nakajima,AIST SV40-PTGRm-Cytosol in NIH3T3-3-4 cells 200 mm Luciferin K in 10% FBS, 25 mm Hepes Medium: DMEM+10%FBS, 200µM D-Luciferin
30 Bioluminescence image of NIH3T3 Transfection of the CMV Eluc reporter construct into NIH3T3 cells CMV promoter Eluc(2µg) Transfection : lipofection Medium: DMEM+10%FBS, 200µM D-Luciferin Magnification of objective lens : 20, 10 Exposure time : 3min( 10) Dr.Y.Nakajima,AIST
31 The movie of Bmal1 expression Relative intensity Time (hr) Dr. Ken-ichi Honnma,Hokkaido Uni. 4hr 16hr 28hr 40hr 52hr 64hr Cell : Rat1 Reporter: Bmal1 Promoter-Fluc Medium : DMEM, 10%FBS, 25mM HEPES, 0.2mM D-Luciferin Magnification of objective lens : 5.2 Exposure time : 20min
32 Image Analysis 2000 Relative intensity Time (hr) 1hr Dr.Y.Nakajima,AIST 96 hr Cell : NIH3T3 Reporter: Bmal1 Promoter-Fluc Transfection: 2µg Medium : DMEM, 10%FBS, 25mM HEPES, 0.2mM D-Luciferin Magnification of objective lens : 5.6 Exposure time : 20min
33 Human genome sequence ATTO Gel Documentation Analysis System
34 Analysis Tool Promorter Gene Transcription Reporter Gene Assay Translation mrna DNA Chip Real-time PCR Northern Blotting Protein Modification Complex Protein A Protein B HPLC 2D-Electrophoresis MS Western Blotting
35 Photon Counting e- Time PMT
36 Quantitative Analysis of mrna and Protein Extraction of RNA :PCR, Northern Blotting Protein: Western Blotting hr
37 Monitoring of Real-time Changes Gen ne Expression Real-time reporter assay Time Conventional reporter assay (end-point assay)
38 Promoter Analysis RLU Promoter poly A Luciferase poly A Light Luciferin MCS Vector Transfection
39 Element Analysis cis elements Constitutive Promoter poly A MCS Luciferase poly A Vector
40 Quantum Efficiency of CCD 量子子効率 (%) QE% Interline CCD マイクロレンズ付 C C D Back Illuminated CCD 背面照射型 C C D Front 前面照射型 Illuminated CCD 波長 (nm) Wave length (nm) Andor Technology
41 Analysis of Gene Expression by Luciferase Reporter Assay Promoter Luciferase gene Living Cell Reporter vector Promoter Endogenous gene Addition of luciferin, ATP, Mg 2+, etc. Luciferase mrna Measurement of bioluminescence by luminometer Lysis of cells
Luminometer for 35mm Dish with CO2 incubator system. AB-2550 Kronos Dio
Luminometer for 35mm Dish with CO2 incubator system AB-2550 Kronos Dio Bioluminescence monitoring in long term Kronos Dio (AB-2550) is a luminometer for detection of bioluminescence in living cells and
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationBright Light, No Lysis
Bright Light, o Lysis Measuring Renilla Luciferase Luminescence in Living Cells By Erika Hawkins 1, M.S., James Unch 2, Ph.D., ancy Murphy 1, B.S., Jolanta Vidugiriene 1, Ph.D., Mike Scurria 2, Dieter
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationGENE EXPRESSION AND EXPERIMENTAL READOUTS ON THE TURNER BIOSYSTEMS FAMILY OF INSTRUMENTS
GENE EXPRESSION AND EXPERIMENTAL READOUTS ON THE TURNER BIOSYSTEMS FAMILY OF INSTRUMENTS Prepared by: Jeff Quast, Associate Product Manager Keywords: Gene Expression, Functional Gene Product, Protein Synthesis,
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationA Genome wide RNAi Screen. in Human Cells. Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1
A Genome wide RNAi Screen for Modifiers of the Circadian Clock in Human Cells Eric E. Zhang,1,2,5 Andrew C. Liu,1,3,5 Tsuyoshi Hirota,1,2,5 Loren J. Miraglia,1 Genevieve Welch,1 Pagkapol Y. Pongsawakul,2
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationViaFect Transfection Reagent
TECHNICAL MANUAL ViaFect Transfection Reagent Instructions for Use of Products E4981, E4982 and E4983 Revised 7/17 TM409 ViaFect Transfection Reagent All technical literature is available at: www.promega.com/protocols/
More informationProduct: Arrest-In TM Transfection Reagent for RNAi
Product: Arrest-In TM Transfection Reagent for RNAi Catalog #: ATR1740, ATR1741, ATR1742, ATR1743 Product Description Arrest-In transfection reagent is a proprietary polymeric formulation, developed and
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationHigh Sensitivity Luminescence Reporter Gene Assay System
High Sensitivity Luminescence Reporter Gene Assay System FOR IN VITRO RESEARCH USE ONLY Contents Page 1. Introduction 3 2. neolite description 4 3. Contents and storage of neolite 12 4. Additional requirements
More informationCignal Reporter Assay Handbook
January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and
More informationCRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611
Data Sheet CRE/CREB Reporter Assay Kit camp/pka Cell Signaling Pathway Catalog #: 60611 Background The main role of the camp response element, or CRE, is mediating the effects of Protein Kinase A (PKA)
More informationTropix Chemiluminescent Kits and Reagents For Cell Biology Applications
PRODUCT FAMILY BULLETIN Tropix Chemiluminescent Kits and Reagents Tropix Chemiluminescent Kits and Reagents For Cell Biology Applications Introduction to Chemiluminescence Chemiluminescence is the conversion
More informationChroma-Glo Luciferase Assay System
TECHNICAL MANUAL Chroma-Glo Luciferase Assay System Instruc ons for Use of Products E491, E492 and E495 Revised 7/15 TM62 Chroma-Glo Luciferase Assay System All technical literature is available at: www.promega.com/protocols/
More informationNucleic Acid Transfection. Genomics. TransIT Transfection Tools. Technical tip D.103
The nucleic acids delivery specialists design our transfection reagents. Our formulations provide superior transfection efficiency and cell viability. This complete range includes TransIT reagents, based
More informationDual-Glo Luciferase Assay System INSTRUCTIONS FOR USE OF PRODUCTS E2920, E2940 AND E2980.
Technical Manual Dual-Glo Luciferase Assay System INSTRUCTIONS FOR USE OF PRODUCTS E292, E294 AND E298. PRINTED IN USA. Revised 8/9 Part# TM58 Dual-Glo Luciferase Assay System All technical literature
More informationDevelopment of a Tissue Slice Culture Model for Prostate Cancer
Development of a Tissue Slice Culture Model for Prostate Cancer Hanneke van Zoggel, PhD Experimental Urology Erasmus MC ; JNI, Be 330 j.vanzoggel@erasmusmc.nl 3D workshop 23/24-09-2013 Create novel models
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More information5 ZFHD sites in variable distances to transcription start site (Fig. S2) pmrlucf luciferase reniformis for Gal4 yeast pmrlucfpa 12Galn
protein origin reference region (aa) construct comment Gal4 yeast -47 pmcgal4-47 pmcrluc-gal4-65 fusion of Rluc, Gal4(-47) and AD of artificial (0) pmczf s fused C-terminally to with 3x myc linker (EQKLISEEDLNG)
More informationUsing ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay
Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Updated: Nov 11, 2016 Introduction Immunoassay is a widely used method for detecting the presence
More informationPre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
More informationDual-Glo Luciferase Assay System Instructions for use of Products E2920, E2940 and E2980.
TECHNICAL MANUAL Dual-Glo Luciferase Assay System Instructions for use of Products E29, E29 and E29. Revised 9/15 TM58 Dual-Glo Luciferase Assay System All technical literature is available at: www.promega.com/protocols/
More informationsirna Transfection Reagent
Description RiboJuice 0.3 ml 71115-3 1.0 ml 71115-4 Description RiboJuice efficiently delivers small interfering RNA (sirna) into a wide range of mammalian cell lines for targeted gene suppression (1).
More informationAgilent s Mx3000P and Mx3005P
Agilent s Mx3000P and Mx3005P Realtime PCR just got better Dr. Ivan Bendezu Genomics Agent Andalucia Real-time PCR Chemistries SYBR Green SYBR Green: Dye attaches to the minor groove of double-stranded
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationCircadian gene expression in mammalian fibroblasts revealed by real-time luminescence reporting: Temperature compensation and damping
Circadian gene expression in mammalian fibroblasts revealed by real-time luminescence reporting: Temperature compensation and damping Mariko Izumo, Carl Hirschie Johnson, and Shin Yamazaki* Department
More informationConvoy TM Transfection Reagent
Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections
More informationMonitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology. Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics
Monitoring Protein:Protein Interactions in Living Cells Using NanoBRET Technology Danette L. Daniels, Ph.D. Group Leader, Functional Proteomics Proteomics and studying dynamic interactions AP-MS Proteomics
More informationTransfection Reagents That Really Work
Transfection Reagents That Really Work non-toxic, biodegradable, highly efficient, serum-compatible Available for DNA,, protein, stem cells www.clontech.com/xf P L A S M I D T R A N S F E C T I O N R E
More information3D Transfection System
3D Transfection System Why 3D Technology? Introduction to Three Dimensional (3D) Cell Culture The goal of three-dimensional (3D) cell culture is to eliminate the stress and artificial responses cells experience
More informationThermo Scientific DharmaFECT Transfection Reagents sirna Transfection Protocol
Protocol Thermo Scientific Transfection Reagents sirna Transfection Protocol The following is a general protocol for use of Thermo Scientific transfection reagents to deliver sirna into cultured mammalian
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationDeveloping a real-time fluorescence cell growth monitoring system
- 65 - Developing a real-time fluorescence cell growth monitoring system Jo-Ting Wang 1, Chun-Han Lu 2, Yao-Nan Wang 2, Ko-Tung Chang 1,* 1 Department of Biological Science and Technology, National Pingtung
More informationPre-made Lentiviral Particles for nuclear permeant CRE recombinase expression
Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE
More informationChemiluminescence Detection. Using UVP s ChemiDoc-It System
Chemiluminescence Detection Using UVP s ChemiDoc-It System Protein Detection Agents Chemiluminescence Fluorescence Colorimetric Detection Radioisotopic Detection Chemiluminescence Generation of light through
More informationAequoScreen aequorin-encoding Plasmids for performing aequorin luminescent assay starting from non-aequorin cell lines
AequoScreen aequorin-encoding Plasmids for performing aequorin luminescent assay starting from non-aequorin s AEQUOSCREEN PLASMIDS A P P L I C A T I O N N O T E Introduction Calcium signaling and Aequorin
More informationConcepts and Methods in Developmental Biology
Biology 4361 Developmental Biology Concepts and Methods in Developmental Biology June 16, 2009 Conceptual and Methodological Tools Concepts Genomic equivalence Differential gene expression Differentiation/de-differentiation
More informationChemically defined conditions for human ipsc derivation and culture
Nature Methods Chemically defined conditions for human ipsc derivation and culture Guokai Chen, Daniel R Gulbranson, Zhonggang Hou, Jennifer M Bolin, Victor Ruotti, Mitchell D Probasco, Kimberly Smuga-Otto,
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationBioware Brite Cell Line HepG2-Red-FLuc
TECHNICAL DATA SHEET Bioware Brite Cell Line Research Use Only. Not for use in diagnostic procedures. Bioware Brite Cell Line HepG2-Red-FLuc Product No.: BW134280 Material Provided Cells: Format: 2 x 1
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationInstructions. Fuse-It-siRNA. Shipping and Storage. Overview. Kit Contents. Specifications. Note: Important Guidelines
Membrane fusion is a highly efficient method for transfecting various molecules and particles into mammalian cells, even into sensitive and primary cells. The Fuse-It reagents are cargo-specific liposomal
More informationColor-Switch CRE Reporter Stable Cell Line
Color-Switch CRE Reporter Stable Cell Line Catalog Number SC018-Bsd SC018-Neo SC018-Puro Product Name / Description CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). Cell line expresses "LoxP-GFP-stop-
More informationTable S1. Primer sequences
Table S1. Primer sequences Primers for quantitative PCR Tgf 1 Forward Tgf 1 Reverse Tgf 2Forward Tgf 2Reverse Tgf 3 Forward Tgf 3 Reverse Tgf r1 Forward Tgf r1 Reverse Tgf r2 Forward Tgf r2 Reverse Thbs1
More informationDolphin-Chemi Plus. Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system
Application Note 03 Dolphin-Chemi plus 8/22/2007 Dolphin-Chemi Plus Aim: To visualise and evaluate the performance of chemiluminescent immunoblots using Wealtec s Dolphin-Chemi plus image system INTRODUCTION
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/317/5837/477/dc1 Supporting Online Material for AAV Vector Integration Sites in Mouse Hepatocellular Carcinoma Anthony Donsante, Daniel G. Miller, Yi Li, Carole Vogler,
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use
More informationStem cell transfection guide
APPLICATION NOTE Stem cell transfection guide Gene delivery solutions Introduction Stem cells continue to show immense promise for the future of regenerative medicine and personalized therapeutic treatments.
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationTHE DELIVERY EXPERTS. INTERFERin in vitro sirna transfection reagent PROTOCOL
THE DELIVERY EXPERTS INTERFERin in vitro sirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna transfection reagent that ensures efficient gene silencing and reproducible transfection
More informationElectroporation of human induced pluripotent stem (ips) cells
Electroporation of human induced pluripotent stem (ips) cells Ribonucleoprotein delivery using the Alt-R CRISPR-Cas9 System and the NEPA21 Electroporator Contributed by Nepa Gene, Chiba, Japan (info@nepagene.jp)
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationAzure Biosystems Western Blotting Workflow
Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for
More informationGeneration of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
More informationProtocol. High-throughput Transfection Protocol for GoClone Reporter Assays. Tech support: Luciferase Assay System
Luciferase Assay System Protocol High-throughput Transfection Protocol for GoClone Reporter Assays LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow promoter luciferase Step 1: Simultaneously
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationingenio electroporation kits & solution
ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic
More informationAutomated Optimization of Cell Transfection
Automated Optimization of Cell Transfection Abstract Cell transfection is an essential technique for interrogating cellular pathways. Determining the optimal conditions for introducing nucleic acids into
More informationFluo-2 MA Brighter, Faster, Cheaper
Fluo-2 MA Brighter, Faster, Cheaper Fluo-2 MA Essentials A direct substitute for Fluo-3 and Fluo-4 The same molecule as Fluo-8 Nearly twice as bright as Fluo-4 Nearly four times as bright as Fluo-3 AM
More informationToxiLight bioassay kit
ToxiLight bioassay kit Non destructive cytotoxicity assay www.lonza.com U.S. Scientific Support: 800-521-0390 scientific.support@lonza.com EU/ROW Scientific Support: +49-221-99199-400 scientific.support.eu@lonza.com
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationTitle producing a large number of transge. Author(s) Suehara, Tetsuya; Takakura,
Title Saturation of transgene protein syn producing a large number of transge Author(s) Takahashi, Yuki; Nishikawa, Suehara, Tetsuya; Takakura, Makiya; Yoshino Citation Biotechnology and bioengineering
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationTransIT -mrna Transfection Kit
INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationLes ARN de l Horloge et L Horloge des ARN. Franck Delaunay University of Nice and CNRS, France
Les ARN de l Horloge et L Horloge des ARN Franck Delaunay University of Nice and CNRS, France Marseille 3 oct 27 Circadian rhythms Bioluminescence 11 1 9 8 7 12 6 1 2 3 4 5 Photosynthesis Hatching Locomotor
More informationXfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
More informationFor identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells.
ab110216 MitoBiogenesis TM In-Cell ELISA Kit (IR) Instructions for Use For identifying inhibitors and activators of mitochondrial biogenesis in adherent cultured cells. This product is for research use
More informationINTERFERin in vitro sirna/mirna transfection reagent PROTOCOL
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
More informationjetpei -Macrophage in vitro DNA transfection reagent PROTOCOL
jetpei - in vitro DNA transfection reagent PROTOCOL DESCRIPTION jetpei - allows DNA transfection of macrophages and macrophage-like cells. It contains a mannose-conjugated linear polyethylenimine that
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationHigh-Throughput In Vivo Bioluminescence Imaging System
IVIS SpectrumBL P R O D U C T N O T E Pre-clinical in vivo imaging Key Features Ultra high-sensitivity to support in vivo bioluminescence, chemiluminescence and Cerenkov imaging High-throughput (10 mice)
More informationNormalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5
Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)
Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming
More informationOrflo Application Brief 3 /2017 GFP Transfection Efficiency Monitoring with Orflo s Moxi GO Next Generation Flow Cytometer. Introduction/Background
Introduction/Background Cell transfection and transduction refer to an array of techniques used to introduce foreign genetic material, or cloning vectors, into cell genomes. The application of these methods
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationExam 2 BIO200, Winter 2012
Exam 2 BIO200, Winter 2012 Name: Multiple Choice Questions: Circle the one best answer for each question. (2 points each) 1. The 5 cap structure is often described as a backwards G. What makes this nucleotide
More informationFunctional characterisation
Me Me Ac Ac Functional characterisation How can we know if measured changes in DNA methylation and function (phenotype) and linked, and in what way? DNMT Dianne Ford Professor of Molecular Nutritional
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationAlt-R CRISPR-Cas9 system:
Alt-R CRISPR-Cas9 system: Delivery of ribonucleoprotein complexes into Jurkat T cells using the Bio-Rad Gene Pulser Xcell Electroporation System See what more we can do for you at www.idtdna.com. For Research
More informationGloResponse CRE-luc2P HEK293 Cell Line INSTRUCTIONS FOR USE OF PRODUCT E8500.
Technical Bulletin GloResponse CRE-luc2P HEK293 Cell Line INSTRUCTIONS FOR USE OF PRODUCT E8500. PRINTED IN USA. Revised 8/11 GloResponse CRE-luc2P HEK293 Cell Line All technical literature is available
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/157/ra4/dc1 Supplementary Materials for Genome-Wide RNAi Screen Reveals Disease-Associated Genes That Are Common to Hedgehog and Wnt Signaling Leni S. Jacob,
More informationHossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
More informationMitochondrial DNA Isolation Kit
Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationUser s Guide MegaTran 1.0 Transfection Reagent
User s Guide MegaTran 1.0 Transfection Reagent Package Contents and Storage Conditions... 2 Related products... 2 Introduction... 2 Production and Quality Assurance:... 3 Experimental Procedures... 3 Transfection
More informationFRAUNHOFER IME SCREENINGPORT
FRAUNHOFER IME SCREENINGPORT Detection technologies used in drug discovery Introduction Detection technologies in drug discovery is unlimited only a biased snapshot can be presented Differences can presented
More informationRNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors
Supplementary Information RNA-Guided Gene Activation by CRISPR-Cas9-Based Transcription Factors Pablo Perez-Pinera 1, Daniel D. Kocak 1, Christopher M. Vockley 2,3, Andrew F. Adler 1, Ami M. Kabadi 1,
More information