Supplemental Information. Spatial and Temporal Regulation of Receptor. Endocytosis in Neuronal Dendrites Revealed

Transcription

1 Cell Reports, Volume 18 Supplemental Information Spatial and Temporal Regulation of Receptor Endocytosis in Neuronal Dendrites Revealed by Imaging of Single Vesicle Formation Morgane Rosendale, Damien Jullié, Daniel Choquet, and David Perrais

2 Figure S1 related to Figure 1: The ph 5.5 solution does not affect TfR endocytosis in neurons A, Example of an endocytic event detected with the pph assay in a neuron (DIV13) transfected with TfR-SEP. Labelled transferrin (Tfn-A568, 5 µg/ml) is co-applied in both ph 5.5 and ph 7.4 perfusion channels. Note the colocalization of TfR-SEP at ph 7.4 and the Tfn-A568 signal. B, Average fluorescence of scission events in the green (dark green ph 7.4, light green ph 5.5) and red channels, aligned to the time of vesicle detection (n = 1169 events in 8 cells. Gray area indicates 95% confidence intervals for significant enrichment. C, Top: images of neurons after 10 minutes of Tfn-A568 application without (left) or with (right) the pph assay. Images taken with wide field epifluorescence microscopy with the same illumination and camera settings and displayed with the same contrast. Bottom, average Tfn-A568 in the soma and proximal dendrites of neurons without (n = 10) or with (n = 9) the pph assay. The average fluorescence values were not significantly different (p = 0.22). D, Kinetics of Tfn-A568 fluorescence accumulation in cells submitted (grey curve, n = 9 cells) or not (black curve, n = 10 cells) to the pph assay as described in C. Normalization done at 1 min after the start of the recording. E, Example trace of current amplitudes evoked by sequential application of acidic solution during the pph assay, recorded in a neurons voltage clamped at -70 mv. After 2 minutes, amiloride (500 µm) was added to the two solutions (ph 7.4 and 5.5) of the application pipette. Inset: currents evoked by acidic solution at time points indicated in the main figure. Note that the fast decrease in current amplitude observed at the beginning of the recording and the partial recovery after washout of amiloride can be explained by a desensitization of ASICs. F, Normalized current amplitude measured at the peak evoked by the pph assay before, during and after application of amiloride (n = 6 cells). G, Normalized cumulative frequency of events detected with the pph assay before and during application of amiloride. H, The average frequency of detected endocytic events is the same before (693 events) and during (n = 673 events) application of amiloride (p = 0.81).

3 Figure S2 related to Figure 1: Internalization of TfR-SEP monitored with Trypan Purple A, Consecutive images taken at 100 ms intervals of a neuron transfected with TfR-SEP during the application and washout of Trypan Purple (5 mm). Note the rapid quenching of most of the extracellular fluorescence, with some dot-like structures still visible B, Example voltage recordings of a neuron (15 DIV) before and during the application of Trypan. Responses to injection of -100, 0 and +100 pa currents for 200 ms show that the membrane resistance and neuronal excitability are not changed by the application of Trypan. In 10 neurons recorded, the membrane resistances calculated from current injections was 309 ± 43 and 313 ± 47 MΩ before and after Trypan, respectively, and were not significantly different (p = 0.82). The numbers of evoked action potentials were 3.8 ± 0.5 and 3.9 ± 0.5 before and after Trypan, respectively, and were not significantly different (p = 0.76). C, Example of an event detected with the ptry protocol at time 0 in a neuron transfected with TfR- SEP. D, Average fluorescence, aligned to the time of vesicle detection for 1022 events in 8 neurons of fluorescence without (top, HBS) and with 5 mm Trypan (bottom). Grey area indicates 95% confidence intervals for significant enrichment. E, Average neuron fluorescence outside of low ph or Trypan application during the pph (black, n = 7) or the ptry (purple, n = 5) protocols. F, cumulative event frequency normalized to 100 at 3 minutes. Note the progressive decrease in event frequency with the ptry protocol, which goes down to 68 ± 6 % of initial frequency in the final 6-9 minutes of recording, whereas the frequency remains stable for the pph assay (108 ±17 % of initial frequency).

4 Figure S3 related to Figure 1: Monitoring stimulated endocytosis of SEP-β2AR. A, Portion of a dendrite transfected with SEP-β2AR and Clc-mCh before (top) and during (bottom) application of 10 µm isoproterenol. The SEP-β2AR fluorescence increased 1.8 ± 0.2-folds at 1263 CCSs in 5 neurons. B, Example event detected at time 0 during isoproterenol application. Note the formation of a cluster visible 2 min before vesicle formation while the clathrin cluster does not change. C, Normalized cumulative frequency of events (552 events in 5 cells). D, Average fluorescence in the green channel at the indicated ph, aligned to the time of vesicle detection, before (left, 52 events) and during isoproterenol application (right, 352 events). The fluorescence at ph 5.5 at the time of vesicle formation reflects receptor loading in vesicles. It does not vary significantly during agonist application (626 ± 77 a.u. during baseline; 786 ± 33 a.u. in the presence of isoproterenol; p = 0.41 Kolmogorov-Smirnov test).

5 Figure S4 related to Figure 2: AMPARs are internalized at CCSs. A, Example event detected at time 0 in a neuron cotransfected with SEP-GluA1 and Clc-mCherry. On the right is the merged image of SEP-GluA1 at ph 7.4 and Clc (averages of 10 frames around the event). White cross indicates the location of the event. B, Average fluorescence of SEP-GluA1 at the indicated ph, and of Clc-mCherry, aligned to the time of vesicle detection (53 events in 5 cells). Gray areas represent the 95% confidence interval of randomized data indicating clathrin enrichment at the site of vesicle formation.. C,D, Same as A and B for neurons transfected with SEP-GluA2, GluA1 and Clc-mCherry. Averages of 266 events recorded in 16 cells.

6 Figure S5 related to Figure 4: Internalization of SEP-GluA2 visualized with the pulsed Trypan protocol is stimulated by NMDA application. A, Currents evoked by application of 20 µm NMDA and 10 µm glycine in a solution containing 0.3 mm Mg 2+ (chemltd stimulation), at ph 7.4 for 2 s then at ph 5.5 and back to ph 7.4. Note the complete reversal of inhibition. The neuron was voltage clamped at -60 mv. B, Same as A with the application of Trypan (5 mm) instead of low ph. The inhibition by Trypan is completely reversible as well. C, Inhibition of NMDA currents measured just before and at the end of quencher application by ph 5.5 solution and Trypan. These inhibitions are not significantly different (p = 0.68). D, Illustration of the paradigm used to visualize the formation of endocytic vesicles by ptry before, during and after stimulation of neurons with the cltd protocol. Bleaching was performed at ph 5.5 for neurons expressing SEP-GluA2 and AP-GluA1. See materials and methods for details. E, Two GluA2 example events. The first event, detected at time 0, occurs in the dendritic shaft. 44 seconds later, a second event occurs in a spine neck. F, Average ratio of event frequency normalized to baseline (n = 5 cells). G, Normalized cumulative frequency of endocytic events during NMDA application. The Y-axis origin starts at 100, which corresponds to the normalized cumulative frequency in the control period. H, Average fluorescence of dendritic regions of the cells used in Figure 4 at ph 7.4 (grey) and ph 5.5 (green). I, Average fluorescence of dendritic regions of the cells used in Figure S5D-G in HBS (grey) and HBS + Trypan (purple).

7 Supplemental Experimental procedures Primary neuronal cultures and transfection Neurons were prepared and cultured following the Banker protocol (Kaech and Banker, 2006). In brief, dissociated hippocampal neurons from embryonic day 18 rat embryos were plated on 18 mm poly-d-lysinecoated glass coverslips at a density of cells/ml in MEM containing 10 % horse serum (Invitrogen) for 3 h, then cultured in Neurobasal medium supplemented with 2 mm glutamine and 10 % Neuromix (PAA), B27 (Gibco) or SM1 supplement (Stem Cell) on a feeder layer of glial cells at 37 C in 5 % CO2 for 13 to 21 days. TfR-SEP, SEP-β2AR, SEP-GluA1, Clc-mCh and Homer1c-RFP (tandem dimer Tomato) plasmids have been described previously (Petrini et al., 2009; Letellier et al., 2014; Merrifield et al., 2005; Taylor et al., 2011; Jullie et al., 2014). SEP-GluA2 was obtained by inserting the SEP sequence after the signal peptide of rat GluA2 coding sequence using AgeI/NheI restriction sites. This SEP-GluA2 insert was then cloned into the pbi-tet-on vector (Clontech) by MluI and EcoRI. AP-GluA1 was generated by introducing a biotin ligase acceptor peptide (AP) tag (GGCCTGAACGACATCTTCGAGGCCCAGAAGATCGAGTGGCACGAG) on the N-terminal part of rat GluA1 after the signal peptide. The AP-GluA1 insert was cloned in a psynaav vector (expression under the human Synapsin promoter) between EcoRI/HindIII restriction sites. Neurons were transfected at 7-10 DIV except when expressing Dyn1-mCh (transfected at DIV 13, i.e. 24h before the experiment to prevent mcherry induced clusterization). Transfection was performed using Effectene (Qiagen) following the company protocol except for SEP-GluA2 expressing neurons used for chemltd experiments under the pph assay which were transfected using a calcium phosphate technique (Wienisch and Klingauf, 2006). Briefly, the culture medium was removed and replaced with Fresh, unsupplemented Neurobasal medium min prior to transfection. The calcium phosphate (125 mm final concentration)/dna precipitate was formed in BES buffered saline (in mm: 50 BES, 280 NaCl, 1,5 NA 2HPO 4.2H 2O; ph 7.07) for min. The precipitate was added dropwise to the cells. Following a min transfection, during which a fine sandy precipitate covered the cells, the cultures were washed in HBSS and returned to the original culture medium. These neurons were systematically cotransfected with a tetracycline transactivator plasmid (Clontech) to allow for the inducible expression of the protein by doxycycline (2 µg/ml 48 hr prior to an imaging session) as well as with AP-GluA1 to favor the heterodimerization and membrane export of the overexpressed AMPAR subunits. Fluorescence Imaging Imaging was performed at 35 C on a TIRF microscope previously described (Shen et al., 2014) on neurons at DIV (Figures 1, S1, S2 and S3) or at DIV (Figures 2, 3, 4 and S4). Cells were perfused with HEPES buffered saline solution (HBS) with, in mm: 120 NaCl, 2 KCl, 2 MgCl 2, 2 CaCl 2, 5 D-glucose and 10 HEPES, and adjusted to ph 7.4 and mosm. For the pph assay, MES buffered saline solution (MBS) was prepared similarly by replacing HEPES with MES and adjusting the ph to 5.5. (Salts from Sigma Aldrich). HBS and MBS were perfused locally around the recorded cell using a 2-way borosilicate glass pipette. Local perfusion solutions were supplemented with (in µm) 3 Na 2-Ascorbate, 500 amiloride (when applicable), 0.5 TTX and 2% v/v Neuromix (PAA laboratories) or B27 (Gibco) on the day of the experiment. For the ptry protocol, 5 mm Trypan purple (Interchim) were diluted from a 0.1 M stock solution in HBS. After Trypan dilution, the osmolarity was not changed and the ph was 7.2. Chemical LTD was induced by using HBS/MBS solutions containing 0.3 mm MgCl 2 (instead of 2) supplemented with 20 µm NMDA (Abcam) and 10 µm Glycine (Sigma). For control experiments, D-APV (50µM) was added to all local perfusion solutions (baseline, stimulation and washout) as well as in the main bath HBS perfusion. The fluorescence of neurons transfected with SEP-GluA2 and unlabelled-glua1 was distributed throughout the neuronal membrane, including spines and PSDs labelled with Homer1c-RFP. However, when

8 Trypan or MBS was applied to these neurons, the fluorescence was only partially quenched, especially in the dendritic shaft consistent with the presence of a non-acidic intracellular compartment (also see (Rathje et al., 2013)). This residual background fluorescence added to the less complete quenching of surface receptors by Trypan than by ph 5.5 solution prevented the efficient detection of endocytic events. To reduce this artefact, data from Figure S4 were acquired after bleaching intracellular receptors of whole dendrites as in Petrini et al. (2009) with a FRAP module (ILas system, Roper Scientific). During this step, neurons were bathed in ph 5.5 solution in the presence of amiloride to render SEP-tagged receptors located on the plasma membrane nonfluorescent, thus sparing them from bleaching. Neurons were then allowed to recover in normal solution for 10 minutes. Patch-clamp recordings Recording pipettes (resistance, 3-5 MΩ) were filled with a solution containing the following (in mm): 110 KCH 3SO 3, 2 KCl, 1 EGTA, 0.1 CaCl 2, 10 HEPES, 4 NaATP, 0.4 NaGTP and 5 Na 2Phosphocreatine, adjusted to ph 7.2 with KOH ( mosm). Cells were recorded on the same microscope and using the same HBS solution as for fluorescence imaging. They were voltage clamped at -60 mv or kept in current clamp mode around -60 mv with an EPC10 patch-clamp amplifier (HEKA). See figure legends (Figures S1 and S3) for more details. Image analysis Semi-automatic detection of endocytic events was performed as described previously for cell lines (Shen et al., 2014; Taylor et al., 2011b). In short, a sudden, punctate, fluorescence increase appearing in ph 5.5 images was detected as being an endocytic event if 1) it was visible for more than 3 frames (i.e. 8 seconds), and 2) it appeared at the same location as a pre-existing fluorescence cluster detectable in ph 7.4 images. Candidate events were then validated by visual inspection in a random order to avoid any bias during cell stimulation. In neurons, the proportion of automatically detected events validated by visual inspection (57.1 ± 10.6 % for TfR- SEP events in this study) was smaller than for cell lines (~80 %, Taylor et al. 2011, Shen et al. 2014). Indeed, we saw a greater contribution of moving intracellular vesicles presumably because transport tracks in small dendrites are closer to the membrane than in larger cell bodies, and vesicles travelling along them become visible within the field of TIRF illumination. In addition, we saw a sizeable amount of exocytic events (characterized by the sudden appearance of fluorescence at ph 7.4), followed by the appearance of the same organelle at ph 5.5. We have characterized this type of kiss-and-run event previously (Jullié et al., 2014). They are independent of clathrin and dynamin, thus independent of clathrin mediated endocytosis, and were not included in this study. Event frequency was expressed per cell surface area measured on the cell mask. The cell mask was determined by the reunion of the thresholded image of SEP tagged receptors at ph 7.4 and the thresholded image of synapses (i.e. Homer1c-tdTom) when applicable. Determination of the number of events per CCS (Figure 1H and related text) was performed using Clc-mCherry images acquired at ph 5.5 throughout each pph recording to reduce the contribution of fluorescence emanating from TfR-SEP surface clusters due to spectral bleed-through from the green to the red channel. These images were averaged into a single image for segmentation. An endocytic event was considered as originating from a CCS if it was detected less than 750 nm away from its center. Cumulative distance plots were obtained by measuring the Euclidian distance between the center of an object A (a CCS, a PSD or an event) and the closest pixel identified in segmented images as belonging to an object B (a PSD or a CCS). Randomized datasets were obtained by generating 1000 cumulative plots of distances for n A randomly scattered objects within the cell mask, where n A is the number of objects A detected. The 95 % upper and lower percentiles of this randomized dataset are represented in grey, and the median as a black line. Parts of the measured cumulative distance plots outside of the gray area of the randomized dataset were considered a specific enrichment, i.e. close to PSDs for GluA1 and GluA2 events (Fig 2F,I; Fig 3F; Fig

9 4C,D) and for CCSs (Fig 2L). Histogram representations associated to these graphs were obtained by subtracting the median of the randomized distance plots to the distance plot of actually detected objects. Excess of objects A occurring closer than chance to an object B was quantified as the sum of the first positive 100 nm bins of this histogram (i.e nm distances). We further assessed significant differences between the two distributions with the non-parametric Kolmogorov-Smirnov (KS) test with a significance level of Fluorescence quantification of events (Figures 1C, 1F, 2D, 4E, S1B, S2D, S3D, S4B,D) was performed as in (Shen et al., 2014). In short, each value is calculated as the mean intensity in a 2-pixel radius circle centered on the detection to which the local background intensity is subtracted (the local background is taken as the 20 th to 80 th percentile of fluorescence in an annulus of 5 to 2 pixel outer and inner radii centered on the detection). The grey area indicates represented on the graphs are a display of the 95% confidence intervals for significant enrichment obtained from randomized fluorescence data. Overall cellular fluorescence intensity (Figure S1C,D, S2E) was measured in a mask determined for each cell by thresholding in images taken in HBS (ph 7.4, no Trypan) during 10 min of pph or pulsed-trypan recordings. Neurons transfected with fluorescent AMPAR subunits (SEP-GluA1 or SEP-GluA2) sometimes displayed very low frequencies of detectable events, yielding in many cases only a few validated events per recording, and often no events in the control period of 3 minutes, precluding a reliable measure of frequency and its modulation by stimulation. This could result from poor signal to noise images due to the fact that many AMPA receptors are located in weakly acidic intracellular organelles, making their SEP tag visible even during extracellular application of ph 5.5 buffer. Therefore, we kept for analysis only those cells where more than 15 events were automatically detected within 8-10 minute recordings. The final dataset was as follows: for cells cotransfected with Homer1c-tdTom, we kept 8 SEP-GluA1 transfected cells with 16 to 187 automatic detections (yielding 6 to 55 validated events) out of 14 recorded cells; we kept 14 SEP-GluA2 transfected cells with 62 to 268 automatic detections (yielding 10 to 39 validated events) out of 58 recorded cells. For cells co-transfected with clc-mcherry, we kept 4 SEP-GluA1 transfected cells with 31 to 54 automatic detections (yielding 10 to 14 validated events) out of 13 recorded cells; we kept 12 SEP-GluA2 transfected cells with 21 to 160 automatic detections (yielding 8 to 53 validated events) out of 24 recorded cells. On the other hand all recorded cells transfected with TfR-SEP or SEP-β2AR could be analyzed, most probably because their intracellular fluorescence was very weak, consistent with the fact that these receptors are mostly found in acidic recycling endosomes rather than in the more neutral endoplasmic reticulum. Supplemental References Kaech, S., and Banker, G. (2006). Culturing hippocampal neurons. Nat. Protoc. 1, Letellier, M., Elramah, S., Mondin, M., Soula, A., Penn, A., Choquet, D., Landry, M., Thoumine, O., and Favereaux, A. (2014). mir-92a regulates expression of synaptic GluA1-containing AMPA receptors during homeostatic scaling. Nat. Neurosci. 17, Wienisch, M., and Klingauf, J. (2006). Vesicular proteins exocytosed and subsequently retrieved by compensatory endocytosis are nonidentical. Nat. Neurosci. 9,