Single nucleotide polymorphisms in rye (Secale cereale L.): discovery, frequency, and applications for genome mapping and diversity studies

Transcription

1 Theo Appl Genet (2007) 114: DOI /s ORIGINAL PAPER Single nucleotide polymophisms in ye (Secale ceeale L.): discovey, fequency, and applications fo genome mapping and divesity studies R. K. Vashney Æ U. Beie Æ E. K. Khlestkina Æ R. Kota Æ V. Kozun Æ A. Gane Æ A. Böne Received: 21 July 2006 / Accepted: 7 Januay 2007 / Published online: 8 Mach 2007 Ó Spinge-Velag 2007 Abstact To elucidate the potential of single nucleotide polymophism (SNP) makes in ye, a set of 48 baley EST (expessed sequence tag) pime pais was employed to amplify fom DNA pepaed fom five ye inbed lines. A total of 96 SNPs and 26 indels (insetion deletions) wee defined fom the sequences of 14 of the esulting amplicons, giving an estimated fequency of 1 SNP pe 58 bp and 1 indel pe 214 bp in the ye tansciptome. A mean of 3.4 haplotypes pe Communicated by A. Schulman. Electonic supplementay mateial The online vesion of this aticle (doi: /s ) contains supplementay mateial, which is available to authoized uses. R. K. Vashney U. Beie R. Kota A. Gane A. Böne Leibniz Institute of Plant Genetics and Cop Plant Reseach (IPK), Coensstaße 3, Gatesleben, Gemany E. K. Khlestkina Institute of Cytology and Genetics, Sibeian Banch of the Russian Academy of Sciences, Laventyeva Avenue 10, Novosibisk , Russia V. Kozun Lochow-Petkus GmbH, Gimsehlstaße 31, Einbeck, Gemany R. K. Vashney (&) Intenational Cops Reseach Institute fo the Semi-Aid Topics (ICRISAT), Patancheu Andha Padesh, India .k.vashney@cgia.og Pesent Addess: R. Kota Plant Disease Resistance Goup, CSIRO, Plant Industy, PO Box 1600, Canbea ACT 2601, Austalia make with a mean expected heteozygosity of 0.66 wee obseved. The nucleotide divesity index (p) was estimated to be in the ange To impove assay cost-effectiveness, 12 of the 14 SNPs wee conveted to a cleaved amplified polymophic sequence (CAPS) fomat. The esulting 12 SNP loci mapped to chomosomes 1R, 3R, 4R, 5R, 6R, and 7R, at locations consistent with thei known map positions in baley. SNP genotypic data wee compaed with genomic simple sequence epeat (SSR) and EST-deived SSR genotypic data collected fom the same templates. This showed a boad equivalence with espect to genetic divesity between these diffeent data types. Intoduction Single nucleotide polymophisms (SNPs) ae the most basic unit of genetic vaiation and epesent the commonest class of DNA-based makes (Cho et al. 1999; Rafalski 2002). As a esult, they can, in pinciple, be used to constuct genetic maps with an at least 100-fold highe make density than is possible using micosatellites (o simple sequence epeats SSRs). The highe genetic stability of SNP ove SSR, which is cuently the most widely used make platfom in cop systems, is a futhe incentive fo thei development (Cho et al. 1999). In addition to poviding an enhanced mapping esouce, othe applications, such as the assessment of genetic divesity, make-assisted beeding, and the detection of genome-wide linkage disequilibium and genotype/phenotype associations would benefit fom thei wide-scale development. All

2 1106 Theo Appl Genet (2007) 114: these activities would become moe pacticable than is possible with SSRs, thanks to the ease with which SNP genotyping can be automated (Rafalski 2002). A majo oute fo SNP discovey in genic sequence stats with an in silico compaison of homologous sequences fom two o moe epesentatives of a given species. Vaiants identified in this way geneally need to be validated in vito by esequencing, befoe specific SNP assays can be designed and tested. This boad appoach has been employed fo SNP discovey in ice (Oyza sativa; Nasu et al. 2002; Feltus et al. 2004), maize (Zea mays; Tenaillon et al. 2001; Ching et al. 2002), wheat (Titicum aestivum; Somes et al. 2003; baley (Hodeum vulgae; Kota et al. 2001; Russell et al. 2004; Rostoks et al. 2005), soybean (Glycine max; Zhu et al. 2003; Van et al. 2004), and sugabeet (Beta vulgais; Möhing et al. 2004). Rye (Secale ceeale L.) is a significant cop in Nothen and Easten Euope. Its compaative advantage ove the othe tempeate ceeals lies in its excellent toleance to low tempeatue and high levels of soil aluminium, and its ability to ealise acceptable gain-yield whee othe cops cannot (Madej 1996). Rye is also an impotant esevoi of genes fo wheat impovement, and is a paent of titicale, the synthetic wheat ye hybid, which occupies a significant niche in the copping system. As a esult, the identification and genetic mapping of genes esponsible fo enhanced agonomic taits and abiotic stess toleances is useful beyond thei immediate benefit to ye genetics and beeding. To achieve these goals, wellsatuated molecula genetic maps of ye ae equied. Seveal genetic linkage maps, constucted fom a vaiety of populations and using vaious make platfoms have been developed fo ye (Devos et al. 1993; Philipp et al. 1994; Senft and Wicke 1996; Kozun et al. 2001; Bednaek et al. 2003, summaized in Vashney et al and Chikmawati et al. 2006). In fact, the exploitation of the heteologous RFLP (estiction fagment length polymophism) makes, developed fo wheat and baley, fo constucting the genetic maps of ye have established good elationships among diffeent linkage goups and genomes of thee Titiceae species, i.e. wheat, baley, and ye (Devos et al. 1992, 1993; Devos and Gale 1993). Howeve, in ecent yeas, as with othe cops, SSRs have come to epesent the makes of choice fo beeding applications (Gupta and Vashney 2000). In an attempt to incease the limited numbe of functional SSR assays in ye, Khlestkina et al. (2004, 2005) developed SSR makes fom ye ESTs (expessed sequence tags) and also tansfeed the wheat-oiginating SSRs (Röde et al. 1998, 2004) to the ye genetic maps. They wee able to map a numbe of both EST-deived (essr) and genomic (gssrs) loci in fou ye mapping populations. A paticula poblem in using such heteologous SSR assays is that only a small popotion of gssr makes is tansfeable, and that essr makes, while eadily tansfeable, tend to be elatively non-polymophic (Vashney et al. 2005). Pesently, a lage numbe of ESTs ae available fo wheat and baley as compaed to ye and a compehensive esouce of EST-based makes including SNPs have been developed fo baley at Gatesleben. Theefoe it is anticipated that the existing esouce of baley EST-based makes could be used fo developing the genic makes in ye fo enhancing the density of the ye genetic maps as well as poviding additional anchoing points between ye and baley genetic maps. The pesent study was undetaken with the following objectives: (a) to assess the possibility of using baley genomic esouces fo undetaking SNP discovey in ye, (b) to assess SNP fequency and nucleotide divesity in the ye genome, (c) to develop affodable assays fo SNP genotyping, (d) to integate SNP makes into the ye genetic maps, and (e) to make a compaison of SNP with gssr and essr makes in the context of divesity analysis. Mateials and methods Plant mateials and PCR DNA was pepaed, as pe Khlestkina et al. (2004), fom five inbed lines (N2, N6, N7, P87, and P105) used as paents of the fou F 2 mapping populations descibed by Kozun et al. (2001) and Malyshev et al. (2003), and fom 74 individuals selected fom each of the fou mapping populations. A set of 48 pime pais was sampled fom a collection of >200 EST-based baley SNP assays. The 48 loci mapped to all seven baley linkage goups, and wee associated with a high nucleotide divesity index (p) (unpublished data). The baley amplicons wee of mean size bp. All PCR pocedues followed those descibed elsewhee (Kota et al. 2001, 2003). SNP discovey Rye amplicons wee sequenced in both fowad and evese oientation using big dye-teminato chemisty (Applied Biosystems, Foste City, CA, USA). Base calling was caied out using Phed (Ewing et al. 1998).

3 Theo Appl Genet (2007) 114: Raw sequence data wee timmed using a sliding window of 50 bp with a minimum aveage Phed scoe of 20, and filteed fo a minimum length of 100 bp. Sequenche (Gene Codes Copoation, Ann Abo, MI, USA) softwae was then used to geneate contigs fom the fowad and the evese sequences of each genotype with the paametes: (a) minimum match 85%, (b) minimum ovelap 20 nt, and (c) assembly algoithm dity data. The sequences wee validated by a manual inspection of the tace files and edited whee appopiate. Finally, the contigs wee aligned with eithe GCG Pileup o ClustalW (Gibskov et al. 1984; Thompson et al. 1994), and putative SNPs diffeentiating the five ye-inbed lines wee identified. Polymophism infomation content (PIC) and p The polymophism infomation content (PIC) was defined as pe Nei (1987) as PIC ¼ 1 Xk i¼1 P 2 i whee k is the total numbe of alleles and P is the fequency of the ith allele at a given locus. The genetic vaiability was modelled by p, defined by the atio K/L, whee K is the aveage numbe of polymophic nucleotide sites in a sequence of length L bp (Nei and Li 1979). The standad deviation of p was calculated accoding to Hatl and Clak (1997). Functional annotation Amplicon sequences containing a mappable SNP wee tested against the non-edundant peptide (NR-PEP) database (Refseq-elease 11, June 2005) using BLASTX2 (Altschul et al. 1990) with a theshold value 1E-10. These analyses wee pefomed using Heidelbeg Unix Sequence Analysis Resouces at Deutsches Kebsfoschungszentum (DKFZ, Geman Cance Reseach Cente), Heidelbeg, Gemany ( dkfz-heidelbeg.de/). Compaison of SNP and SSR makes Single nucleotide polymophism genotyping data wee collected on the ye inbed lines in the pesent study. On the simila set of genotypes, we obtained additional genotyping data using a set of genomic SSRs (gssrs) and EST-deived SSRs (essrs) (Khlestkina et al. 2004, 2005). The details on these SSR makes have been povided in Supplementay Table 1). Fo compaing the potential of EST-deived SNP (esnp) makes of the pesent study with gssrs and essrs, the genotyping data obtained fo all thee types of makes wee coded into pesence/absence matices. Sepaate paiwise genetic similaity distance matices among enties wee assembled, based on esnp, gssr, and essr makes. Genetic similaity matices obtained fo each type of make wee compaed using the Mantel (1967) test. Convesion into cleaved amplified polymophic sequences Sequence alignments wee loaded in FASTA fomat into the SNP2CAPS tool ( de/snp2caps/; Thiel et al. 2004), which employs the REBASE database (vesion 304, Mach 24, 2003), containing the ecognition sequences of 235 non-isoschizomeic and commecially available estiction enzymes. Potentially infomative estiction enzymes wee validated in vito, following methods detailed elsewhee (Thiel et al. 2004). Linkage mapping Single nucleotide polymophisms wee mapped in at least one of the fou mapping populations. MAP- MAKER 2.0 softwae (Lande et al. 1987) was used to assign SNPs into the famewok map(s) at a LOD scoe of 3.0. cm distances wee calculated by applying the Kosambi map-unit function (Kosambi 1944). Results SNP discovey and fequency in ye All of the assays successfully amplified fom a template of baley cv. Bake DNA, but only one thid of the 48 pime pais geneated an adequate amplicon (a single, well-amplified poduct) in the expected size ange fom all the five ye templates. A futhe eight pime pais wee functional fo at least thee of the five templates. The ye and baley amplicons geneated fom these 24 pime pais wee sequenced. The emaining 24 pime pais amplified a scoable bp poduct fom, at best, only one of the ye templates. Sequence data of sufficient quality fo at least thee of the yes and the baley wee obtained fo 21 of the 24 amplicons. Sequence analysis fo SNP discovey was pefomed only fo the egion whee sequence data wee obtained fo at least thee of the five inbed lines. In all, alignments ove a mean of 397 bp pe make (ange bp) wee examined, epesenting in all 5.55 kb of the ye

4 1108 Theo Appl Genet (2007) 114: Table 1 Identification and analysis of SNPs Make Pime sequence (5 3 ) Sequence suveyed (bp) Numbe of genotypes examined Numbe of SNPs identified Numbe of indels obseved Haplotypes based on SNPs PIC (haplotypes) Aveage pi (p) GBS0131 F: AAGATACTCCACACCGACCG R: GGGTGGGGAACTTTGATCTC GBS0186 F: CAACTGCAGCTTATTCGGGAT R: ACCTTGGAGATTGGTCCCAC GBS0284 F: AAGATCGTGCATACGTCAACCA R: CATAAGTTATCGCCGTGGCAG GBS0360 F: CATGCCGAAGAACAAGGGTA R: GACTCCCTCGTTGAGGCG GBS0456 F: TCACTGCAATGCAGATCACG R: CGGGTACGAGGTGATCAAGAG GBS0461 F: CACCGTTGCTGACACTGGAT R: AATGCGGCTCTTTGTGGG GBS0524 F: TGCCAGTTTAGCATCAATTTGC R: TTTTACCCACGTGAGAAGCTTG GBS0526 F: AGACAGAATCCTCACAGGTGCC R: CCATGCCGAAGCAGATCC GBS0551 F: GTGCAGCCTTGCCTTCATAA R: CGTCGGATTCAACGTCTCCA GBS0554 F: ATGGAGCCCCTCCCAACTAC R: GTAGACGTCCAGCACCTCGAT GBS0577 F: GTGCTCAACAATGCCCCCTA R: CAGGTTCTTGGCTGCTTGTATC GBS0582 F: CTGGAGAAACCAGCCTATGGA R: CCAGGCAATGCTCATGAATG GBS0613 F: AGTGTTACATGCATCGCACCG R: GGCTTCATCGTCTACCCTTCG GBS0712 F: TACGAAACTCTTGCTCGGGC R: CGGGCATACTCAGGCAAAG Total 5, Aveage F fowad pime, R evese pime

5 Theo Appl Genet (2007) 114: geneated. Between two and five (mean 3.36) haplotypes pe amplicon wee identified, esulting in haplotype-based PIC values lying between 0.37 and 0.80 (mean 0.66) (Table 1). Ove 85% of the amplicons yielded a haplotype-pic of >0.50. In contast, the PIC values of individual SNPs fell in the ange (mean 0.32). Compaison of sequence divesity between ye and baley Fig. 1 Sequence alignment showing SNP discovey. Sequence alignment fo GBS0551 acoss five ye inbed lines (N2, N6, N7, P87, and P105) and baley cv. Bake. A numbe of SNPs vaying amongst the ye lines ae identifiable genome (Table 1). In summay, these esults suggested the utility of existing esouce of baley EST makes fo undetaking SNP discovey in ye. A total of 96 SNPs and 26 indels wee obseved in 14 of the 21 amplicons (Table 1; Fig. 1). The emaining seven amplicon-sequences wee completely monomophic acoss the five yes and the baley. The highest numbe of SNPs pe amplicon (29) was in GBS0551, followed by 12 in GBS0456, while indel fequency was highest (12) in GBS0131 and GBS0456. GBS0524 and GBS0712 yielded only one SNP in each, and eight of the amplicons lacked any indel. The oveall fequencies of SNPs and indels wee, espectively, 1 pe 58 bp and 1 pe 214 bp. p anged fom to , with a mean of Expected heteozygosity and haplotypes in ye Single nucleotide polymophism makes ae usually biallelic and so, thei PIC cannot exceed Howeve, by consideing haplotypes (the combination of SNPs within an amplicon), highe PIC values can be The set of makes analysed fo sequence divesity is a subset of the baley EST makes that wee analysed fo sequence divesity in baley (R. Kota et al., unpublished). Sceening of seven baley genotypes (Igi, Fanka, Steptoe, Moex, OWBDom, OWBRec, and Bake), the paental genotypes of fou mapping populations (i.e. Igi Fanka, Steptoe Moex, OWBDom OWBRec, and Bake Moex), with these 14 makes yielded a total of 76 SNPs which is 1.26 lesse as compaed to that was obseved in ye (Table 2). Although these makes did not show any indel in baley genotypes, a total of 26 indels wee obseved in ye genotypes. Numbe of haplotypes obseved in baley genotypes was a bit highe as compaed to that of ye. The PIC value of the haplotypes and sequence divesity index in ye genotypes fo the examined makes, howeve, was highe in ye as compaed to that of baley (Table 2). Convesion of SNPs into cleaved amplified polymophic sequence makes fo ye Many SNP detection and genotyping platfoms depend on expensive equipment and/o consumables, making SNP genotyping an expensive pocess. Of the 14 polymophic sequence alignments, 12 contained at least one potential cleaved amplified polymophic sequence (CAPS) candidate (Table 3). All these candidates wee validated by the appopiate digestion eactions (Fig. 2). Table 2 Compaative assessment of sequence divesity between ye and baley Featue Rye Baley Fold diffeence in ye as compaed to baley Genotypes analysed 5 7 Numbe of SNPs identified 96 (6.85) 76 (5.42) 1.26 highe Numbe of indels obseved 26 0 New featue obseved Numbe of haplotypes pe make 2 5 (3.36) 2 6 (3.5) 0.96 less PIC of haplotypes (0.66) (0.57) 1.16 highe Aveage nucleotide divesity (p) (0.0203) (0.0052) 3.90 highe Linkage goups epesented 6 (not 2R) 6 (not 6H) No change

6 1110 Theo Appl Genet (2007) 114: Table 3 Mapped SNP loci in ye: location, CAPS convesion, and putative function Rye linkage goups, make loci mapped Rye population used fo mapping Restiction enzyme fo CAPS assay Make name and linkage goups in baley Putative function (BLASTX desciption) Potein ID a E-value E-scoe 1R Xgbs0131-1R N6 N2 MseI GBS0131 (1H) MCB1 potein (Hodeum vulgae) emb CAC E Xgbs0554-1R N7 N6 HhaI GBS0554 (1H) Pathogenesis elated potein (H. vulgae) emb CAA E R Xgbs0186-3R N7 N2 HhaI GBS0186 (3H) Putative aspatate aminotansfease (Oyza sativa) dbj BAD E Xgbs0284-3R N7 N2 Cac8I GBS0284 (3H) Unknown potein (O. sativa) dbj BAD E R Xgbs0456-4R N7 N2 RsaI GBS0456 (4H) Glutamine synthetase isofom GSe1 (Titicum aestivum) gb AAR E Xgbs0551-4R N7 N2 ApoI GBS0551 (4H) RNA binding potein Rp120 (O. sativa) gb AAP E R Xgbs0577-5R N7 N2 EcoRV GBS0577 (5H) Hodoindoline-a (H. vulgae) gb AAV E Xgbs0613-5R P105 P87 NciI GBS0613 (5H) Putative cysteine conjugate beta-lyase (O. sativa) dbj BAD E Xgbs0712-5R P105 P87 DdeI GBS0712 (5H) NPH3 family potein (O. sativa) gb AAT E R Xgbs0526-6R N7 N2 TaqI GBS0526 (3H) Putative 60S ibosomal potein L38 (O. sativa) gb AAT E R Xgbs0461-7R N7 N2 NspI GBS0461 (4H) Ion-deficiency induced gene (H. vulgae) dbj BAB E Xgbs0360-7R N7 N2 EcoRV GBS0360 (7H) Eukayotic tanslation initiation facto 1A (O. sativa) emb CAD E a emb Euopean Molecula Biology Laboatoies (EMBL), gb Genbank, dbj DNA Databank of Japan Potein databases

7 Theo Appl Genet (2007) 114: essr (114 alleles) and 60 gssr (167 alleles) loci (Khlestkina et al. 2004, 2005; Supplementay Table 1). Analysis showed a boad equivalence with espect to genetic divesity between these diffeent data types (Table 4; Fig. 4). A high-coelation coefficient was obtained between both the genetic divesity indices obtained fom gssr and essr data ( = 0.992), essr and SNP data ( = 0.982), and gssr and SNP data ( = 0.972). Discussion Sequence divesity and SNPs in ye using baley makes Fig. 2 Development of CAPS assays. MseI and HhaI digests of two amplicons (uppe panel: GBS0131, lowe panel: GBS0186). The left side of each panel show undigested PCR poducts, and the ight side digested PCR poducts. M1 puc19 DNA/MspI, size standad; M2 1 kb ladde, size standad; 1 N2; 2 N6; 3 N7; 4 P87; 5 P105; 6 Bake; 7, 8 wate Integation of SNP makes into ye genetic maps The 12 CAPS assays wee applied to individual pogeny of the mapping populations, enabling the mapping of eight SNP loci in N7 N2, two in P105 P87, and one each in N6 N2 and N7 N6. All segegations wee in accodance with the 1:2:1 atio expected fo an F 2 population. The loci wee thus staightfowadly integated into the pe-existing genetic maps of Khlestkina et al. (2004, 2005), theeby adding 12 loci, spead ove all the ye chomosomes except fo 2R (Table 3; Fig. 3). The majoity of the loci mapped to the ye linkage goup coesponding to the one in which the sequence was located in baley. The exceptions wee GBS0526 (3H) and GBS0461 (4H), which wee assigned to, espectively, chomosomes 6R and 7R (Table 3; Fig. 3). Compaison of SNP with gssr and essr makes in ye The potential of SNPs to assess genetic divesity in ye was assessed by compaing the amplicon sequences obtained by 14 EST makes acoss the five inbed lines. This set of genotypic data (involving 96 SNPs) was used to descibe the genetic elationships between the inbed lines (Fig. 4). The esulting dendogam suggests that N2 is moe divese than the othe lines, while P87 and P105 have a level of similaity of geate than 50%. A compaison was then made between the SNP genetic similaity matix and those deived fom We have illustated how esnp makes in baley can be used to discove SNP vaiation in ye, and that these assays can be used to analyse sequence divesity in the ye genome. The possibility of tansfeing pe-existing baley makes to ye saves substantial time and effot, othewise needed fo the de novo design and synthesis of SNP pime pais. Integeneic tansfe of DNA makes cannot always be elied upon, although the use of heteologous cdna pobes fo RFLP analysis in the ceeals has woked vey well (Devos et al. 1992, 1993; Devos and Gale 1993; Nelson et al. 1995). Some success has also been achieved in tansfeing SSR makes fom wheat and baley to ye (Khlestkina et al. 2004, 2005), especially to those based on genic, as opposed to anonymous genomic sequence (Gupta et al. 2003; Thiel et al. 2003; Vashney et al. 2005). This highe level of tansfeability no doubt eflects the bette consevation ove speciation of coding, as opposed to non-coding sequence (Vashney et al. 2005). Polymophism in allogamous species is geneally highe than in autogamous ones (Rafalski 2002), and thus, as expected, SNP fequency in ye was highe than in baley (anging between 1/78 and 1/189 bp; Kanazin et al. 2002; Bundock et al. 2003; Russell et al. 2004; R. Kota et al., unpublished), wheat (1/540 bp, Somes et al. 2003), soghum (1/ bp, Hamblin et al. 2004), sugabeet (1/130 bp, Schneide et al. 2001), and soybean (1/278 bp, Van et al. 2004), but compaable to its fequency in maize (1/61 bp, Ching et al Likewise, the mean p in ye is highe than that in baley ( ), wheat ( , Somes et al. 2003), soghum ( , Hamblin et al. 2004), soybean ( , Zhu et al. 2003; , Van et al. 2004), and sugabeet ( , Schneide et al. 2001). Supisingly, it was also two- to theefolds highe than that in maize ( , Tenaillon et al. 2001; , Ching et al. 2002). We believe,

8 1112 Theo Appl Genet (2007) 114: Fig. 3 Integation of SNP loci into the ye genetic map. SNP makes (undelined) integated into ye micosatellite linkage map (Khlestkina et al. 2004) based on segegation data fom pogeny of cosses a P87 P105, b N6 N2, c N7 N2, and d N7 N6. The tentative position of centomees is indicated based on data of Devos et al. (1993) and Kozun et al. (2001). Shot ams of chomosomes ae at the top, and the long ams at the bottom (b) (d) (c) (c) C Xgwm1223- Xa i g9 Xems1303- Xbcd Xgwm752- Xps6 Xps3 Xgbs Xa i g9 Xbcd Xps6 Xps5 Xems1280- Xps Xps11 Xps89 Xps9 Xgbs0186- Xgbs Xps9 Xa i g18 Xmwg203 Xgbs0551- Xgbs0456- Xa i g1 Xgwm1091- Xgwm941- Xgwm676- Xps6 Xgwm R Xa i g18 Xps3 Xmwg9 Xwg R Xa i g18 Xps3 Xmwg9 Xwg2 Xgbs R Xwg11 Xmwg9 Xps68 Xmwg R Xscb Xgwm720- Xm c wg65 Xmwg205 Xps89 (a) C R Xhvsu Xmwg5 Xmwg22 Xems1167- Xgbs0613- Xgwm601- Xps9 Xps3 Xgwm996- Xgwm1011- Xgwm335- Xgwm1266- Xgwm1122- Xps12 Xgbs0712- ems1266- Xems1186- Xwg6 Xems7- Xscb Xgwm212- Xps3 Xwg1 Xgwm179- Xbcd13 (c) (c) (c) R Xgbs0577- Xgwm205- Xmwg5 Xmwg203 Xgwm1284- Xps3 Xps10 Xgwm1205- Xwg10 Xmwg216 Xgwm271- Xgwm212- Xwg6 Xgwm131- Xgwm1226- Xscb Xwg1 Xgwm R Xps Xwg Xgwm959- Xps9 Xgwm1103- Xgwm732- Xgbs0526- Xgwm751- Xps12 Xps Xps5 Xa i g Xgwm R Xps5 Xps1 Xpsb Xgbs0461- Xgbs0360- Xps1 Xa i g1

9 Theo Appl Genet (2007) 114: Highe sequence divesity in ye as compaed to baley Fig. 4 Genetic elationships among five inbed lines defined by 96 SNPs obtained by using 14 EST makes Table 4 Genetic divesity indices among ye genotypes based on SNP, essr and gssr make data Make type P87 P105 N2 N6 N7 Genotype SNP essr P87 gssr SNP essr P105 gssr SNP essr N2 gssr SNP essr N6 gssr SNP essr N7 gssr Allelic divesity data obtained fo 96 SNPs with 14 SNP makes, 114 alleles with 39 essrs and 167 alleles with 60 gssrs wee used fo compaison by using Jaccad s similaity coefficient howeve, that this esult eflects the non-andom choice applied fo the amplicons to sceen, whee a delibeate attempt was made to select makes with both high PIC and high p. On the basis of allelic fequencies, the SNPs identified had a mean PIC of In contast, the gssr and essr makes acoss the same gemplasm sample had a mean PIC of, espectively, 0.55 and Howeve, when PIC was calculated on the basis of haplotype instead of on individual SNPs, its value was moe than doubled. Seveal studies (e.g. Johnson et al. 2001) have suggested that haplotype analysis is supeio to SNP analysis fo tait association o diagnostic studies. Oveall, the infomation content of SNP haplotypes is compaable o even highe than that of the SSR makes. As mentioned ealie, occuence of indels, the highe numbe of SNPs (1.26 ), highe sequence divesity (3.9 ), and highe PIC value of haplotypes (1.16 ) obtained in ye as compaed to baley with the same set of the makes can be attibuted to the allogamous natue of ye while the baley is an autogamous species (Rafalski 2002). A slightly highe numbe of haplotypes wee obseved in baley as compaed to ye. This could be possible as a highe numbe of baley genotypes (seven) than ye (five) wee analysed with these makes. In bief, these analyses clealy undeline the value of existing esouce of baley makes fo undetaking SNP discovey and make development studies in ye. Development of functional SNP makes fo ye The pesent study epesents the beginning of SNP discovey and development in ye. A majo baie fo SNP discovey in ye to date has been the paucity of EST sequence and the poo level of genotype epesentation among these ESTs. This has militated against a database mining stategy fo SNP discovey. We have shown that heteologous EST sequence can substitute fo the lack of ye sequence. Following this discovey, the next challenge in SNP development is in the design of genotyping assays. Numeous competing platfoms ae being pomoted fo this pupose, but some ae associated with high costs fo specialized equipment and/o eagents. The convesion of SNPs to CAPS makes povides an oppotunity fo applications in laboatoies equipped with only basic infastuctual facilities. Convesion was achieved hee fo 12 makes, allowing them to be deployed using simple PCR eactions, estiction digestion, and agaose gel electophoesis in a vey cost- and time-effective manne. Ou aim was to demonstate a oute to the development of low cost SNP assays in ye, which would open the way to a substantial enichment of the ye genetic map. This is paticulaly elevant fo ye, fo which, at pesent, the genetic maps in the public domain involve RFLP, AFLP, RAPD, and SSR loci (Devos et al. 1993; Philipp et al. 1994; Senft and Wicke 1996; Kozun et al. 2001; Bednaek et al. 2003; Khlestkina et al. 2004, 2005). None of these maps have a significant make density (Vashney et al. 2004). Of the 12 mapped SNP loci, 10 wee located to thei expected chomosome, based on thei location in baley. Howeve, the emaining two (GBS0526 and GBS0461, on baley 3H and 4H) mapped to appaently

10 1114 Theo Appl Genet (2007) 114: non-homoeologous locations in ye (6R and 7R, espectively). These two ye chomosomes have evolved, via multiple tanslocations, to become substantially diffeentiated fom othe Titiceae species (Devos et al. 1993; Devos and Gale 1993), and these eaangements ae consistent with the appaently non-homoeologous locations of these two makes (Table 3). As the souce sequence fo the EST-SNP makes is genic, putative function can often be assigned using standad homology seaches within non-edundant potein databases. Except fo one make (Xgbs0284-3R), all sequences showed a level of homology with identified poteins (Table 3). A known function can give added value to a make, since the possibility exists that SNPs can then be diectly associated with vaiants fo a specific function (Holton et al. 2002; Gao et al. 2004). Thus, GBS0554 (1R) and GBS0461 (7R) may be associated with quantitative vaiation fo biotic and abiotic stess toleance, as thei sequences belong to a gene encoding a pathogenesis-elated potein (GBS0554), o an ion-deficiency-induced potein (GBS0461). Wee such an association to be confimed though a genetic analysis, such makes would become useful both fo make-assisted selection and fo allele mining in gemplasm collections. Such a stategy equies a lage epetoie of mapped genes (Andesen and Lübbestedt 2003). Genetic divesity and compaison of SNP makes with gssrs and essrs in ye The elationships among the five inbed lines suggest that N2 is genetically distant fom the othe fou inbed lines, while P87 and P105 ae closely elated to one anothe. This is consistent with known pedigee and povenance (Kozun et al. 2001; Malyshev et al. 2003; Tikhenko et al. 2005). P87 and P105 wee developed togethe at the Institute of Genetics and Cytology, Minsk, Belaus, both having been selected fom the pogeny of a single coss. N6 and N7 oiginate fom, espectively, Sweden and Russia, while N2 is thought to have been developed in Nothen/Easten Euope (N. D. Tikhenko, pesonal communication). The SNP divesity is consistent with that deived fom analysis of gssrs and essrs. Impotantly, even though only a small numbe of SNPs wee analysed, highly significant coelations wee obtained between the SNP make data set and that of the gssr ( = 0.972) and essr ( = 0.982) sets. The even highe coelation ( = 0.992) between the gssr and essr data sets pobably eflects the lage numbe of alleles samples. Since both essr and SNP makes ae souced fom the tansciptome, it is not supising that the coelation between them is so high. In conclusion, we have shown that extant baley sequence can be used fo SNP discovey in ye and that most of these SNPs can be conveted into economical CAPS assays. We have used these new makes to add 12 functional loci to the ye map, and showed that these loci ae syntenic between ye and baley. The development of CAPS assay should allow SNP makes to be deployed in situations whee sophisticated infastuctue is lacking. The availability of a lage numbe of ESTs in baley and wheat can facilitate the development of SNP makes, useful fo both ye genetics and beeding. Acknowledgment The authos thank D. Nils Stein, IPK, fo his constuctive suggestions duing the couse of study. Refeences Altschul SF, Gish W, Mille W, Myes EW, Lipman DJ (1990) Basic local alignment seach tool. J Mol Biol 215: Andesen JR, Lübbestedt T (2003) Functional makes in plants. Tends Plant Sci 8: Bednaek PT, Masojc P, Lewandowska R, Myskow B (2003) Satuating ye genetic map with amplified fagment length polymophism (AFLP) and andom amplified polymophic DNA (RAPD) makes. J Appl Genet 44:21 33 Bundock PC, Chistophe JT, Eggle P, Ablett G, Heny RJ, Holton TA (2003) Single nucleotide polymophisms in cytochome P450 genes fom baley. Theo Appl Genet 106: Chikmawati T, Ma XF, Ross K, Miftahudin, Gustafson JP (2006) Rye. In: Kole C (ed) The genomes: a seies on genome mapping, molecula beeding in plants: ceeals and millets, vol 1. Spinge, Gemany, pp Ching A, Caldwell KS, Jung M, Dolan M, Smith OS, Tingey S, Mogante M, Rafalski AJ (2002) SNP fequency, haplotype stuctue and linkage disequilibium in elite maize inbed lines. BMC Genet 3:19 Cho RJ, Mindinos M, Richads DR, Sapolsky RJ, Andeson M, et al (1999) Genome-wide mapping with biallelic makes in Aabidopsis thaliana. Nat Genet 23: Devos KM, Gale MD (1993) Extended genetic maps of the homoeologous goup-3 chomosomes of wheat, ye and baley. Theo Appl Genet 85: Devos KM, Atkinson MD, Chinoy CN, Liu CJ, Gale MD (1992) RFLP-based genetic map of the homoeologous goup 3 chomosomes of wheat and ye. Theo Appl Genet 83: Devos KM, Atkinson MD, Chinoy CN, Fancis HA, Hacout RL, Koebne RMD, Liu CJ, Masojc P, Xie DX, Gale MD (1993) Chomosomal eaangements in the ye genome elative to that of wheat. Theo Appl Genet 85: Ewing B, Hillie L, Wendl MC, Geen P (1998) Base-calling of automated sequence taces using phed. I. Accuacy assessment. Genome Res 8: Feltus FA, Wan J, Schulze SR, Estill JC, Jiang N, Pateson AH (2004) An SNP esouce fo ice genetics and beeding based on subspecies indica and japonica genome alignments. Genome Res 14:

11 Theo Appl Genet (2007) 114: Gao LF, Jing RL, Hu NX, Li XP, Zhou RH, Chang XP, Tang JF, Ma Zy, Jia JZ (2004) One hunded and one new micosatellite loci deived fom ESTs (EST-SSRs) in bead wheat. Theo Appl Genet 108: Gibskov M, Deveeux J, Bugess RR (1984) The codon pefeence plot: gaphic analysis of potein coding sequences and pediction of gene expession. Nucleic Acids Res 12: Gupta PK, Rustgi S, Shama S, Singh R, Kuma N, Balyan HS (2003) Tansfeable EST-SSR makes fo the study of polymophism and genetic divesity in bead wheat. Mol Genet Genomics 270: Gupta PK, Vashney RK (2000) The development and use of micosatellite makes fo genetic analysis and plant beeding with emphasis on bead wheat. Euphytica 113: Hackauf B, Wehling P (2002) Identification of micosatellite polymophisms in an expessed potion of the ye genome. Plant Beed 121:17 25 Hamblin MT, Mitchell SE, White GM, Gallego J, Kukatla R, Wing RA, Pateson AH, Kesovich S (2004) Compaative population genetics of the panicoid gasses: sequence polymophism, linkage disequilibium and selection in a divese sample of Soghum bicolo. Genetics 167: Hatl DL, Clak AG (1997) Pinciples of population genetics. Sinaue Associates, Sundeland Holton TA, Chistophe JT, McClue L, Hake N, Heny RJ (2002) Identification and mapping of polymophic SSR makes fom expessed gene sequences of baley and wheat. Mol Beed 9:63 71 Johnson GC, Esposito L, Baatt BJ, Smith AN, Hewad J, Di Genova G, Ueda H, Codell HJ, Eaves IA, Dudbidge F, Twells RC, Payne F, Hughes W, Nutland S, Stevens H, Ca P, Tuomilehto-Wolf E, Tuomilehto J, Gough SC, Clayton DG, Todd JA (2001) Haplotype tagging fo the identification of common disease genes. Nat Genet 29: Kanazin V, Talbet H, See D, Decamp P, Nevo E, Blake T (2002) Discovey and assay of single nucleotide polymophism in baley (Hodeum vulgae). Plant Mol Biol 48: Khlestkina EK, Than MH, Pestsova EG, Rode MS, Malyshev SV, Kozun V, Böne A (2004) Mapping of 99 new micosatellite-deived loci in ye (Secale ceeale L.) including 39 expessed sequence tags. Theo Appl Genet 109: Khlestkina EK, Than MH, Pestsova EG, Rode MS, Malyshev SV, Kozun V, Böne A (2005) Mapping of 99 new micosatellite-deived loci in ye (Secale ceeale L.) including 39 expessed sequence tags. Eatum. Theo Appl Genet 110: Kozun V, Malyshev S, Voylokov AV, Böne A (2001) A genetic map of ye (Secale ceeale L.) combining RFLP, isozyme, potein, micosatellite and gene loci. Theo Appl Genet 102: Kosambi DD (1944) The estimation of map distances fom ecombination values. Ann Eugen 12: Kota R, Vashney RK, Thiel T, Dehme K-J, Gane A (2001) Geneation and compaison of EST-deived SSR and SNP makes in baley (Hodeum vulgae L.). Heeditas 135: Kota R, Rudd S, Facius A, Kolesov G, Thiel T, Zhang H, Stein N, Maye K, Gane A (2003) Snipping polymophisms fom lage EST collections in baley (Hodeum vulgae L.). Mol Genet Genomics 270:24 33 Lande ES, Geen P, Abahamson J, Balow A, Daly MJ, Lincoln SE, Newbug L (1987) MAPMAKER: an inteactive compute package fo constucting pimay genetic linkage maps of expeimental and natual populations. Genomics 1: Madej LJ (1996) Woldwide tends in ye gowing and beeding. Vot Pflanzenzüecht 35:1 6 Malyshev SV, Katel NA, Voylokov AV, Kozun V, Böne A (2003) Compaative analysis of QTLs affecting agonomical taits in ye and wheat. EWAC Newsl 12: Mantel N (1967) The detection of disease clusteing and a genealized egession appoach. Cance Res 27: Möhing S, Salamini F, Schneide K (2004) Multiplexed, linkage goup specific make sets fo apid genetic mapping and fingepinting of suga beet (Beta vulgais L.). Mol Beed 14: Nasu S, Suzuki J, Ohta R, Hasegawa K, Yui R, Kitazawa N, Monna L, Minobe Y (2002) Seach fo and analysis of single nucleotide polymophisms (SNPs) in ice (Oyza sativa, Oyza ufipogon) and establishment of SNP makes. DNA Res 9: Nei M (1987) Molecula evolutionay genetics. Columbia Univesity Pess, New Yok Nei M, Li WH (1979) Mathematical model fo studying genetic vaiation in tems of estiction endonucleases. Poc Natl Acad Sci USA 76: Nelson JC, Soells ME, Van Deynze AE, Lu YH, Atkinson M, Benad M, Leoy P, Fais JD, Andeson JA (1995) Molecula mapping of wheat: majo genes and eaangements in homoeologous goups 4, 5, and 7. Genetics 141: Philipp U, Wehling P, Wicke G (1994) A linkage map of ye. Theo Appl Genet 88: Polakova K, Lauie DA, Vaculova K, Ovesna J (2003) Chaacteization of beta-amylase alleles in 79 baley vaieties with pyosequencing. Plant Mol Biol Rep 21: Rafalski JA (2002) Application of single nucleotide polymophisms in cop genetics. Cu Opin Plant Biol 5: Röde MS, Huang X-Q, Ganal MW (2004) Wheat micosatellites: potential and implications. In: Löz H, Wenzel G (eds) Biotechnology in agicultue and foesty, molecula make systems, vol 55. Spinge, Heidelbeg, pp Röde MS, Kozun V, Wendehake K, Plaschke J, Tixie M, Leoy P, Ganal MW (1998) A micosatellite map of wheat. Genetics 149: Rostoks N, Mudie S, Cadle L, Russell J, Ramsay L, Booth A, Svensson JT, Wanamake SI, Walia H, Rodiguez EM, Hedley PE, Liu H, Mois J, Close TJ, Mashall DF, Waugh R (2005) Genome-wide SNP discovey and linkage analysis in baley based on genes esponsive to abiotic stess. Mol Genet Genomics 274: Russell J, Booth A, Fulle J, Haowe B, Hedley P, Machay G, Powell W (2004) A compaison of sequence-based polymophism and haplotype content in tanscibed and anonymous egions of the baley genome. Genome 47: Saal B, Wicke G (1999) Development of simple sequence epeat makes in ye (Secale ceeale L.). Genome 42: Schneide K, Weisshaa B, Bochadt DC, Salamini F (2001) SNP fequency and allelic haplotype of Beta vulgais expessed genes. Mol Beed 8:63 74 Senft P, Wicke G (1996) An extended genetic map of ye (Secale ceeale L.). Plant Beed 115: Somes DJ, Kikpatick R, Moniwa M, Walsh A (2003) Mining single-nucleotide polymophisms fom hexaploid wheat ESTs. Genome 46: Tenaillon MI, Sawkins MC, Long AD, Gaut B, Doebley JF, Bandon S (2001) Pattens of DNA sequence polymophism

12 1116 Theo Appl Genet (2007) 114: along chomosome 1 of maize (Zea mays ssp. Mays L.) Poc Natl Acad Sci USA 98: Thiel T, Michalek W, Vashney RK, Gane A (2003) Exploiting EST databases fo the development of cdna deived micosatellite makes in baley (Hodeum vulgae L.). Theo Appl Genet 106: Thiel T, Kota R, Gosse I, Stein N, Gane A (2004) SNP2CAPS: a SNP and INDEL analysis tool fo CAPS make development. Nucleic Acids Res 32(1): e5 Thompson JD, Higgins DG, Gibson TJ (1994) Clustal-W impoving the sensitivity of pogessive multiple sequence alignment though sequence weighting, position-specific gap penalties and weight matix choice. Nucleic Acids Res 22: Tikhenko ND, Tsvetkova NV, Voylokov AV (2005) Genetic contol of embyo lethality in cosses between common wheat and ye. Russ J Genet 41: Van K, Hwang E-Y, Young Kim M, Kim Y-H, Cho Y-I, Cegan PB, Lee S-H (2004) Discovey of single nucleotide polymophisms in soybean using pimes designed fom ESTs. Euphytica 139: Vashney RK, Kozun V, Böne A (2004) Molecula make maps in ceeals: methodology and pogess. In: Gupta PK, Vashney RK (eds) Ceeal genomics. Kluwe Academic Publishes, The Nethelands, pp Vashney RK, Sigmund R, Böne A, Kozun V, Stein N, Soells M, Langidge P, Gane A (2005) Intespecific tansfeability and compaative mapping of baley EST-SSR makes in wheat, ye and ice. Plant Sci 168: Zhu YL, Song QJ, Hyten DL, van Tassell C, Matukumalli LK, Gimm DR, Hyatt SM, Fickus EW, Young ND, Cegan PB (2003) Single-nucleotide polymophisms in soybean. Genetics 163:1 1134