Supplemental Information. Macrophages Mediate the Repair of Brain. Vascular Rupture through Direct Physical Adhesion. and Mechanical Traction

Transcription

1 Immunity, Volume 44 Supplemental Information Macrophages Mediate the Repair of Brain Vascular Rupture through Direct Physical Adhesion and Mechanical Traction Chi Liu, Chuan Wu, Qifen Yang, Jing Gao, Li Li, Deqin Yang, and Lingfei Luo

2 Figure S1

3 Figure S1, related to Figure 2. Repair of cerebrovascular ruptures can be mediated by peripheral macrophages. (A and B) Combination of fluorescent in situ hybridizations (FISH) and immunohistochemistry indicates that the majority of cerebrovascular ruptures are repaired by Lcp1 and p2y12 double positive macrophages (A, n=56/58). However, in rare cases, ruptures can be repaired by p2y12-negative macrophages (B, n=2/58). (C and D) The majority of cerebrovascular ruptures are repaired by Lcp1 and slc7a7 double positive macrophages (C, n=44/45). However, in rare cases, ruptures can be repaired by slc7a7-negative macrophages (D, n=1/45). (E H) In contrast to the un-injected control (E and G), brain-resident microglia can be efficiently depleted by the injection of slc7a7mo as indicated by the mpeg1:gfp transgene (F, n=33/40) and FISH-p2y12 (H, n=28/36). (I and J) In slc7a7 morphants, a small portion of cerebrovascular ruptures can be repaired by macrophages (I, n=17/81). All these repairing macrophages are negative for p2y12 (J, n=17/17). (I) and (J) exhibit the same macrophage. The time elapsed since the laser ablation is indicated in hours:minutes. Scale bar, 10 μm.

4 Figure S2 Figure S2, related to Figure 3. Macrophages in the brain express Cdh5 and other adhesion molecules. (A and B) Under the Tg(cdh5:gal4; UAS:GFP) transgenic background, strong and weak GFP epifluorescences were detected in brain vascular ECs and macrophages, respectively (A, n=25/25). Expression of GFP in the macrophages was confirmed by antibodies against Lcp1 and GFP (B, n=20/20). Arrowheads indicate macrophages. Scale bar, 10 μm. (C) RT-PCRs indicated that the sorted brain macrophages expressed cdh5, pecam1, icam1, and vcam1, but not kdrl or zo1.

5 Figure S3 Figure S3, related to Figure 5. Sorting of the working macrophages and endothelial end cells. (A and B) The Kaede-labeled working macrophage was photoconverted from green to red epifluorescence (A). About eighty macrophages were photoconverted and proceeded to sorting, and about twenty of them were finally confirmed and collected (B, R6) for further transcriptional profile analysis. (C and D) The Dendra2-labeled endothelial end cells were photoconverted from green to

6 red epifluorescence (C). About eighty cells were photoconverted and proceeded to sorting, and about twenty of them were finally confirmed and collected (D, R6) for further transcriptional profile analysis. The purple circles indicate irradiation points by the 405-nm laser for photoconversion.

7 Figure S4

8 Figure S4, related to Figure 5. Statistics of pathway enrichment in the working macrophages and endothelial end cells. Transcriptional profile analyses of the working macrophages (A) and of the endothelial end cells (B) at three different lesion stages indicate statistics of pathway enrichment. Rich-ratio represents the ratio of significantly different expression genes in a pathway / the ratio of significantly different expression genes in all pathways. The size of the color dot indicates the number of significantly different expression genes in a pathway. The darkness of the color dot indicates the p-val.

9 Figure S5 Figure S5, related to Figure 5. KEGG pathway map of the cell adhesion and mechanical force regulatory genes. Schematic based on KEGG pathway map displays comparison of cell adhesion and

10 mechanical force regulatory genes between three different lesion stages, macrophage arrival vs uninjured controls (A), macrophage traction vs macrophage arrival (B), and macrophage traction vs uninjured controls (C), in both macrophages and endothelial end cells. Red and green boxes represent up-regulated and down-regulated genes, respectively.

11 Figure S6 Figure S6, related to Figure 1. Macrophages mediate the repair of fin vascular ruptures. Dynamic cellular events that occur in the repair of fin vascular rupture. Note that the macrophage also extends filopodia or lamellipodia, physically adheres to both endothelial ends and mediates their ligation (n=10/20). Note that the neutrophils that are fluorescently labeled in yellow arrive at and leave the lesion earlier than macrophages, but never physically adhere to the endothelial ends (n=20/20). Scale bar, 10 μm.

12 Supplemental Experimental Procedures Zebrafish Strains and Generation of Transgenic Lines Zebrafish of the Tg(kdrl:Dendra2-NTR) cq10 abbreviated as Tg(kdrl:DenNTR) cq10, Tg(kdrl:Lifeact-DsRed) cq11, Tg(coronin1a:Lifeact-DsRed) cq12 abbreviated as Tg(coro1a:Lifeact-DsRed) cq12, Tg(kdrl:eb3-GFP) cq13, Tg(kdrl:Rac1-FRET) cq17 (Chen et al., 2012), Tg(coronin1a:Rac1-FRET) cq18 abbreviated as Tg(coro1a:Rac1-FRET) cq18 (Li et al., 2012b), Tg(coro1a:GFP; lysc:dsred) (Li et al., 2012a), Tg(kdrl:GFP; gata1:dsred), Tg(kdrl:DsRed), Tg(kdrl:GcaMP5) cq19, Tg(coronin1a:hCRIB-RasCT) cq20 abbreviated as Tg(coro1a:hCRIB-RasCT) cq20, Tg(kdrl:hCRIB-RasCT) cq21, Tg(coronin1a:Kaede) cq22 abbreviated as Tg(coro1a:Kaede) cq22, Tg(kdrl:pecam1-GFP) cq23, Tg(cdh5 BAC :gal4ff) mu101 abbreviated as Tg(cdh5:gal4) (Bussmann et al., 2011), Tg(UAS:GFP) nkuasgfp1a (Bussmann et al., 2011), and Tg(mpeg1:GFP) (Ellett et al., 2011) lines were raised and maintained under standard laboratory conditions according to Institutional Animal Care and Use Committee protocols. kdrl-denntr construct was generated by replacing the lfabp promoter with the kdrl promoter in the pbluescript vector. Lifeact-DsRed was generated by the direct addition of the Lifeact DNA sequence before DsRed with the following primers: 5'-TCCCCCGGGATGGGTGTCGCAGATTTGATCAAGAAATTCGAAAGCATCTCAAAG GAAGAAATGGCCTCCTCCGAGAACGT-3' and 5'-CACCTGTTCCTGTAATCGATA-3'.

13 kdrl-lifeact-dsred and coro1a-lifeact-dsred were generate by inserting Lifeact-DsRed downstream of the kdrl promoter or the coronin1a promoter. eb3 was amplified from human cdna using the primers 5'-GTCGACATGGCCGTCAATGTGTACTC-3' and 5'-GGATCCCGTACTCGTCCTGGTCTTCTTG-3' and then cloned into the pegfp-n2 plasmid. The eb3-gfp sequence was then excised and subcloned downstream of the kdrl promoter to generate the kdrl-eb3-gfp construct. pecam1 was amplified from zebrafish cdna, and the same subcloning procedure that was used for eb3 was applied to generate the kdrl-pecam1-gfp construct. kdrl-gcamp5 and kdrl-hcrib-rasct were constructed by subcloning GcaMP5 and hcrib-rasct, respectively, downstream of the kdrl promoter. The constructs were injected into zebrafish embryos of the AB genetic background at the one-cell stage for transgenesis. Laser Microsurgical Cell Ablation, Photoconversion, In Vivo Time-lapse and FRET Imaging For laser microsurgical cell ablation, the larvae were mounted in 1.2% low melting point agarose and viewed using a LSM780NLO confocal microscope (Carl Zeiss). The target cerebrovascular endothelial cell or macrophage was focused in a single confocal plane and irradiated for three seconds by a multi-photon laser at 800 nm, which was generated using a Chameleon Vision2 Laser System (Coherent). Effective ablations were identified by cellular debris. Whole larvae photoconversion was performed by exposing the larvae to UV light for

14 4 minutes using a M165FC Stereo Microscope (Leica). Most of the Dendra2 epifluorescence was converted from green to red. Focused photoconversion of the endothelial ends was achieved by irradiation with a 405-nm laser equipped on an LSM780NLO confocal microscope for 30 seconds. For time-lapse live imaging, zebrafish embryos were grown in the presence of 0.003% 1-phenyl-2-thiourea (PTU) to avoid pigmentation. Larvae were mounted in 1.2% low melting point agarose in 35-mm glass bottom dishes. Time-lapse images were captured using a 20 water immersion objective mounted on an LSM780NLO confocal microscope that was equipped with a heating stage to maintain 28.5 C. Z-stack images were collected every 3 10 minutes, and three-dimensional data sets were compiled using ZEN2010 software (Carl Zeiss). To measure Rac1 activity, FRET ratio images were acquired using a Zeiss LSM780 confocal microscope, as previously described (Kardash et al., 2010; Kardash et al., 2011; Li et al., 2012b). RNA Sequencing Focused photoconversions of endothelial end cells or macrophages at three lesion stages (uninjured control, macrophage arrival, and macrophage traction) were achieved by irradiating Tg(kdrl:DenNTR; coro1a:egfp) or Tg(coro1a:Kaeda; kdrl:egfp) transgenic larvae with a 405-nm laser equipped on an LSM780NLO confocal microscope for 30 seconds. About eighty cells (repairing macrophages or endothelial end cells) in

15 twenty animals were photoconverted. After photoconversion, zebrafish heads were dissected, collected, and homogenized in 1 ml 0.5% trypsin at 4 C. The homogenized cell suspension was centrifuged at 1000x g at 4 C for 5 minutes. Then, the supernatant was removed and the cell pellet was resuspended in PBS, followed by cell sorting by flow cytometry (Moflo XDP, Beckman). cdna libraries were generated from these sorted cells using the Smart-seq2 protocol (Picelli et al., 2013). Then, RNA sequencing was performed using the PE100 strategy (HiSeq 2500, Illumina). Raw data were filtered to obtain clean data using Perl scripts. Reference genome and annotations were downloaded from the ENSEMBL website ( Reference genome library was built using the Bowtie2 v2.2.3 software, and clean data was aligned to the library using the TopHat v software. Gene expressions were calculated by the RPKM method using the HTSeq v0.6.0 software. Genes with P value<0.05 and log2 ratio 1 were identified as differentially expressed genes using the DESeq (v1.16.0) software. These data were then subject to GO (gene ontology, analyses and aligned to KEGG (Kyoto Encyclopedia of Genes and Genomes, database to build pathway maps. Immunohistochemistry and Fluorescent In Situ Hybridizations Whole-mount antibody staining was performed as previously described (Liu et al., 2009). To detect the expression of Cdh5, the larvae were fixed 2.5 hours and 4 hours after laser

16 ablation. Anti-zfCdh5 antibodies (Blum et al.,2008) (1:400, a gift from Markus Affolter) and anti-lcp1 antibodies(li et al., 2011) (1:400) were visualized using donkey-anti-rabbit AlexaFluor 647 (Invitrogen). Anti-GFP antibodies (1:400, Santa Cruz) were visualized using goat-anti-mouse AlexaFluor 488 (Invitrogen). Combination of fluorescent in situ hybridizations and immunohistochemistry was carried out as previously described (He et al., 2014) using anti-lcp1 antibodies (1:400) and p2y12 and slc7a7 antisense RNA probes. Cell Sorting, RNA Isolation, and RT-PCR The heads of five hundred Tg(mpeg1:GFP) transgenic larvae were dissected at 84 hpf, and their cells were dissociated and sorted as previously described (Lu et al., 2013). Total RNA was isolated from sorted macrophages using TRIzol reagent (Invitrogen), and cdna was obtained via reverse transcription using OmniScript RT Kits (Qiagen). PCR was then performed to detect the transcriptions of cdh5, pecam1, icam1, vcam1, kdrl, and zo1. Primer sequences are available on request.

17 Supplemental References Blum, Y., Belting, H.G., Ellertsdottir, E., Herwig, L., Lüders, F., and Affolter, M. (2008). Complex cell rearrangements during intersegmental vessel sprouting and vessel fusion in the zebrafish embryo. Dev. Biol. 316, Picelli, S., Bjorklund, A.K., Faridani, O.R., Sagasser, S., Winberg, G., and Sandberg, R. (2013). Smart-seq2 for sensitive full-length transcriptome profiling in single cells. Nat. Methods 10,