Supporting Information

Transcription

1 Supporting Information Liu et al /pnas SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from Invivogene. Rabbit anti-p65 and rabbit anti-stat1 antibodies were from Santa Cruz. Protein G agarose beads were from Pierce. Mice. C57BL/6 mice were purchased from NCI-Frederick. TRIF / mice were purchased from Jackson Labs. MyD88 / mice were previously described in (24). Age and sex matched mice were used. All animal protocols were approved by the UAB Institutional Animal Care and Use Committee (IACUC). Cell Culture. The human embryonic kidney cell line HEK-293, mouse macrophage cell line RAW and human monocytic cell line THP-1 were purchased from the American Type Culture Collection (ATCC). Mouse peritoneal macrophages were elicited by i.p. injection of 1.5 ml of 4% thioglycolate solution for 4 days. Alveolar macrophages were obtained by bronchoalveolar lavage with PBS containing 5 mm EDTA. The cells were cultured in DMEM plus 10% FBS at 37 C and 5% CO 2. Intratracheal Instillation of LPS. C57BL/6 mice were intratracheally injected with 1 mg/kg LPS in 50 L PBS. At 0, 4, 24, 48, or 72 h after injection, the mice (n 5) were killed and the lungs collected and homogenized in TRIzol solution to purify total RNA. Equal amounts of RNA from each mouse at each time point were pooled for analysis. Plasmids. To generate a construct that expresses mouse mature mir-147 under the control of tetracycline, the mouse full-length NMES1 cdna was amplified from mouse cdna using the following primers: sense 5 GGT ACC CCTTTCTGAAAAGT- TCTGTGGAGCG 3 and antisense 5 CTC GAG GTTTATA- CATTTCAAGGAAAATATCCAAGC 3. The PCR product was cloned into pcdna4 between KpnI and XhoI sites. The resulting construct was termed pcdna4-mir-147. To generate a construct that can express mature murine mir-147 sequence, two complementary DNA oligos were synthesized and annealed. The sequences for the oligos were sense 5 GATC CCC TAG- CAGAAGCATTTCCGCACAC TTCAAGAGA GTGTGCG- GAAATGCTTCTGCTA TTTTTGGAAA 3 and antisense 5 AGCT TTTCCAAAAA TAGCAGAAGCATTTCCGCACAC TCTCTTGAA GTGTGCGGAAATGCTTCTGCTA GGG 3, with the mature mir-147 sequence listed in bolded italics. The annealed double-stranded oligo was then cloned into pbabe-h1 at HindIII and BglII sites. The resulting construct was termed pbabe-h1-mir-147. The expression of mature mir-147 sequence was initiated by the RNA polymerase III promoter, H1. Generation of a Stable RAW264.7 Cell Line Inducibly Expressing mir-147. To generate a RAW264.7 cell line that can inducibly express mir-147, a tet-on system was used. First, RAW264.7 cells were transfected with pcdna6, which can express a tet repressor. The transfected cells were selected with blasticidin for 2 weeks. A single colony was isolated and checked for expression of the tet repressor. The positive clone was then transfected with pcdna4-mir-147. The cells were selected with zeocin for 2 weeks, and a single colony was isolated and amplified. An individual cell clone was left uninduced or was induced to express mir-147. Two positive clones (RAW264.7-miR-147#5 and #8) were used for the study. Transfection of MicroRNA Mimics and Inhibitors. Peritoneal macrophages were transfected with 40 nm control microrna mimics (Ambion) or mouse mir-147 mimics (Ambion) using HIPerFect transfection reagents (Qiagen) according to the manufacturer s instructions. At 2 days after transfection, the cells were washed three times and then underwent treatments. Similarly, cells were transfected with 40 nm control locked nucleic acid (LNA) modified inhibitors (Exiqon) or mouse LNA mir-147 inhibitors (Exiqon). Transfection of Non-Targeting Control sirna and NMES1-Coding Region Targeting sirna. Peritoneal macrophages were transfected with 40 nm control non-targeting sirna (Dhmarcon) or NMES1 sirna (Dhmarcon) using HIPerFect transfection reagents (Qiagen) according to the manufacturer s instructions. At 2 days after transfection, the cells were washed three times and then underwent treatments. The sequence for NMES1 sirna is: sense 5 CGUGGUUAUUGAUCGGAAAUU 3 and antisense 5 UUUCCGAUCAAUAACCACGUU 3. Real-Time RT-PCR. To determine the expression of mouse GAPDH, TNF-, IL-1, IFN-, IFN-, PYHIN, UBCH8, ZBP1, and primary mouse mir-147, cdna was synthesized using Taqman reverse transcription (RT) reagents (Applied Biosystems). To determine the expression of mouse NMES1 and primary human mir-147b, cdna was synthesized using iscript cdna Synthesis Kit (Bio-Rad). Real-time PCR was performed using a Lightcycler 480 SYBR Green I Master system (Roche) according to the manufacturer s instructions. The primers were as followings: mouse GAPDH: 5 CGACTTCAACAGCAA- CTCCCACTCTTCC 3 and 5 TGGGTGGTCCAGGGTTT- CTTACTCCTT 3 ; mouse TNF- :5 CTGTAGCCCACGTCG- TAGC 3 and 5 TTGAGATCCATGCCGTTG 3 ; mouse IL- 1 : 5 TGTAATGAAAGACGGCACACC 3 and 5 TCTTCTTTGGGTATTGCTTGG 3 ; mouse IFN- : 5 GGACTTTGGATTCCCGCAGGAGAAG 3 and 5 GCTG- CATCAGACAGCCTTGCAGGTC 3 ; mouse IFN- : 5 AAC- CTCACCTACAGGGCGGACTTCA 3 and 5 TCCCACGT- CAATCTTTCCTCTTGCTTT 3 ; mouse PYHIN: 5 AGTTCCCAAAAGATGCTGGAGTGGA 3 and 5 TCCT- TCGGGAAGCAGTTGGTAAAGA 3 ; mouse UBCH8: 5 CGCCAACTGTCTAGTGACTATGCCA 3 and 5 CCAGAT- TCGGTTTACTCACCAGCAC 3 ; mouse ZBP1: 5 AACCCT- CAATCAAGTCCTTTACCGC 3 and 5 TCTTCCACGTCT- GTCCGTCATAGCT 3 ; mouse primary mir-147/mouse NMES1: 5 TCTACACTAAAGTCATCATGGGCGTTTT 3 and 5 AGAGGAGTGGTGAGCAATCATCTGG 3 ; human GAPDH: 5 GCGAGATCCCTCCAAAATCAA 3 and 5 GT- TCACACCCATGACGAACAT 3 ; human primary mir-147b: 5 AACTCATTCCCTTGGTGGTGTTCAT 3 and 5 CTCGT- CATTTGGTCACCCTTTGGAC 3. To determine the expression of mouse mature mir-147 and human mature mir-147b, cdna was synthesized using Taqman reverse transcription reagents with specific human mature mir-147b RT primers (Applied Biosystems), specific mouse small nucleolar RNA 135 (snorna135) primers (Applied Biosystems), or specific human small nuclear RNA U6 (RNU6) primers (Applied Biosystems). Real-time PCR was performed using the Taqman Probe Master (Roche) system with specific human mature mir-147b probes, specific mouse snorna135 probes (Applied Biosystems), or RNU6 probes (Applied Biosystems). snorna135 and RNU6 served as an internal controls. 1of6

2 Cytokine ELISA. Immunoreactive mouse TNF- and mouse IL-6 was quantified using commercially available ELISA kits (R&D Systems), according to the manufacturer s instructions. Luciferase Assays. The approximately 2 kb of the mir-147 promoter region upstream of the transcriptional starting site was obtained by PCR amplification. The primers were: 5 CTC- GAGCCTGATACTGTAAACCTGGACAAGCA 3 and 5 AAGCTTCTTTTCAGAAAGGAGACGCACCTAG 3. The PCR product was subcloned into a luciferase reporter plasmid pgl2 between the XhoI and HindIII sites and the resulting plasmid was termed FL. The promoter region with deletion of the two distal NF- B binding sites, deletion of the two distal NF- B binding sites and the GAS element, or deletion of all three NF- B binding sites and the GAS element was obtained by PCR amplification and subcloned into pgl2. The resulting constructs were termed 1, 2, and 3, respectively. The forward primers for these fragments were: CTCGAGAA- GATATAACTTCAGCCCTTCAATG ( 1), CTCGAGCA- GAAACTGTGAGCCAAAAGTGATG ( 2), and CTC- GAGGGAGGAGGAGAAGAAATCAATCAATC ( 3), respectively. The reverse primer was the same as that with FL. The promoter region with an internal deletion of the proximal NF- B binding sites and the GAS element was obtained by replacing the fragment between PVUII and HindIII in the FL construct with a PCR product that started immediately after the GAS element and was ended at the same location as FT, 1, 2, and 3. This fragment was subcloned into pgl2. The resulting constructs were termed 4. The primers were used for the promoter with internal deletion were: 5 CAGCTGCAAAGCT- GATGCTAATACTCGG 3 and 5 AAGCTTCTTTTCA- GAAAGGAGACGCACCTAG g of various luciferase reporters were transfected into RAW264.7 cells. At 24 h after transfection, the cells were treated with 1 g/ml LPS for 16 h. The cells were lysed and the luciferase activities were measured and normalized to the protein concentration of the same lysate. Luciferase activity with the empty vector pgl2 was regarded as 1. Northern Blotting Assays. Total RNA (10 g) was resolved by 12% denatured polyacrylamide gel containing 8 M urea. After electrophoresis, the gel was stainined with 1 g/ml ethidium bromide solution to view RNA loading. The RNA was then transferred to Hybond nylone membranes (GE Life Sciences). After UV crosslinking, the membrane was incubated in prehybridization buffer [50% formamide (USB), 0.5% SDS, 5 SSC (USB), 5 Denhardt s solution (USB), and 20 g/ml sheared, denatured, salmon sperm DNA (Invitrogen)] at 37 C for 30 min. The membrane was then hybridized with specific -p32 labeled mouse LNA mir-147 probes (Exiqon) at 37 C for 24 h. The membrane was washed for 10 min three times with washing buffer (0.5% SDS, 2 SSC) and exposed to film. After hybridization with mir-147 probes, the membrane was striped and reblotted with specific -p32 labeled mouse U6 probes (Exiqon) as loading controls. Chromatin Immunoprecipitation Assays. After experimental treatments, RAW264.7 cells were fixed with 1% of formaldehyde for 10 min. Cells were collected in cold PBS and resuspended in 1 ml TE buffer. Genomic DNA was then sheared to lengths ranging from 200 to 1,000 bp by sonication. One percent of cell extract was taken out as input, and the rest of the extract was incubated with rabbit anti-p65 polyclonal antibodies or rabbit anti-stat1 polyclonal antibodies overnight, followed by precipitation with protein G agarose beads. Genomic DNA in the immunocomplexes was purified using Qiagen miniprep column (Qiagen). The NF- B binding site or the GAS responsive element in the promoter of mouse I B- or mir-147 were amplified by PCR. The primer sequence for amplification of the NF- B-responsive element in the promoter of mouse I B- gene was sense 5 TGGCGAGGTCTGACTGTTGTGG 3 and antisense 5 GCTCATCAAAAAGTTCCCTGTGC 3. The primer sequence for amplification of the mir-147 promoter region containing the NF- B binding site that is closer to the transcriptional start site and the GAS responsive element in the promoter of mouse mir-147 gene was sense 5 GATTTCATCCCTAC- CACTCACCAGC 3 and antisense 5 TTCCGAGTATTAG- CATCAGCTTTGG 3. 2of6

3 µ Fig. S1. mir-147 is induced in multiple macrophage populations after LPS treatment and in the lungs of LPS-exposed mice. (A and B) The expression of mir-146a and mir-155 was up-regulated in LPS-stimulated mouse macrophages. Peritoneal macrophages were treated with 1 g/ml LPS for the indicated lengths of time. Real-time PCR was performed as described in Materials and Methods. The non-treated cells were used as controls and values from these cells were regarded as 1. Values are expressed as mean SD from triplicate wells. Data shown are representative of three experiments. (C) mir-147 was induced in LPS-treated alveolar macrophages. Alveolar macrophages were treated with 500 ng/ml LPS for 0, 4, or 24 h. Real-time PCR was performed to determine the expression of mature mir-147. (D) RAW264.7 cells were treated with 1 g LPS for 0, 6, 24, or 48 h. Northern blotting was performed with mir-147 probes. The same membrane was stripped and re-blotted with U6 probes to ensure equal loading. (E and F) Primary and mature human mir-147b were induced in LPS-treated human monocyte cell line, THP-1. THP-1 cells were treated with 1,000 ng/ml LPS for 0, 4, or 24 h. Real-time PCR was performed to determine the expression of primary (E) and mature (F) mir-147b. GAPDH and RNU6 were used as internal controls. Values are presented as mean SD from 3 4 wells. *, P 0.05; **, P 0.01; and ***, P compared to untreated cells. (G and H) mir-147 and mir-155 were induced in the lungs of LPS exposed mice. LPS was intratracheally instilled into mice (1 mg/kg body weight). The mice were killed at 0, 4, 24, 48, and 72 h (five mice at each time point) after i.t. LPS administration and the lungs harvested. Lung RNA was purified and equal amounts of RNA from each mouse in the same group was pooled. Real-time RCR (G) and northern blotting (H) were performed to determine levels of mir-147 and mir of6

4 µ Fig. S2. mir-147 is induced by stimulation of multiple TLRs. (A) Time course of PAM3CSK4, poly(i:c) and LPS induced mir-147 (A) and TNF- (B) expression. Peritoneal macrophages were treated with 1 g/ml PAM3CSK4, 5 g/ml poly(i:c) or 1 g/ml LPS for 0, 9, and 24 h. Real-time PCR was performed to determine the levels of mir-147 (A) and TNF- (B). (C) LPS treatment does not induce IFN expression. Peritoneal macrophages were treated with 1 g/ml LPS for 0, 30, 60, and 120 min. The expression of IFN was determined by real-time PCR analysis. 4of6

5 µ Fig. S3. mir-147 is a negative regulator of macrophage inflammatory responses. (A) Peritoneal macrophages were transfected with 40 nm control microrna mimics or mir-147 mimics. At 48 h after the transfection, the cells were cultured with 1 ng/ml LPS for 18 h. Real-time PCR was performed to determine the expression of PYHIN, UBCH8, ZBP1, and pri-mir-147. Expression levels in control mimics transfected cells were regarded as 100%. Expression levels in mir-147 mimics transfected cells were the ratio to the control mimics transfected cells. Values are presented as mean SD from 3 4 wells. *, P 0.05, **, P 0.01, and ***, P compared to the control mimics transfected cells. (B) Control microrna mimics did not affect the response of macrophages to LPS stimulation. Peritoneal macrophages were transfected without (only with transfection reagents) or with 40 nm control microrna mimics or mir-147 mimics. At 48 h after the transfection, the cells were cultured with 1 ng/ml LPS for 18 h. The levels of TNF- and IL-6 in the supernatants were determined by ELISA. Values are presented as mean SD from 3 4 wells. **, P 0.01 and ***, P compared to the control mimics transfected cells. (C E) mir-147 attenuates LPS, PAM3CSK4, and poly(i:c) induced inflammatory response in RAW264.7 cells. RAW264.7-miR-147 cells were left uninduced or were induced to express mir-147 for 48 h. The cells were then treated with 1 ng/ml LPS (C), 100 ng/ml PAM3CSK4 (D), or 5 g/ml poly(i:c) (E) for 18 h. The levels of TNF- and IL-6 in the supernatants were then determined. Values were shown as mean SD from 3 4 wells. Data presented are representative of three experiments. *, P 0.05 and ***, P compared to cells without mir-147 induction. 5of6

6 µ Fig. S4. Downregulation of NMES1 had no effects on LPS induced cytokine expression in macrophages. (A and B) NMES1 coding region targeting sirna specifically knock down MRES1, but not mature mir-147 expression. Peritoneal macrophages were transfected with 40 nm non-targeting control sirna or specific NMES1 sirna. At 48 h after the transfection, the cells were cultured with or without 1 ng/ml LPS for 18 h. Real-time PCR was performed to determine the expression of NMES1 (A) and mature mir-147 (B). Values are presented as mean SD from 3 4 wells. **, P 0.01 when compared to LPS-treated control sirna transfected macrophages. (C and D) Downregulation of NMES1 had no effects on LPS induced cytokine expression in macrophages. The supernatants from (A) were collected and ELISA assays were performed to determine the levels of TNF- (C) and IL-6 (D). 6of6