Supporting Information
|
|
- Coral Dickerson
- 6 years ago
- Views:
Transcription
1 Supporting Information Liu et al /pnas SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from Invivogene. Rabbit anti-p65 and rabbit anti-stat1 antibodies were from Santa Cruz. Protein G agarose beads were from Pierce. Mice. C57BL/6 mice were purchased from NCI-Frederick. TRIF / mice were purchased from Jackson Labs. MyD88 / mice were previously described in (24). Age and sex matched mice were used. All animal protocols were approved by the UAB Institutional Animal Care and Use Committee (IACUC). Cell Culture. The human embryonic kidney cell line HEK-293, mouse macrophage cell line RAW and human monocytic cell line THP-1 were purchased from the American Type Culture Collection (ATCC). Mouse peritoneal macrophages were elicited by i.p. injection of 1.5 ml of 4% thioglycolate solution for 4 days. Alveolar macrophages were obtained by bronchoalveolar lavage with PBS containing 5 mm EDTA. The cells were cultured in DMEM plus 10% FBS at 37 C and 5% CO 2. Intratracheal Instillation of LPS. C57BL/6 mice were intratracheally injected with 1 mg/kg LPS in 50 L PBS. At 0, 4, 24, 48, or 72 h after injection, the mice (n 5) were killed and the lungs collected and homogenized in TRIzol solution to purify total RNA. Equal amounts of RNA from each mouse at each time point were pooled for analysis. Plasmids. To generate a construct that expresses mouse mature mir-147 under the control of tetracycline, the mouse full-length NMES1 cdna was amplified from mouse cdna using the following primers: sense 5 GGT ACC CCTTTCTGAAAAGT- TCTGTGGAGCG 3 and antisense 5 CTC GAG GTTTATA- CATTTCAAGGAAAATATCCAAGC 3. The PCR product was cloned into pcdna4 between KpnI and XhoI sites. The resulting construct was termed pcdna4-mir-147. To generate a construct that can express mature murine mir-147 sequence, two complementary DNA oligos were synthesized and annealed. The sequences for the oligos were sense 5 GATC CCC TAG- CAGAAGCATTTCCGCACAC TTCAAGAGA GTGTGCG- GAAATGCTTCTGCTA TTTTTGGAAA 3 and antisense 5 AGCT TTTCCAAAAA TAGCAGAAGCATTTCCGCACAC TCTCTTGAA GTGTGCGGAAATGCTTCTGCTA GGG 3, with the mature mir-147 sequence listed in bolded italics. The annealed double-stranded oligo was then cloned into pbabe-h1 at HindIII and BglII sites. The resulting construct was termed pbabe-h1-mir-147. The expression of mature mir-147 sequence was initiated by the RNA polymerase III promoter, H1. Generation of a Stable RAW264.7 Cell Line Inducibly Expressing mir-147. To generate a RAW264.7 cell line that can inducibly express mir-147, a tet-on system was used. First, RAW264.7 cells were transfected with pcdna6, which can express a tet repressor. The transfected cells were selected with blasticidin for 2 weeks. A single colony was isolated and checked for expression of the tet repressor. The positive clone was then transfected with pcdna4-mir-147. The cells were selected with zeocin for 2 weeks, and a single colony was isolated and amplified. An individual cell clone was left uninduced or was induced to express mir-147. Two positive clones (RAW264.7-miR-147#5 and #8) were used for the study. Transfection of MicroRNA Mimics and Inhibitors. Peritoneal macrophages were transfected with 40 nm control microrna mimics (Ambion) or mouse mir-147 mimics (Ambion) using HIPerFect transfection reagents (Qiagen) according to the manufacturer s instructions. At 2 days after transfection, the cells were washed three times and then underwent treatments. Similarly, cells were transfected with 40 nm control locked nucleic acid (LNA) modified inhibitors (Exiqon) or mouse LNA mir-147 inhibitors (Exiqon). Transfection of Non-Targeting Control sirna and NMES1-Coding Region Targeting sirna. Peritoneal macrophages were transfected with 40 nm control non-targeting sirna (Dhmarcon) or NMES1 sirna (Dhmarcon) using HIPerFect transfection reagents (Qiagen) according to the manufacturer s instructions. At 2 days after transfection, the cells were washed three times and then underwent treatments. The sequence for NMES1 sirna is: sense 5 CGUGGUUAUUGAUCGGAAAUU 3 and antisense 5 UUUCCGAUCAAUAACCACGUU 3. Real-Time RT-PCR. To determine the expression of mouse GAPDH, TNF-, IL-1, IFN-, IFN-, PYHIN, UBCH8, ZBP1, and primary mouse mir-147, cdna was synthesized using Taqman reverse transcription (RT) reagents (Applied Biosystems). To determine the expression of mouse NMES1 and primary human mir-147b, cdna was synthesized using iscript cdna Synthesis Kit (Bio-Rad). Real-time PCR was performed using a Lightcycler 480 SYBR Green I Master system (Roche) according to the manufacturer s instructions. The primers were as followings: mouse GAPDH: 5 CGACTTCAACAGCAA- CTCCCACTCTTCC 3 and 5 TGGGTGGTCCAGGGTTT- CTTACTCCTT 3 ; mouse TNF- :5 CTGTAGCCCACGTCG- TAGC 3 and 5 TTGAGATCCATGCCGTTG 3 ; mouse IL- 1 : 5 TGTAATGAAAGACGGCACACC 3 and 5 TCTTCTTTGGGTATTGCTTGG 3 ; mouse IFN- : 5 GGACTTTGGATTCCCGCAGGAGAAG 3 and 5 GCTG- CATCAGACAGCCTTGCAGGTC 3 ; mouse IFN- : 5 AAC- CTCACCTACAGGGCGGACTTCA 3 and 5 TCCCACGT- CAATCTTTCCTCTTGCTTT 3 ; mouse PYHIN: 5 AGTTCCCAAAAGATGCTGGAGTGGA 3 and 5 TCCT- TCGGGAAGCAGTTGGTAAAGA 3 ; mouse UBCH8: 5 CGCCAACTGTCTAGTGACTATGCCA 3 and 5 CCAGAT- TCGGTTTACTCACCAGCAC 3 ; mouse ZBP1: 5 AACCCT- CAATCAAGTCCTTTACCGC 3 and 5 TCTTCCACGTCT- GTCCGTCATAGCT 3 ; mouse primary mir-147/mouse NMES1: 5 TCTACACTAAAGTCATCATGGGCGTTTT 3 and 5 AGAGGAGTGGTGAGCAATCATCTGG 3 ; human GAPDH: 5 GCGAGATCCCTCCAAAATCAA 3 and 5 GT- TCACACCCATGACGAACAT 3 ; human primary mir-147b: 5 AACTCATTCCCTTGGTGGTGTTCAT 3 and 5 CTCGT- CATTTGGTCACCCTTTGGAC 3. To determine the expression of mouse mature mir-147 and human mature mir-147b, cdna was synthesized using Taqman reverse transcription reagents with specific human mature mir-147b RT primers (Applied Biosystems), specific mouse small nucleolar RNA 135 (snorna135) primers (Applied Biosystems), or specific human small nuclear RNA U6 (RNU6) primers (Applied Biosystems). Real-time PCR was performed using the Taqman Probe Master (Roche) system with specific human mature mir-147b probes, specific mouse snorna135 probes (Applied Biosystems), or RNU6 probes (Applied Biosystems). snorna135 and RNU6 served as an internal controls. 1of6
2 Cytokine ELISA. Immunoreactive mouse TNF- and mouse IL-6 was quantified using commercially available ELISA kits (R&D Systems), according to the manufacturer s instructions. Luciferase Assays. The approximately 2 kb of the mir-147 promoter region upstream of the transcriptional starting site was obtained by PCR amplification. The primers were: 5 CTC- GAGCCTGATACTGTAAACCTGGACAAGCA 3 and 5 AAGCTTCTTTTCAGAAAGGAGACGCACCTAG 3. The PCR product was subcloned into a luciferase reporter plasmid pgl2 between the XhoI and HindIII sites and the resulting plasmid was termed FL. The promoter region with deletion of the two distal NF- B binding sites, deletion of the two distal NF- B binding sites and the GAS element, or deletion of all three NF- B binding sites and the GAS element was obtained by PCR amplification and subcloned into pgl2. The resulting constructs were termed 1, 2, and 3, respectively. The forward primers for these fragments were: CTCGAGAA- GATATAACTTCAGCCCTTCAATG ( 1), CTCGAGCA- GAAACTGTGAGCCAAAAGTGATG ( 2), and CTC- GAGGGAGGAGGAGAAGAAATCAATCAATC ( 3), respectively. The reverse primer was the same as that with FL. The promoter region with an internal deletion of the proximal NF- B binding sites and the GAS element was obtained by replacing the fragment between PVUII and HindIII in the FL construct with a PCR product that started immediately after the GAS element and was ended at the same location as FT, 1, 2, and 3. This fragment was subcloned into pgl2. The resulting constructs were termed 4. The primers were used for the promoter with internal deletion were: 5 CAGCTGCAAAGCT- GATGCTAATACTCGG 3 and 5 AAGCTTCTTTTCA- GAAAGGAGACGCACCTAG g of various luciferase reporters were transfected into RAW264.7 cells. At 24 h after transfection, the cells were treated with 1 g/ml LPS for 16 h. The cells were lysed and the luciferase activities were measured and normalized to the protein concentration of the same lysate. Luciferase activity with the empty vector pgl2 was regarded as 1. Northern Blotting Assays. Total RNA (10 g) was resolved by 12% denatured polyacrylamide gel containing 8 M urea. After electrophoresis, the gel was stainined with 1 g/ml ethidium bromide solution to view RNA loading. The RNA was then transferred to Hybond nylone membranes (GE Life Sciences). After UV crosslinking, the membrane was incubated in prehybridization buffer [50% formamide (USB), 0.5% SDS, 5 SSC (USB), 5 Denhardt s solution (USB), and 20 g/ml sheared, denatured, salmon sperm DNA (Invitrogen)] at 37 C for 30 min. The membrane was then hybridized with specific -p32 labeled mouse LNA mir-147 probes (Exiqon) at 37 C for 24 h. The membrane was washed for 10 min three times with washing buffer (0.5% SDS, 2 SSC) and exposed to film. After hybridization with mir-147 probes, the membrane was striped and reblotted with specific -p32 labeled mouse U6 probes (Exiqon) as loading controls. Chromatin Immunoprecipitation Assays. After experimental treatments, RAW264.7 cells were fixed with 1% of formaldehyde for 10 min. Cells were collected in cold PBS and resuspended in 1 ml TE buffer. Genomic DNA was then sheared to lengths ranging from 200 to 1,000 bp by sonication. One percent of cell extract was taken out as input, and the rest of the extract was incubated with rabbit anti-p65 polyclonal antibodies or rabbit anti-stat1 polyclonal antibodies overnight, followed by precipitation with protein G agarose beads. Genomic DNA in the immunocomplexes was purified using Qiagen miniprep column (Qiagen). The NF- B binding site or the GAS responsive element in the promoter of mouse I B- or mir-147 were amplified by PCR. The primer sequence for amplification of the NF- B-responsive element in the promoter of mouse I B- gene was sense 5 TGGCGAGGTCTGACTGTTGTGG 3 and antisense 5 GCTCATCAAAAAGTTCCCTGTGC 3. The primer sequence for amplification of the mir-147 promoter region containing the NF- B binding site that is closer to the transcriptional start site and the GAS responsive element in the promoter of mouse mir-147 gene was sense 5 GATTTCATCCCTAC- CACTCACCAGC 3 and antisense 5 TTCCGAGTATTAG- CATCAGCTTTGG 3. 2of6
3 µ Fig. S1. mir-147 is induced in multiple macrophage populations after LPS treatment and in the lungs of LPS-exposed mice. (A and B) The expression of mir-146a and mir-155 was up-regulated in LPS-stimulated mouse macrophages. Peritoneal macrophages were treated with 1 g/ml LPS for the indicated lengths of time. Real-time PCR was performed as described in Materials and Methods. The non-treated cells were used as controls and values from these cells were regarded as 1. Values are expressed as mean SD from triplicate wells. Data shown are representative of three experiments. (C) mir-147 was induced in LPS-treated alveolar macrophages. Alveolar macrophages were treated with 500 ng/ml LPS for 0, 4, or 24 h. Real-time PCR was performed to determine the expression of mature mir-147. (D) RAW264.7 cells were treated with 1 g LPS for 0, 6, 24, or 48 h. Northern blotting was performed with mir-147 probes. The same membrane was stripped and re-blotted with U6 probes to ensure equal loading. (E and F) Primary and mature human mir-147b were induced in LPS-treated human monocyte cell line, THP-1. THP-1 cells were treated with 1,000 ng/ml LPS for 0, 4, or 24 h. Real-time PCR was performed to determine the expression of primary (E) and mature (F) mir-147b. GAPDH and RNU6 were used as internal controls. Values are presented as mean SD from 3 4 wells. *, P 0.05; **, P 0.01; and ***, P compared to untreated cells. (G and H) mir-147 and mir-155 were induced in the lungs of LPS exposed mice. LPS was intratracheally instilled into mice (1 mg/kg body weight). The mice were killed at 0, 4, 24, 48, and 72 h (five mice at each time point) after i.t. LPS administration and the lungs harvested. Lung RNA was purified and equal amounts of RNA from each mouse in the same group was pooled. Real-time RCR (G) and northern blotting (H) were performed to determine levels of mir-147 and mir of6
4 µ Fig. S2. mir-147 is induced by stimulation of multiple TLRs. (A) Time course of PAM3CSK4, poly(i:c) and LPS induced mir-147 (A) and TNF- (B) expression. Peritoneal macrophages were treated with 1 g/ml PAM3CSK4, 5 g/ml poly(i:c) or 1 g/ml LPS for 0, 9, and 24 h. Real-time PCR was performed to determine the levels of mir-147 (A) and TNF- (B). (C) LPS treatment does not induce IFN expression. Peritoneal macrophages were treated with 1 g/ml LPS for 0, 30, 60, and 120 min. The expression of IFN was determined by real-time PCR analysis. 4of6
5 µ Fig. S3. mir-147 is a negative regulator of macrophage inflammatory responses. (A) Peritoneal macrophages were transfected with 40 nm control microrna mimics or mir-147 mimics. At 48 h after the transfection, the cells were cultured with 1 ng/ml LPS for 18 h. Real-time PCR was performed to determine the expression of PYHIN, UBCH8, ZBP1, and pri-mir-147. Expression levels in control mimics transfected cells were regarded as 100%. Expression levels in mir-147 mimics transfected cells were the ratio to the control mimics transfected cells. Values are presented as mean SD from 3 4 wells. *, P 0.05, **, P 0.01, and ***, P compared to the control mimics transfected cells. (B) Control microrna mimics did not affect the response of macrophages to LPS stimulation. Peritoneal macrophages were transfected without (only with transfection reagents) or with 40 nm control microrna mimics or mir-147 mimics. At 48 h after the transfection, the cells were cultured with 1 ng/ml LPS for 18 h. The levels of TNF- and IL-6 in the supernatants were determined by ELISA. Values are presented as mean SD from 3 4 wells. **, P 0.01 and ***, P compared to the control mimics transfected cells. (C E) mir-147 attenuates LPS, PAM3CSK4, and poly(i:c) induced inflammatory response in RAW264.7 cells. RAW264.7-miR-147 cells were left uninduced or were induced to express mir-147 for 48 h. The cells were then treated with 1 ng/ml LPS (C), 100 ng/ml PAM3CSK4 (D), or 5 g/ml poly(i:c) (E) for 18 h. The levels of TNF- and IL-6 in the supernatants were then determined. Values were shown as mean SD from 3 4 wells. Data presented are representative of three experiments. *, P 0.05 and ***, P compared to cells without mir-147 induction. 5of6
6 µ Fig. S4. Downregulation of NMES1 had no effects on LPS induced cytokine expression in macrophages. (A and B) NMES1 coding region targeting sirna specifically knock down MRES1, but not mature mir-147 expression. Peritoneal macrophages were transfected with 40 nm non-targeting control sirna or specific NMES1 sirna. At 48 h after the transfection, the cells were cultured with or without 1 ng/ml LPS for 18 h. Real-time PCR was performed to determine the expression of NMES1 (A) and mature mir-147 (B). Values are presented as mean SD from 3 4 wells. **, P 0.01 when compared to LPS-treated control sirna transfected macrophages. (C and D) Downregulation of NMES1 had no effects on LPS induced cytokine expression in macrophages. The supernatants from (A) were collected and ELISA assays were performed to determine the levels of TNF- (C) and IL-6 (D). 6of6
supplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationSupplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
More informationNon-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationTechnical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationGalina Gabriely, Ph.D. BWH/HMS
Galina Gabriely, Ph.D. BWH/HMS Email: ggabriely@rics.bwh.harvard.edu Outline: microrna overview microrna expression analysis microrna functional analysis microrna (mirna) Characteristics mirnas discovered
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationSupplemental Information. PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock
Molecular Cell, Volume 49 Supplemental Information PARP1 Represses PAP and Inhibits Polyadenylation during Heat Shock Dafne Campigli Di Giammartino, Yongsheng Shi, and James L. Manley Supplemental Information
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationMyers Lab ChIP-seq Protocol v Modified January 10, 2014
Myers Lab ChIP-seq Protocol V011014 1 Contact information: Dr. Florencia Pauli Behn HudsonAlpha Institute for Biotechnology 601 Genome Way Huntsville, AL 35806 Telephone: 256-327-5229 Email: fpauli@hudsonalpha.org
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for resuspending the SingleShot RNA control template
Catalog # Description 172-5085 SingleShot SYBR Green Kit, 100 x 50 µl reactions For research purposes only. Introduction The SingleShot SYBR Green Kit prepares genomic DNA (gdna) free RNA directly from
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationTECHNICAL BULLETIN. GenElute mrna Miniprep Kit. Catalog MRN 10 MRN 70
GenElute mrna Miniprep Kit Catalog Numbers MRN 10, MRN 70 TECHNICAL BULLETIN Product Description The GenElute mrna Miniprep Kit provides a simple and convenient way to purify polyadenylated mrna from previously
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationRegulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells
Online Data Supplement Regulation and Function of the IL-1 Family Cytokine IL-1F9 in Human Bronchial Epithelial Cells Regina T. Chustz 1, Deepti R. Nagarkar 1, Julie A. Poposki 1, Silvio Favoreto, Jr 1,
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationXactEdit Cas9 Nuclease with NLS User Manual
XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of
More informationTable of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationIntracellular receptors specify complex patterns of gene expression that are cell and gene
SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationMMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit
MMLV Reverse Transcriptase 1st-Strand cdna Synthesis Kit Cat. No. MM070150 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA265E MMLV Reverse Transcriptase 1st-Strand cdna Synthesis
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationInterleukin-10 Inhibits Interleukin-12 p40 Gene Transcription by Targeting a Late Event in the Activation Pathway
MOLECULAR AND CELLULAR BIOLOGY, Mar. 2004, p. 2385 2396 Vol. 24, No. 6 0270-7306/04/$08.00 0 DOI: 10.1128/MCB.24.6.2385 2396.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationBasic Protocol (v. 2.0, May, 2003)
Basic Protocol (v. 2.0, May, 2003) Preparation of RNA:DNA Handles For the two handles (called A and B), you will need the following oligos: Product 1 : Name=B_reverse : Synthesis=1 umole : Purification=HPLC
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationSOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency
Molecular Cell, Volume 52 Supplemental Information SOD1 as a Molecular Switch for Initiating the Homeostatic ER Stress Response under Zinc Deficiency Kengo Homma, Takao Fujisawa, Naomi Tsuburaya, Namiko
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationSYBR Green Realtime PCR Master Mix
Instruction manual SYBR Green Realtime PCR Master Mix 0810 F0924K SYBR Green Realtime PCR Master Mix QPK-201T 1 ml x 1 QPK-201 1 ml x 5 Contents [1] Introduction [2] Components [3] Primer design [4] Detection
More informationSupporting Information. SI Material and Methods
Supporting Information SI Material and Methods RNA extraction and qrt-pcr RNA extractions were done using the classical phenol-chloroform method. Total RNA samples were treated with Turbo DNA-free (Ambion)
More informationPositively Charged Membrane
BIOBOND NYLON MEMBRANES ProductInformation Technical Bulletin No. MB-570 June 1999 Size Quantity Positively Charged Membrane Neutral Membrane 30 cm x 3.5 m 1 roll N4781 N1031 30 cm x 12 m 1 roll N4906
More informationPrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual RNA-direct SYBR Green Realtime PCR Master Mix 0810 F0930K RNA-direct SYBR Green Realtime PCR Master Mix Contents QRT-201T QRT-201 0.5mLx2 0.5mLx5 Store at -20 C, protected from light
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationPlease purchase PDFcamp Printer on to remove this watermark. DNA microarray
DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of
More informationOPPF-UK Standard Protocols: Mammalian Expression
OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationab ChIP Kit Magnetic One-Step
ab156907 ChIP Kit Magnetic One-Step Instructions for Use For selective enrichment of a chromatin fraction containing specific DNA sequences in a high throughput format using chromatin isolated from various
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationPlasmid Midiprep Plus Purification Kit. Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only
Plasmid Midiprep Plus Purification Kit Cat. # : DP01MD-P10/ DP01MD-P50 Size : 10/50 Reactions Store at RT For research use only 1 Description: The Plasmid Midiprep Plus Purification Kit provides simple
More informationRecombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationQuickExtract RNA Extraction Kit
Cat. Nos. QER09015 and QER090150 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 299 12/2012 1
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationDepartment of Biochemistry and Molecular Biophysics, Columbia University, New York, USA
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans Germano Cecere * and Alla Grishok Department of Biochemistry and Molecular Biophysics, Columbia University, New York, USA * For correspondence:
More informationBauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
More informationPureSpin DNA Clean Up Kit
PureSpin DNA Clean Up Kit Micro Columns INSTRUCTION MANUAL KIT COMPONENTS For Research Use Only PureSpin DNA Clean Up Kit, Micro Columns w/out Caps (Kit Size) OD2080 (50 Preps.) OD2080-2 (200 Preps.) Storage
More informationIMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
More informationBIOO RESEARCH PRODUCTS. ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205
BIOO RESEARCH PRODUCTS ALL-TAIL Kit Manual For Extreme 3 RACE Catalog #: 5205 BIOO Scientific Corp. 2010 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 2 Kit
More informationOne Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
More informationMir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationGetting the Most from Your DNA Analysis from Purification to Downstream Analysis. Eric B. Vincent, Ph.D. February 2013
Getting the Most from Your DNA Analysis from Purification to Downstream Analysis Eric B. Vincent, Ph.D. February 2013 1 Presentation Outline Genomic Analysis Purification Quantitation Qualification Analysis
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationFor in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida.
For in vitro Veterinary Diagnostics only. DNA Extraction and PCR Detection Kit for Pasteurella multocida www.kylt.eu DIRECTION FOR USE Art. No. 31058 / 31059 Kylt Pasteurella multocida DNA Extraction and
More informationRT 2 Easy First Strand Handbook
March 2011 RT 2 Easy First Strand Handbook For cdna synthesis Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and assay technologies,
More informationT7-Based RNA Amplification Protocol (in progress)
T7-Based RNA Amplification Protocol (in progress) Jacqueline Ann Lopez (modifications) Amy Cash & Justen Andrews INTRODUCTION T7 RNA Amplification, a technique originally developed in the laboratory of
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationThe Basics: RNA Isolation
Shop My Account View Cart Catalog Documents Technical Resources > The Basics > General Articles > RNA Isolation The Basics: RNA Isolation NAVIGATE THIS ARTICLE: Sample Collection/Disruption > Options >
More informationSite-directed mutagenesis of proteins
IFM/Kemi Linköpings Universitet August 2013/LGM Labmanual Site-directed mutagenesis of proteins Figur 1: Flow-chart of the site-directed mutagenesis lab exercise 2 Site-specific mutagenesis Introduction
More informationProductInformation TECHNICAL BULLETIN
RapidBlot Senior Transfer System RapidBlot Junior Transfer System RapidBlot Membrane Packs with BioBond or BioBond Plus Membranes Product Codes RAPID-1, RAPID-2, RP-1, RP-2, RP-3, RP-4 Technical Bulletin
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationHiPer Real-Time PCR Teaching Kit
HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from
More informationFor Research Use Only Ver
INSTRUCTION MANUAL ZR-Duet DNA/RNA MiniPrep Plus Catalog No. D7003 Highlights Efficient isolation and separation of DNA and RNA from any cells, tissue, blood, and biological fluids. High quality DNA and
More informationPrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
More informationAMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
More informationmmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
More informationGateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab
Gateway Cloning Protocol (Clough Lab Edition) This document is a modification of the Gateway cloning protocol developed by Manju in Chris Taylor's lab With the Gateway cloning system, a PCR fragment is
More informationAttention all MYbaits users: The following MYbaits protocol has been replaced with a newer version, which can be accessed from:
MYcroarray Attention all MYbaits users: The following MYbaits protocol has been replaced with a newer version, which can be accessed from: http://www.mycroarray.com/mybaits/manual s.html The following
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationBacteriophage MS2. genesig Standard Kit. Phage MS2 genome. 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Bacteriophage MS2 Phage MS2 genome genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Bacteriophage MS2 Bacteriophage MS2 is a non-enveloped,
More informationCell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on
Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin
More informationNature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.
Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice
More informationMolecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD
Molecular characterization, detection & quantitation of biological products Purin Charoensuksai, PhD Department of Biopharmacy, Faculty of Pharmacy, Silpakorn University Example of critical checkpoints
More informationSupplementary Figure 1
Supplementary Figure A Name Location Start position End position Oct4P Chr 3 29433673 29435 Annotation Mus musculus predicted gene 572 (Gm572), noncoding RNA RefSeq accession number NR_33594. Oct4P2 Chr
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More information