Microarray Solutions Edition # 4 / September 2008

Size: px
Start display at page:

Download "Microarray Solutions Edition # 4 / September 2008"

Transcription

1 Microarray Solutions Edition # 4 / September 2008 The Nexterion Newsletter Editorial...2 New Aminosilane Slide...3 Nexterion Slide AStar Protein Microarrays Selecting the optimal surface for your protein microarray Antibody Arrays...6 Epitome Biosystems, Boston, MA: Ti-Tyr Profiling chips for detection and quantification of phosphorylation sites News...7 Latest news from SCHOTT Meet us...8 Conference and exhibition calendar Competition...8 Win an ipod The Nexterion Newsletter

2 The Nexterion Newsletter #4 September 2008 page 2 2 Editorial Dear Reader, Welcome to the latest edition of the SCHOTT Microarray Solutions newsletter. Since the last edition, there have been a number of developments at SCHOTT that we hope will continue to allow us to offer the latest microarray substrates and accessories. Some of these developments will be covered in this newsletter, including the launch of a new coated slide product, and SCHOTT s continued focus on developing the best range of slide surfaces for protein microarrays. Christian Jabschinsky General Manager Nexterion Microarray Solutions When SCHOTT first entered the microarray slide business back in 2002, aminosilane coated substrates were by far the most popular choice for printing PCR products. Even after all this time, aminosilane still remains an extremely popular slide surface for printing DNA microarrays. As a result of this continued popularity, SCHOTT will soon launch what we feel will be the best aminosilane coated substrate in the market, Nexterion Slide AStar. There is a short interview with Dr Dietrich in this newsletter that gives some insights into the background and development of the product. Last year, SCHOTT introduced a range of new Nitrocellulose slides (Nexterion Slide NC). These were jointly developed by SCHOTT and Sartorius Stedim to address the needs of the rapidly growing protein microarray market. The high level of customer interest in Nexterion Slide NC, and other SCHOTT surfaces, led to our decision to give a presentation on How to select the most appropriate protein microarray surface at PepTalk 2008 in San Diego, CA. The talk was well received both by the delegates and the press. In this issue we look back on Dr. Dietmar Knoll s talk, and hopefully offer some invaluable advice on key factors to consider when selecting the most appropriate slide surface. This edition of Microarray Solutions will also introduce you to our exciting new product catalogue, and the newly developed web based Frequently Asked Questions. These will both help to complement the first class technical and customer support SCHOTT continues to strive to offer all our customers. I hope that you will enjoy reading this edition of our newsletter and, as always, please feel free to contact us if you have any ideas for articles you would like to see in future editions. These could include having your facility and research work with Nexterion product featured, or a suggestion for an application area that you would like us to focus on. Finally don t forget to enter our competition to win an ipod Classic. Viel Glück! Regards, Christian Jabschinsky

3 The Nexterion Newsletter #4 September 2008 page 3 3 Specification for AStar Coating Contact angle 50 Target spot size 100 microns Low fluorescence background (allowing long term storage of printed slide) Distinguished coating uniformity, CV s < 5% Robust and stable (highly reproducible) coating process Economic production costs O N H 2 O H 2 N N H NEW Nexterion Slide AStar Taking Aminosilane Slide Performance to the Next Level In this article we discuss the development of the new aminosilane slide from SCHOTT with the Director of R&D, Dr. Rüdiger Dietrich. MS: Why did SCHOTT decide to develop yet another Aminosilane coated slide? RD: That s a good question! Aminosilane slides still remain the most popular choice for printing both PCR products, and longer oligonucleotides. This is despite the widespread availability of potentially superior surface chemistries. To better address the needs of the current market, and in collaboration with colleagues in marketing, we developed a specification for a new high performance aminosilane slide (see table on left). MS: What were seen as important parameters for the new slide? RD: We agreed targets for performance characteristics such as a spot size with typical spotting buffer and conditions, required shelf lives of unprinted and printed slides, low background and high coating uniformity. Developing a commercial product is always a balance between creating the best product technically, and practical considerations like; are the reagents that we want to use readily availability for at least two suppliers at a reasonable cost? From the production point of view, a major consideration was that the slides must be able to be produced in a robust and stable process. Fortunately the seven years experience SCHOTT has with slide coating technologies was a major advantage in this respect. Alongside optimising the production process we have also developed new quality control for checking things like coating homogeneity. MS: SCHOTT already offers two aminosilane coated slides, isn t adding a third going to confuse customers? RD: Yes, potentially this could be a problem, and for this reason we have decided, in future, just to offer two type of aminosilane slides, Nexterion Slide A+, and Slide AStar. The current Nexterion Slide A will still be available on request, but we will not be actively promoting it. We have also been able to improve the performance and shelf life of Slide A+ as a result of what we learned during the development of Slide AStar. MS: Did you have any surprises during the development of the new product? RD: We first evaluated samples of all the commercially available aminosilanes. These are available with varying linker chain lengths and numbers and positions of amino groups. We also put prototype coated slides through full DNA hybridization experiments to find out the best performing surface under varying conditions. The way the aminosilane coating works is that the negatively DNA is attached to the surface by ionic interaction with positively charged amine groups. We had always thought that longer aminosilane molecules with multiple amino-groups produce higher signal-tonoise ratios, as their higher net positive charge will bind more DNA to the slide surface. However, we found that the situation is actually more complicated, and that while surfaces with a higher charge do bind more DNA, they are also much more difficult to block effectively, resulting in significantly higher nonspecific binding. The higher levels of non-specific binding have a negative effect leading to poorer signal-to-noise ratios. For this reason the aminosilane used for Slide AStar is a very short-chained molecule. MS: When will the new Nexterion Slide AStar be available? RD: We have already started sampling large customers, but the official product launch will be at the Discovery-2-Diagnostics conference in San Diego on October , so watch this space!

4 The Nexterion Newsletter #4 September 2008 page 4 4 SCHOTT Guide to Selecting the Optimal Slide Surface for your Protein Microarray In January, Dr. Dietmar Knoll gave a presentation at the PepTalk 2008 conference in San Diego, CA, outlining some of the factors researchers should consider when selecting suitable surfaces for functional protein microarrays. The talk was well received, and was subsequently referenced in an article in Genetic Engineering News (15th March 2008: Protein Microarray Uses Abound ). In the following article, Dr. Knoll discusses some of the key points from the talk with Microarray Solutions. Dr. Dietmar Knoll Senior R&D Scientist SCHOTT Microarray Solutions Jena, Germany. Prior to this, Dietmar worked for Quantifoil Micro Tools, a small biotech company acquired by SCHOTT in He received his Ph.D. in Organic Chemistry from Leipzig University and has extensive expertise in organic surface coatings. Because proteins have slightly different requirements to maintain their 3-D structure, for example membrane compared to cytosolic proteins, and not all requirements can be optimally reflected by one universal slide surface, so the user has to choose the most suitable slide surface solution for their specific application. Dr. Ruediger Dietrich, Director of Research & Development at SCHOTT Microarray Solutions. MS: Why has SCHOTT dedicated so many resources to developing a range of products for what is still a relatively small target market, when compared to DNA microarrays? DK: Proteins are a very important class of bio-molecules to study as they participate in every process within the living cell,for example, as enzymes, receptors, structural proteins, carrier proteins and so on. As a result, functional protein microarrays have become the fastest growing part of the microarray slide market, and are suited to a wide range of applications, such as biomarker discovery, antibody and protein substrate profiling, and protein quantification in diagnostic assays. Microarrays provide a way of doing this in a rapid, highly parallel, and cost effective way. However, when compared to DNA microarrays, there are still many technical challenges to overcome. MS: What are some of the technical obstacles to creating function protein microarrays? DK: One of the major challenges is the generation of the content itself. To ensure accurate results, a stable protein is necessary, and finding or purifying suitable high quality proteins can be costly in both time and money. Proteins are much more complex than DNA, starting with the higher number of building blocks to form polypeptides, continuing with a secondary structure, and finally a more or less susceptible 3-D structure, which is essential for their function. Because of the complexity of a protein, providing a stable environment to maintain the structure is important for any kind of biological assay. Consequently, slide surfaces play a vital role providing a support structure to keep the protein molecules intact and functioning properly, and at a fixed location for interaction with another biological molecule. MS: What are the most important slide surface characteristics? DK: Many of the slide surface characteristics important for DNA microarrays also hold true for protein microarrays. These include planar surface, high binding capacity, low non-specific binding, high sensitivity, low autofluorescence of the glass and compatibility with the process protocols. However, the stabilizing environment of the slide surface is of much greater importance for protein microarrays, along with the need for high binding capacity, tolerance to a wide range of print buffers, and the opportunity to analyze the arrays using label free detection systems. MS: What types of slide surface are currently available from SCHOTT for protein microarrays? DK: The SCHOTT coated glass substrates can be categorized into either twodimensional (2-D) or three-dimensional (3-D) surfaces. 2-D Substrates provide a planar surface consisting of a chemical monolayer, which actively immobilize protein molecules via epoxy (Nexterion Slide E), or aldehyde groups (Nexterion Slide AL). These surfaces are normally very robust and reliable, however 2-D substrates provide very little structural support for the tertiary or quaternary structures of proteins. Consequently, this

5 The Nexterion Newsletter #4 September 2008 page 5 type of surface is usually most suitable for arraying more robust proteins like antibodies, or in assays that do not require the protein probes to be functionality active. Another point to consider is the high steric hindrance with 2-D substrates. This disadvantage can be circumvented by addition of appropriate linkers to keep the probe away from the surface. The binding capacity of 2-D substrates is generally significantly less than with 3-D. 5 P r o b e t y p e S u r f a c e t y p e C o a t i n g p r o p e r t i e s R e c o m m e n d e d N e x t e r i o n p r o d u c t Using 3-D Substrates overcomes both limitations mentioned above as their multi-dimensional structure help to retain protein functionality and offer a high binding capacity. Another advantage of these substrates is that the open 3-D structure can provide the target with better accessibility to the printed probes. 3-D slide surfaces can be further divided into thin film and thick film coatings, thick films are typically tens of microns thick, whereas thin film typically have a thickness of less than a few hundred nanometres. Thin film coatings such as hydrogel slides (Nexterion Slide H), Streptavidin-hydrogel (Nexterion Slide H-S) and polymer slides (Nexterion Slide P), have higher binding capacity than 2-D slides, and provide a exceptionally low non-specific binding after blocking. Therefore, high signal-to-noise ratios, and sensitivity can be achieved with these substrates. Examples of thick 3-D coatings are nitrocellulose coated slides (Nexterion Slide NC). MS: During your talk you mentioned reverse phase assays, do these require specific substrates? DK: Yes, for reverse phase using cell lysates, the thin film hydrogel and polymer surfaces are not really suitable. These probe types require high concentrations of detergent to avoid precipitation, conditions that would result in very large spot sizes and poor spot morphology on hydrogel and polymer surfaces. Therefore the thick 3-D substrates like nitrocellulose coated slides (Nexterion Slide NC) are the substrates of choice for this application. Generally, nitrocellulose slides are a good starting point for most protein array applications as they produce a linear correlation between probe and target over a wide concentration range. Another advantage is that for many applications printed nitrocellulose slides exhibit a very long shelf life at ambient temperatures without significant loss of activity. The disadvantages discovered when evaluating nitrocellulose surfaces can include high background, and no possibility of having additional layers such as, optically active layers under the opaque nitrocellulose coating for enhancing signal or use in label free detection. MS: Do you have any final recommendations? DK: The range of possible assays, technologies and studies involving analysis of proteins is very diverse, and there is no one universal surface that will work for all. Indeed the vast number of variables that can impact the quality of data a user can generate from a protein microarray dictates that even the above guidelines may not always be totally reliable. SCHOTT typically recommending that users try a variety of different slide surfaces rather than focus their efforts entirely on one slide surface. For additional advice on selecting the most appropriate slide surface for your protein application, or to receive a copy of the PepTalk 2008 presentation given by Dr. Dietmar Knoll, please send an message.

6 The Nexterion Newsletter #4 September 2008 page 6 6 Epitome Biosystems Antibody Arrays Company: Epitome Biosystems Location: Waltham, MA Web: Substrate Used: Nexterion Slide H Epitome Biosystems, Waltham, MA: Ti-Tyr Profiling Chips for Detection and Quantification of Site-Specific Phosphorylation via Sandwich Immunoassays Epitome Biosystems is pioneering innovative protein measurement products to enable drug discovery, drug development and the practice of clinical medicine. The company's highly quantitative and specific protein measurement products provide critical information on biological mechanisms and reveal important biomarkers or readouts of cell function. Epitome s initial focus is on novel phosphorylation measurement products, including mass spectrometry (MS)-based biomarker discovery, as well as profiling chips and multiplex assay kits that are based on Epitome s proprietary EpiTag technology. The EpiTag technology platform enables quantitative, multiplexed and highly specific measurements of protein abundance and amounts of phosphorylation at specific sites using targeted antibody pairs in a peptide-based sandwich immunoassay format. Epitome s Ti-Tyr Chip provides quantitative profiling of dozens of phosphorylation sites simultaneously, on up to sixteen samples per chip, using a standard microarray reader. These products enable: Quantitative assessment of phosphorylation at individual sites on proteins Analysis of on- and off-target drug responses across signalling networks Measurement of low copy number proteins and low abundance phosphorylation events Epitome s innovative protein measurement products and services enable Pharmaceutical, Biotech and Academic researchers to obtain highly specific, quantitative information about the cell-signalling network, which is a key interface for monitoring drug action and understanding disease. Key application areas include biomarker discovery and development, target validation and elucidation of mechanisms of drug action. The Ti-Tyr Profiling Chip is a tyrosine phosphorylation focused product, based on Epitome s proprietary EpiTag technology. Tyrosine phosphorylation is measured quantitatively at a site-specific level, after proteolytic fragmentation of samples. The Ti-Tyr Chip allows for multiplexed analysis across 74 phosphotyrosine sites on 60 different proteins using a planar microarray. The Ti-Tyr Chip covers a wide range of content including receptors (e.g. EGFR and HER2), adapter and scaffold proteins (e.g. IRS1 and Crk), intracellular mediators (e.g. Erk1 and Raf-1) and transcription factors (e.g. c-jun and STAT3). A single chip can be used to analyze 16 different samples, including reference standards and controls, or four chips can be mounted in a carrier and treated similar to a microtiter plate. A number of coated microarray slides from several manufacturers were evaluated on their ability to meet the demands of the Epitome application. SCHOTT slides were the only slides that provided uniform, high signals and very low backgrounds necessary for our highly multipexed antibody arrays, reported Tim Nadler, Director of Product Development, Epitome BioSystems SCHOTT slide quality enabled Ti-Tyr Chip s ability to consistently perform quantitative, high content measurements. EpiTag technology provides a unique, powerful platform for targeted, quantitative and highly multiplexed protein measurements. The approach provides a predictable, streamlined path for assay development and enables rapid content generation. In addition to ongoing Ti-Tyr Chip content expansion, similar profiling chips incorporating threonine and serine phosphorylation measurements are in development.

7 The Nexterion Newsletter #4 September 2008 page 7 SCHOTT Microarray Solutions News 7 New SCHOTT Microarray FAQ Section Goes Online Since entering the microarray substrate market several years ago, SCHOTT has aimed to provide customers with the best possible technical support, whether it be through direct contact with designated technical support specialists, or via support materials such as protocols, scientific papers or customer references. To further enhance this offering, SCHOTT has just launched a new Frequently Asked Questions (FAQ) section to be found at the Nexterion web site. New Nexterion Microarray Substrates Catalogue The new catalogue for the Nexterion range of microarray products will be available from 01 September The format of the new catalogue will be a flexible ring binder system, allowing customers to keep all the details of the Nexterion products, such as product flyers, ordering details, protocols etc., in one place. The catalogue can easily be kept up to date simply by adding new information sheets as they become available. The layout of the individual product flyers has been redesigned to improve readability and allow customers to find the important information quickly. Nitrocellulose Slide Application Note SCIENION AG manufactures and markets non-contact dispensing systems for printing microarrays. They have recently published an application note favourably comparing the new SCHOTT Nexterion nitrocellulose slides (Slide NC-W and NC-D) to the market leading nitrocellulose slide. For further details please download the sciflexarrayer Application Note No from: Nexterion MPX 16-well Slide Price Reduction The Nexterion MPX 16-well slides have always been a popular way to run multiple arrays on one slide. SCHOTT has now made these slides even more cost effective by reduced the list price of all the MPX slides. In order to do this the slide package now contains five MPX slides rather than eight, and the Nexterion 16-well self-adhesive superstructure and sealing strip are now supplied as a separate item. For more details about the revised MPX slide range please visit the SCHOTT Nexterion web site.

8 The Nexterion Newsletter #4 September 2008 page 8 Conference and Exhibition Calendar 2008/09 8 Exhibition Location Date Discovery2Diagnostics Manchester Grand Hyatt San Diego One Market Place San Diego, CA USA October PEPTALK 2009 LabAutomation2009 Statusseminar Chip Technologies Advances in Microarray Technology Did you know? Hotel Del Coronado 1500 Orange Ave Coronado, CA USA Palm Springs Convention Center, Palm Springs, CA USA DECHEMA-Haus Theodor-Heuss-Allee Frankfurt am Main, Germany Stockholm International Fairs S STOCKHOLM Mässvägen 1, Stockholm/Älvsjö, Sweden January January March May By entering our competition, you will have a chance to win one Apple ipod classic (80 GB).Simply answer the three questions below, and send your entry to arrive before 12 midnight (CET) on 28 February By coatedsubstrate@us.schott.com By fax: / The winner will be the first correct entry drawn at random. Name : Institute/Company : 1. What title was the city of Jena awarded in 2008? City of Optics "Stadt der Optik" City of Science "Stadt der Wissenschaft" City of Sport "Stadt des Sports" Microarray Solutions SCHOTT North America Inc Shepherdsville Road Louisville, KY USA Phone: Fax: coatedsubstrate@us.schott.com 2. Which Nexterion slide does Epitome Biosystems use for their profiling chips? Nexterion Slide E Nexterion Slide H Nexterion Glass B 3. What is the name of the new aminosilane slide from SCHOTT? ASpar APlug AStar * Only one entry per person. The judges' decision is final. This competition is void where prohibited. This competition is run and staged in accordance with German legislation.

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Microarray Solutions

Microarray Solutions Microarray Solutions The Nexterion Newsletter Edition # 3 / September 2007 SCHOTT LAUNCHES A NEW RANGE OF NITROCELLULOSE SLIDES, NEXTERION SLIDE NC, IN PARTNERSHIP WITH SARTORIUS STEDIM BIOTECH read more

More information

Protocol. Nexterion Slide E MPX 16. Protein-application

Protocol. Nexterion Slide E MPX 16. Protein-application Seite: 1/8 1 Introduction... 2 2 Storage and handling... 3 3 General precautions... 3 4 Reagents required... 3 5 Equipment required... 3 6 Array printing... 4 7 Printing guidelines... 4 8 Protein immobilization...

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Protocol. Nexterion Slide A+ MPX 16. DNA-application

Protocol. Nexterion Slide A+ MPX 16. DNA-application Seite: 1/12 1 Introduction...2 2 Storage and handling...3 3 General precautions...3 4 Reagents required...3 5 Equipment required...4 6 Array printing...4 7 Printing guidelines...5 8 DNA immobilization...6

More information

Technical Instructions for Spotting Microarrays

Technical Instructions for Spotting Microarrays Technical Instructions for Spotting Microarrays PRODUCT is a special low fluorescence glass slide in the standard size of 75.6 mm x 25.0 mm x 1.0 mm. The aldehyde surface coating allows efficient covalent

More information

1. General. Contents. 2. Technical support. 3. Coated substrates. Aldehydesilane coating. Aminosilane coating. Epoxysilane coating

1. General. Contents. 2. Technical support. 3. Coated substrates. Aldehydesilane coating. Aminosilane coating. Epoxysilane coating Contents 1. General Introduction High quality borosilicate glass Production and quality assurance General information on coated slides 2. Technical support 3. Coated substrates Aldehydesilane coating NEXTERION

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

DNA Microarray Technology

DNA Microarray Technology CHAPTER 1 DNA Microarray Technology All living organisms are composed of cells. As a functional unit, each cell can make copies of itself, and this process depends on a proper replication of the genetic

More information

Expression Array System

Expression Array System Integrated Science for Gene Expression Applied Biosystems Expression Array System Expression Array System SEE MORE GENES The most complete, most sensitive system for whole genome expression analysis. The

More information

Characterization of Aptamer Binding using SensíQ SPR Platforms

Characterization of Aptamer Binding using SensíQ SPR Platforms Characterization of Aptamer Binding using SensíQ SPR Platforms APPLICATION NOTE INTRODUCTION Aptamers have the potential to provide a better solution in diagnostics and other research areas than traditional

More information

Kinase Activity: a total solution

Kinase Activity: a total solution Kinase Activity: a total solution Protein arrays for multiplex kinetic measurements Robust Instrumentation User friendly software Kinetic data at your fingertips! PamGene s novel platform for profiling

More information

Protocol. NEXTERION Slide H. Protein application

Protocol. NEXTERION Slide H. Protein application Seite: 1/8 1 Introduction... 2 2 Storage and handling... 3 3 General precautions... 3 4 Reagents required... 4 5 Equipment required... 4 6 Protein concentration for spotting... 5 7 Array printing... 5

More information

Biomarker Discovery using Surface Plasmon Resonance Imaging

Biomarker Discovery using Surface Plasmon Resonance Imaging F e a t u r e A r t i c l e Feature Article Biomarker Discovery using Surface Plasmon Resonance Imaging Elodie LY-MORIN, Sophie BELLON, Géraldine MÉLIZZI, Chiraz FRYDMAN Surface Plasmon Resonance (SPR)

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit

RayBio Phospho- Stat 3 (Tyr705) ELISA Kit RayBio Phospho- Stat 3 (Tyr705) ELISA Kit For Measuring Phosphorylated Stat3 (Tyr705) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Stat3 (Tyr705) ELISA Kit Protocol (Cat#:

More information

Protocol. Nexterion Slide E. DNA application

Protocol. Nexterion Slide E. DNA application Seite: 1/12 1 Introduction...2 2 Storage and handling...2 3 Array printing...3 4 DNA immobilization...3 5 Handling of printed arrays...3 6 Washing...3 7 Blocking...4 8 Hybridization...4 9 Post-Hybridization

More information

Instruction Manual for DNA-Microarrays

Instruction Manual for DNA-Microarrays Instruction Manual for DNA-Microarrays 3-D Amino Surface Last update: 2004-12 page 1 Table of contents I. Introduction...3 II. Product description...4 A. Greiner Bio-One HTA Slides...4 B: SCIENION Buffer

More information

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics

TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics TECHNICAL NOTE Phosphorylation Site Specific Aptamers for Cancer Biomarker Peptide Enrichment and Detection in Mass Spectrometry Based Proteomics INTRODUCTION The development of renewable capture reagents

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Explore the future. Automotive Test Systems Process & Environmental Medical Semiconductor Scientific

Explore the future. Automotive Test Systems Process & Environmental Medical Semiconductor Scientific Explore the future Automotive Test Systems Process & Environmental Medical Semiconductor Scientific Label-free Bio-Affinity Analysis Surface Plasmon Resonance (SPR) is an established tool in the life science

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

RayBio Phospho- Akt (Ser473) ELISA Kit

RayBio Phospho- Akt (Ser473) ELISA Kit RayBio Phospho- Akt (Ser473) ELISA Kit For Measuring Phosphorylated Akt (Ser473) in Human, Mouse and Rat Cell Lysates User Manual (Revised Mar 1, 2012) RayBio Akt (Ser473) ELISA Kit Protocol (Cat#: PEL-Akt-S473-001)

More information

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE)

GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) TriMark Publications April 2007 Volume: TMRGER07-0401 GENE EXPRESSION REAGENTS MARKETS (SAMPLE COPY, NOT FOR RESALE) Trends, Industry Participants, Product Overviews and Market Drivers TABLE OF CONTENTS

More information

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme

Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the

More information

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications

Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications Comparison of LANCE Ultra TR-FRET to PerkinElmer s Classical LANCE TR-FRET Platform for Kinase Applications LANCE ULTRA TR-FRET TECHNOLOGY A P P L I C A T I O N N O T E Introduction Protein kinases play

More information

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer

Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Performance characteristics of the High Sensitivity DNA kit for the Agilent 2100 Bioanalyzer Technical Note 10 Measured conc. [ng/µl] 1 Y intercept = 0.09 r 2 = 0.993 0.1 0.1 1 10 Reference concentration

More information

SureSilencing sirna Array Technology Overview

SureSilencing sirna Array Technology Overview SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Drug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels

Drug Discovery Research Clinical Screening. Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels Drug Discovery Research Clinical Screening FLAG Expression Measurement Application Note Comparison of ELISA and AlphaScreen Assay Technologies for Measurement of Protein Expression Levels ALPHASCREEN APPLICATION

More information

Overview of Solulink Products. June 2011

Overview of Solulink Products. June 2011 Overview of Solulink Products June 2011 1 Who we are Established in 2003, Solulink develops, patents, manufactures, and sells consumables to over 1,000 customers in life science, diagnostic, and pharmaceutical

More information

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay

Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Using ULS24 CMOS Bio-imager as a Readout Sensor for Chemiluminescence Immunoassay and DNA Hybridization Assay Updated: Nov 11, 2016 Introduction Immunoassay is a widely used method for detecting the presence

More information

Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration

Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration Introducing a Highly Integrated Approach to Translational Research: Biomarker Data Management, Data Integration, and Collaboration 1 2 Translational Informatics Overview Precision s suite of services is

More information

Azure Biosystems Western Blotting Workflow

Azure Biosystems Western Blotting Workflow Azure Biosystems Western Blotting Workflow PROBE PLAN SEPARATE ANALYZE VISUALIZE PLAN Plan your experiment and choose your detection method Chemiluminescent Western Blotting The most common method for

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC.

MSD Immuno-Dot-Blot Assays. A division of Meso Scale Diagnostics, LLC. MSD Immuno-Dot-Blot Assays Example: High Throughput Western Blots Replacements Traditional Western Blots High content Molecular weight and immunoreactivity Labor and protein intensive Inherently low throughput

More information

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection

Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Fragment-based screening of enzyme drug targets: Microfluidic mobility shift assay improves confidence in candidate selection Introduction Fragment-based lead discovery is establishing itself as valuable

More information

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count

Tech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from

More information

Label-free interaction analysis in realtime using surface plasmon resonance

Label-free interaction analysis in realtime using surface plasmon resonance GE Healthcare Technology Note 23 Biacore systems Label-free interaction analysis in realtime using surface plasmon resonance Providing quantitative data on: report point Specificity sensorgram To what

More information

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology

Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Introduction Lateral Flow (LF) and similar assays represent a unique growing class of Point of Care (POC) tests designed to

More information

Application Note AN001

Application Note AN001 Testing hybridoma supernatants with the Spots On Dots Antibody Screening Kit Application Note AN1 Table of Contents Overview... 2 Figure 1. Screening of hybridomas raised against peptide antigens... 3

More information

rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF

rapiflex Innovation with Integrity Designed for Molecules that Matter. MALDI TOF/TOF rapiflex Designed for Molecules that Matter. Innovation with Integrity MALDI TOF/TOF rapiflex TM The first MALDI-TOF/TOF that adapts to your needs. The rapiflex is the most advanced MALDI TOF/TOF system

More information

Production-based pharmacist a fascinating job.

Production-based pharmacist a fascinating job. www.mybayerjob.com Production-based pharmacist a fascinating job These are the interesting tasks that our pharmacists typically undertake in entry-level positions in Production at Bayer HealthCare Pharmaceuticals

More information

Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Pipette Tips. Next generation immunoaffinity. Robust quantitative platform

Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Pipette Tips. Next generation immunoaffinity. Robust quantitative platform Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Pipette Tips Next generation immunoaffinity Robust quantitative platform Immunoaffinity sample preparation Thermo Scientific Mass Spectrometric Immunoassay

More information

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST

Peptide libraries: applications, design options and considerations. Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Peptide libraries: applications, design options and considerations Laura Geuss, PhD May 5, 2015, 2:00-3:00 pm EST Overview 1 2 3 4 5 Introduction Peptide library basics Peptide library design considerations

More information

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay

-PLEX. Immunogenicity Assay Application Note. Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay -PLEX Immunogenicity Assay Application Note 1 Measuring anti-drug antibodies (ADAs) to two different drugs using a multiplex bridging assay The use of biotherapeutics, biosimilars, and combination biotherapies

More information

EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M)

EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M) Primerdesign TM Ltd EGFR T790M mutation mutation detection by quantitative allele specific amplification (quasa) EGFR (T790M) 50 tests For general laboratory and research use only 1 Contents Introduction

More information

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology

MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Technical note MicroRNA profiling directly from low amounts of plasma or serum using the Multiplex Circulating mirna Assay with Firefly particle technology Abstract We introduce a new assay that enables

More information

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques

Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Comparing the Agilent 2100 Bioanalyzer Performance to Traditional DNA Analysis Techniques Application Note Author Deborah Vitale Agilent Technologies, Inc. Palo Alto, CA, USA Abstract This Application

More information

Introduction to Assay Development

Introduction to Assay Development Introduction to Assay Development A poorly designed assay can derail a drug discovery program before it gets off the ground. While traditional bench-top assays are suitable for basic research and target

More information

Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents

Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents A p p l i c a t i o n G u i d e Synergy NEO HTS Multi-Mode Microplate Reader and Life Technologies Reagents High Performance Multi-Detection Capabilities that Span the Small Molecule Drug Discovery Process

More information

ab Complex IV Human Enzyme Activity Microplate Assay Kit

ab Complex IV Human Enzyme Activity Microplate Assay Kit ab109909 Complex IV Human Enzyme Activity Microplate Assay Kit Instructions for Use For the quantitative measurement of Complex IV activity in samples from Human and Cow. This product is for research use

More information

Lecture #1. Introduction to microarray technology

Lecture #1. Introduction to microarray technology Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing

More information

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests

Advanced phospho-erk1/2 (Thr202/Tyr204) 500 tests Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64aerpeg USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1

More information

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL

Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL Developing an Accurate and Precise Companion Diagnostic Assay for Targeted Therapies in DLBCL James Storhoff, Ph.D. Senior Manager, Diagnostic Test Development World Cdx, Boston, Sep. 10th Molecules That

More information

Multi-Volume Based Protein Quantification

Multi-Volume Based Protein Quantification A p p l i c a t i o n G u i d e Multi-Volume Based Methods Why Quantify Proteins? Proteins are central to our understanding of biology. In cells, they are multipurpose: from actin providing structural

More information

Towards unbiased biomarker discovery

Towards unbiased biomarker discovery Towards unbiased biomarker discovery High-throughput molecular profiling technologies are routinely applied for biomarker discovery to make the drug discovery process more efficient and enable personalised

More information

AmoyDx TM JAK2 V617F Mutation Detection Kit

AmoyDx TM JAK2 V617F Mutation Detection Kit AmoyDx TM JAK2 V617F Mutation Detection Kit Detection of V617F mutation in the JAK2 oncogene Instructions For Use Instructions Version: B1.0 Date of Revision: July 2012 Store at -20±2 o C -1/5- Background

More information

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125

Proteomics. Manickam Sugumaran. Department of Biology University of Massachusetts Boston, MA 02125 Proteomics Manickam Sugumaran Department of Biology University of Massachusetts Boston, MA 02125 Genomic studies produced more than 75,000 potential gene sequence targets. (The number may be even higher

More information

Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology

Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology APPLICATION NOTE HTS Reagents Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Waltham, MA Simple Conversion of ELISA to PerkinElmer s High Sensitivity DELFIA Technology Introduction Immunoassays

More information

Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL

Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE PROTOCOL Part # PV3324 Lit. # 762-038412 020304 TABLE OF CONTENTS 1.0 INTRODUCTION... 2 2.0 ASSAY THEORY... 2 3.0 Z -LYTE KINASE ASSAY KIT SER/THR 9 PEPTIDE MATERIALS

More information

Workshop and Training Program on Sampling and Detection Methods Applied to Transgenic Crops November 17 19, 2011, NIN, Hyderabad, India

Workshop and Training Program on Sampling and Detection Methods Applied to Transgenic Crops November 17 19, 2011, NIN, Hyderabad, India Workshop and raining Program on Sampling and Detection ethods Applied to ransgenic Crops odified (G) Plants and Food Detection ethods Dr. Clara. Alarcon Pioneer Hi-Bred Hyderabad, 2011 1.Plants 2.Seeds

More information

Transcription Factor ELISA Kit

Transcription Factor ELISA Kit Transcription Factor ELISA Kit User Manual P/N 12490 Rev. A 061119 DRAFT November 19, 2006 6:40 pm ElisaTFTtile.fm Panomics, Inc. Transcription Factor ELISA Kit User Manual Copyright Copyright 2006, Panomics,

More information

Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System

Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System Technical Note Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System Sensitive Gene Expression Analysis From Crude Preparations and Fragmented RNA Cell Lysates Tissue Homogenates

More information

DNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016

DNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016 DNA Workflow Marine Biological Laboratory Mark Bratz Applications Scientist, August 2016 Scientific Applications Support Mission Realize customer driven applications of Promega technologies to enhance

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING

PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING Fraunhofer Institute for Manufacturing Engineering and Automation IPA PROJECT GROUP FOR AUTOMATION IN MEDICINE AND BIOTECHNOLOGY IN MANNHEIM BIOPROCESS ENGINEERING VERGÜTUNG VON ERFINDUNGEN UND TECHNISCHEN

More information

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip

Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Validation Study of FUJIFILM QuickGene System for Affymetrix GeneChip Reproducibility of Extraction of Genomic DNA from Whole Blood samples in EDTA using FUJIFILM membrane technology on the QuickGene-810

More information

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System

PCR SYSTEMS. a new era in high-productivity qpcr. Applied Biosystems ViiA 7 Real-Time PCR System PCR SYSTEMS a new era in high-productivity qpcr Applied Biosystems ViiA 7 Real-Time PCR System a new era in high-productivity qpcr The ViiA 7 Real-Time PCR System delivers the proven reliability, sensitivity,

More information

Annotated PhosphoSites Kinase Off-the-shelf peptide microarrays

Annotated PhosphoSites Kinase Off-the-shelf peptide microarrays Protocol Annotated PhosphoSites Kinase Off-the-shelf peptide microarrays Contact us: InfoLine: +49-30-6392-7878 Order per fax: +49-30-6392-7888 Or e-mail: peptide@jpt.com www: www.jpt.com JPT Peptide Technologies

More information

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics.

Program overview. SciLifeLab - a short introduction. Advanced Light Microscopy. Affinity Proteomics. Bioinformatics. Open House Program SciLifeLab Open House in Stockholm November 4, 2015 09:00-16:00 Contact: events@scilifelab.se Program overview 09:00-09:30-10:00-10:30-11:00-11:30-12:00-12:30-13:00-13:30-14:00-14:30-15:00-15:30-09:30

More information

Please purchase PDFcamp Printer on to remove this watermark. DNA microarray

Please purchase PDFcamp Printer on  to remove this watermark. DNA microarray DNA microarray Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. A DNA microarray is a multiplex technology used in molecular biology. It consists of

More information

GSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet

GSI Equine IL-10 ELISA Kit- Cell Lysate DataSheet IL-10, also known as human cytokine synthesis inhibitory factor (CSIF), is an antiinflammatory cytokine that is produced by T cells, NK cells, mast cells and macrophages (1,2,3). It is capable of inhibiting

More information

HPCE-5 2. A Revolution in Capillary Electrophoresis. High Performance Capillary Electrophoresis

HPCE-5 2. A Revolution in Capillary Electrophoresis. High Performance Capillary Electrophoresis A Revolution in Capillary Electrophoresis High Performance Capillary Electrophoresis Revolutionary Performance Continuous Monitoring of Capillary and Buffer Conditions Sensitive Label-Free 512 Times Better

More information

Application Note. Authors. Abstract

Application Note. Authors. Abstract Automated, High Precision Tryptic Digestion and SISCAPA-MS Quantification of Human Plasma Proteins Using the Agilent Bravo Automated Liquid Handling Platform Application Note Authors Morteza Razavi, N.

More information

AlphaLISA SureFire Ultra

AlphaLISA SureFire Ultra AlphaLISA SureFire Ultra p-erk 1/2 (Thr202/Tyr204) Assay Kit Manual Assay Points Catalog # 500 ALSU-PERK-A500 10 000 ALSU-PERK-A10K 50 000 ALSU-PERK-A50K For Research Use Only. Not for use in Diagnostic

More information

Protein/Cytokine Array Services

Protein/Cytokine Array Services Protein/Cytokine Array Services at the Analytical Instrumentation Core Boston University, AIC, DOM, BMC, BUMC 2015 Analytical Instrumentation Core Mission: The AIC supports investigators through both cutting-edge

More information

Simplify your pathogen testing. Amplify your confidence.

Simplify your pathogen testing. Amplify your confidence. Simplify your pathogen testing. Amplify your confidence. 2 One protocol. Fewer steps. Better results. Be confident in the knowledge that your pathogen testing process is accurate and reliable with the

More information

3C bioscience. ProbeSure Genotyping Master Mix User Guide. P a g e 1 ProbeSure User Guide v1.0

3C bioscience. ProbeSure Genotyping Master Mix User Guide. P a g e 1  ProbeSure User Guide v1.0 3C bioscience r ProbeSure Genotyping Master Mix User Guide P a g e 1 www.3crbio.com ProbeSure User Guide v1.0 Content: 1. Product details 2. Description 3. Storage and shelf Life 4. Safety warnings and

More information

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit MSD 96-Well MULTI-ARRAY and MULTI-SPOT Human Cytokine Assays: Base Kit Summary MSD Cytokine Assays measure one to ten cytokines in a 96-well MULTI-ARRAY or MULTI-SPOT plate. The assays employ a sandwich

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Feature Selection of Gene Expression Data for Cancer Classification: A Review

Feature Selection of Gene Expression Data for Cancer Classification: A Review Available online at www.sciencedirect.com ScienceDirect Procedia Computer Science 50 (2015 ) 52 57 2nd International Symposium on Big Data and Cloud Computing (ISBCC 15) Feature Selection of Gene Expression

More information

Supplementary Figure 1. Utilization of publicly available antibodies in different applications.

Supplementary Figure 1. Utilization of publicly available antibodies in different applications. Supplementary Figure 1 Utilization of publicly available antibodies in different applications. The fraction of publicly available antibodies toward human protein targets is shown with data for the following

More information

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Mouse Cytokine Assays: Tissue Culture Kit

MSD 96-Well MULTI-ARRAY and MULTI-SPOT Mouse Cytokine Assays: Tissue Culture Kit MSD 96-Well MULTI-ARRAY and MULTI-SPOT Mouse Cytokine Assays: Tissue Culture Kit Summary MSD Cytokine Assays measure one to ten cytokines in a 96-well MULTI-ARRAY or MULTI-SPOT plate. The assays employ

More information

First Annual Biomarker Symposium Quest Diagnostics Clinical Trials

First Annual Biomarker Symposium Quest Diagnostics Clinical Trials First Annual Biomarker Symposium Quest Diagnostics Clinical Trials Terry Robins, Ph.D. Director Biomarker R&D and Scientific Affairs Quest Diagnostics Clinical Trials Key Considerations: Biomarker Development

More information

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT

HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT HUMAN CTGF ELISA KIT PAGE 1 HUMAN CONNECTIVE TISSUE GROWTH FACTOR (CTGF) ELISA KIT PURCHASE INFORMATION: ELISA NAME HUMAN CTGF ELISA FOR THE QUANTITATIVE DETERMINATION OF HUMAN CTGF CONCENTRATIONS IN SERUM

More information

Proteome Profiler TM 96

Proteome Profiler TM 96 Proteome Profiler TM 96 Mouse Phospho-RTK Custom Array Catalog Number ARZC03 For the parallel determination of the relative levels of tyrosine phosphorylation of mouse receptor tyrosine kinases (RTKs).

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

UNDERSTANDING GENETIC RESEARCH AND ALTERNATING HEMIPLEGIA OF CHILDHOOD. IT ALL BEGINS WITH THE AHC PATIENT And The Scientific Process

UNDERSTANDING GENETIC RESEARCH AND ALTERNATING HEMIPLEGIA OF CHILDHOOD. IT ALL BEGINS WITH THE AHC PATIENT And The Scientific Process IT ALL BEGINS WITH THE AHC PATIENT And The Scientific Process Genetic discovery AHC Patients Need Help! Researchers collect data on AHC patients (observation) Researchers interpret and evaluate data AHC

More information

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM

2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM 2D gel Western blotting using antibodies against ubiquitin, SUMO and acetyl PTM Nancy Kendrick, Jon Johansen & Matt Hoelter, Kendrick Labs Inc www.kendricklabs.com Talk Outline Significance Method description

More information

For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine.

For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. m andw da a For the quantitative detection of human IL6 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity Range (calibration

More information

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd

QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s

More information

xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL

xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL xcelligence Immunotherapy Kit - B Cell Killing Assay ASSAY MANUAL Table of Contents I. List of Kit Components 2 II. Storage Conditions 3 III. Additional Materials & Reagents Required 3 IV. Introduction

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011

DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS. September, 2011 DISCOVERY AND VALIDATION OF TARGETS AND BIOMARKERS BY MASS SPECTROMETRY-BASED PROTEOMICS September, 2011 1 CAPRION PROTEOMICS Leading proteomics-based service provider - Biomarker and target discovery

More information

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications

MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1. Lecture 25: Mass Spectrometry Applications MBios 478: Mass Spectrometry Applications [Dr. Wyrick] Slide #1 Lecture 25: Mass Spectrometry Applications Measuring Protein Abundance o ICAT o DIGE Identifying Post-Translational Modifications Protein-protein

More information

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit

Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit Product Manual Human Cancer Antigen 15-3 (CA 15-3) ELISA Kit Catalog Numbers PRB- 5069 PRB- 5069-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Breast

More information

AlphaLISA SureFire Ultra

AlphaLISA SureFire Ultra AlphaLISA SureFire Ultra p-vegf Receptor 2 (Tyr1175) Assay Kit Manual Assay Points Catalog # 500 ALSU-PVGFR-A500 10 000 ALSU-PVGFR-A10K 50 000 ALSU-PVGFR-A50K For Research Use Only. Not for use in Diagnostic

More information