Detection of the P35S promoter in transgenic maize via various isothermal amplification techniques: a practical approach
|
|
- Lucinda Hunt
- 6 years ago
- Views:
Transcription
1 Analytical and Bioanalytical Chemistry Electronic Supplementary Material Detection of the P35S promoter in transgenic maize via various isothermal amplification techniques: a practical approach C. Zahradnik, C. Kolm, R. Martzy, R.L. Mach, R. Krska, A.H. Farnleitner, K. Brunner Fig.. Alignment of the P35S promoter sequences for RoundUp Ready TM soy (EU ) and transgenic maize MON810 (JX13971). Forward outer primer (F3) and backward outer primer (B3) as published by [26] in red and as designed by the authors in green. The alignment shows that the primer set designed for RoundUp Ready TM soy cannot be used for amplification of the P35S promotor in transgenic maize, since this sequence is shorter and the F3 primer lies outside of the target sequence. Therefore, efficient amplification cannot be expected, since LAMP relies on the hybridization of all primers to the target in order to amplify the desired DNA sequence (Fig. )
2 Fig.. Amplification plot with primers and reaction conditions as previously published and performed [26, 25] for GM maize, resulting in poor amplification efficiency as well as low fluorescence intensity. n = 5 Table.. Various primer sets for NEAR, SDA and RCA were tested, including different nicking and restriction enzymes (, Nt.BspQI, HincII, BsrI). *Primer and oligo nucleotide sequences for NEAR (A1-8), SDA (-4) and RCA (C1-7) used in feasibility tests as shown in figure 1. Recognition sites of restriction enzymes are underlined. Method Primer Sequence 5' 3' NEAR* CAAAAAAAAAAAAGCGAGTCTAGCACTCCACTGACGTAAGGGATG CAAAAAAAAAAAAGCGAGTCTAGCAAAGGGTCTTGCGAAGGATAG CAAAAAAAAAAAAGCGAGTCTAGCATCTCCACTGACGTAAGGGA CAAAAAAAAAAAAGCGAGTCTAGCAGAAGGGTCTTGCGAAGGAT CAAAAAAAAAAAAGCGAGTCTAGCAC CAAAAAAAAAAAAGCGAGTCTAGCAAGGATAGTGGGATTGTGCG CGAGGAGCATCGTGGA GTCCTCTCCAAATGAAATGAAC CAAAGTCTGAGTCTGGGAC CAAAGTCTGAGTCTGGGAAGGATAGTGGGATTGTGCG CGAGGAGCATCGTGGA GTCCTCTCCAAATGAAATGAAC CAAAAAAAAAAAAGCGAGTCTAGCACTCCACTGACGTAAGGGATG
3 Nt.Bsp QI SDA_Bs ri SDA_Hi ncii SDA_Hi ncii CAAAAAAAAAAAAGCGAGTCTAGCAAAGGGTCTTGCGAAGGATAG CAAAAAAAAAAAAGCGAGTCTAGCAACGTAAGGGATGACGCA CAAAAAAAAAAAAGCGAGTCTAGCAGAGGAAGGGTCTTGCGA CAAAAAAAAAAAAGCGAGTCTAGCACCACTGACGTAAGGGATGA CAAAAAAAAAAAAGCGAGTCTAGCAGGGTCTTGCGAAGGATAGT CAAAAAAAAAAAAAAGCTCTTCTCCAACCACGTCTTC CAAAAAAAAAAAAAAGCTCTTCTGGGATTGTGCGTC CCACGAGGAGCATCG GAAGGGTCTTGCGA CCGAGACTTAGGATTCACTCTACAACCAGTGGATGACGCACAATCCCAC CCGAGACTTAGGATTCACTCTACAACCAGTAGAGGAAGGGTCTTGCGA GCCGACAGTGGTCCCAAAGAT AGCGTGTCCTCTCCAAATGAAATG CAAAAAAAAAAAAGTTGACCGTCTTCAAAGC CAAAAAAAAAAAAGTTGACTGGGATTGTGC TCGTGGAAAAAGAA GTCTTGCGAAGG CAAAAAAAAAAAGTTGACAAGGGATGACG CAAAAAAAAAAAGTTGACGAGGAAGGGTC ACCACGTCTTCA CCAAATGAAATGAAC SDA* TAGGATGAGCATTCTGCGGTTGCCAGTCGTTCCAACCACGTCTTCAAAGCAAGT TAGGATGAGCATTCTGCGGTTGCCAGTAGGAAGGGTCTTGCGAAGGATAGTGGG GCCGACAGTGGTCCCAAAGAT AGCGTGTCCTCTCCAAATGAAATG RCA* hybridization TTTTCCACTATCTTCACAATAAAGTTTTGATGCCGTATGCCTAGCACGGAATTAACTTGCTAG CCGTCCAGGTTAGCCACCTTCC Primer1 GCCGTATGCCTAGCA Primer2 TTGCTAGCCGTCCAG RCA2 hybridization GCCTCTGCCGACAGTGTTTGATGCCGTATGCCTAGCACGGAATTAACTTGCTAGCCGTCCA GGTTATCTTCAACG ATCATTGCGATAAAGGAAAGGCCATCGTTGAAGAT Primer1 GCTAGGCATACGGCATCAAA Primer2 AACTTGCTAGCCGTCCAGGTT DNA TCACTTAGGACGTAGTGAAGCAGGAAACACCTATGCC RCA3 hybridization TCTATATAAGGAAGTTCATTTCATTTTTGATGCCGTATGCCTAGCACGGAATTAACTTGCTAG CCGTCCAGGTTCCTTCCCAGAACGCACAATCCCACTATCCTTCGCAAGACCCTTCC Primer1 TGC TAG GCA TAC GGC ATC AAA Primer2 AAC TTG CTA GCC GTC CAG GTT RCA4 hybridization GAATCCGAGGAGGTTTCCGTTTGATGCCGTATGCCTAGCACGGAATTAACTTGCTAGCCGT CCAGGTTCTGGGCAATG Primer1 AAACGGAAACCTCCTCGGATTCCATT Primer2 TTGATGCCGTATGCCTAGCACGGA RCA5 hybridization TTTTCCACTATCTTCACAATAAAGTTTTGATGCCGTATGCCTAGCACGGAATTAACTTGCTAG CCGTCCAGGTTAGCCACCTTCC Primer1 GCCGTATGCCTAGCA Primer2 TTGCTAGCCGTCCAG RCA6 hybridization AGTGGAAAAGGAAGGTGGCTCTTTGATGTAGTATGCCTAGTACTGAATTAACTTGCTAGCCG
4 RCA7 Primer1 Primer2 DNA hybridization Primer1 Primer2 DNA TCCAGGTTATCTTCACATATCTGTCACTTTATTGTGAAGAT ACCTTCCTTTTCCACTATC TAGTATGCCTAGTACTGAATTAACTT TCACTTAGGACGTAGTGAAGCAGGAAACACCTATGCC ATCTTCAACGATGGCCTTTCTGAACGACGAATCTGTACCATGCTAATGCGGCGTGATGTATT ATGCGTATGACGGCAGAGGC TGCTAATGCGGCGTGATGT GGAATCCGAGTGAACGACGA TGAACGACGAATCTGTACCATGCTAATGCGGCGTGATGTATTATGCGTATGGA Table. Reaction conditions and buffer s tested for Rolling Circle Amplification, resulting in a total number of tested combinations of 3481 Ligation Denaturation step at 95 Ligation reaction time Ligases used padlock probe IDs melting temperatures Tm of padlock probe 5'arms Tm pf padlock probe 3'arms padlock probe s DNA applied to ligation reaction Exonuclease I Exonuclease III Incubation time of exonucleases Amplification Denaturation step Polymerases tested 3 min. at 95 C none 30 min. 60 min. 90 min. 120 min. 180 min. 240 min. Ampligase at T4 DNA ligase 65 C at 37 C RCA RCA2 RCA3 RCA4 RCA5 RCA6 RCA7 70 C 68.3 C 63.9 C 69.5 C 50 C 70 C 70.2 C 50 C 77.7 C 68.3 C 32.6 C 70 C 61.1 C 49.6 C 100pM 10pM 1pM 10 ng/μl 1 ng/μl 0.1 ng/μl 1 Unit 10 Units 20 Units 1 Unit 10 Units 20 Units 10 min. 30 min. 120 min. 3 min. at 95 C none Bst (65 C) phi29 Divalent cations 6 mm 4 mm 2 mm 1 mm s buffer ph Table S3. Reaction conditions and buffer s tested for Nicking Enzyme Amplification Reaction Tm of primer target 37 C 40 C 45 C 55 C 60 C 65 C Tm of primer 5 end 37 C 40 C 45 C 55 C 60 C 65 C Nicking Enzymes Temp: 37 C Temp: 55 C (recognition site) Nt.BbvCI Nb.BtsI Nt.BspQI Assay time 15 min 30 min 60 min Buffer ph Buffer 20 mm 40 mm 80 mm KCl 25 mm 50 mm 100 mm MgCl mm 5 mm 10 mm dntps 0.2 mm 0.4 mm 0.8 mm Additives Formamid (5%) Betain (1M) DMSO (5%) Et.SSB Glycerin (5%) BSA (4 ng/µl) 100 µg/µl Nicking Enzyme 2.5 units 5 units 10 units 20 units Polymerase Phi29 Bst (55-65 C) Polymerase conc. 2.5 units 5 units 10 units
5 Table S4. Reaction conditions and buffer s tested for Strand Displacement Amplification. Tm of primer target 37 C 40 C 45 C 60 C 65 C Tm of primer 5 end 37 C 40 C 45 C 60 C 65 C 70 C Restriction Enzymes Temp: Temp: 65 C (recognition site) 37 C BsrI BsmI HincII Assay time 30 min 60 min 90 min Buffer ph Buffer 20 mm 40 mm 80 mm KCl 25 mm 50 mm 100 mm MgCl mm 5 mm 10 mm Protection dntp datp S dctp S dntps 0.2 mm 0.4 mm 0.8 mm Restriction Enzyme 2.5 units 5 units 10 units 20 units Polymerase Exo - Bst Klenow (55-65 C) Polymerase conc. 2.5 units 5 units 10 units
Recombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
More informationSupplementary Information
Supplementary Information A general solution for opening double-stranded DNA for isothermal amplification Gangyi Chen, Juan Dong, Yi Yuan, Na Li, Xin Huang, Xin Cui* and Zhuo Tang* Supplementary Materials
More informationElectronic Supplementary Information Sensitive detection of polynucleotide kinase using rolling circle amplification-induced chemiluminescence
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Sensitive detection of polynucleotide kinase
More informationA netlike rolling circle nucleic acid amplification technique
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 Supplementary Information A netlike rolling circle nucleic acid amplification technique Xiaoli Zhu,
More informationSupplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC
Supplementary Appendixes Supplement 1: Sequences of Capture Probes. Capture probes were /5AmMC6/CTG TAG GTG CGG GTG GAC GTA GTC ACG TAG CTC CGG CTG GA-3 for vimentin, /5AmMC6/TCC CTC GCG CGT GGC TTC CGC
More informationEnzymatic assembly of DNA molecules up to several hundred kilobases
nature methods Enzymatic assembly of DNA molecules up to several hundred kilobases Daniel G Gibson, Lei Young, Ray-Yuan Chuang, J Craig Venter, Clyde A Hutchison III & Hamilton O Smith Supplementary figures
More informationSupporting Information. Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy
Supporting Information Trifluoroacetophenone-Linked Nucleotides and DNA for Studying of DNA-protein Interactions by 19 F NMR Spectroscopy Agata Olszewska, Radek Pohl and Michal Hocek # * Institute of Organic
More informationSupporting Online Information
Supporting Online Information Isolation of Human Genomic DNA Sequences with Expanded Nucleobase Selectivity Preeti Rathi, Sara Maurer, Grzegorz Kubik and Daniel Summerer* Department of Chemistry and Chemical
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Amplified Binding-Induced Homogeneous Assay through Catalytic
More informationSupporting Information
Supporting Information Wiley-VCH 2006 69451 Weinheim, Germany Rolling-circle Amplification of a DNA Nanojunction Chenxiang Lin, Mingyi Xie, Julian J.L. Chen, Yan Liu and Hao Yan A. RCA replication of the
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
More informationTHE MAGIC BOXES. And The Molecular Biology Behind the Marvels. April 28, 2016
THE MAGIC BOXES And The Molecular Biology Behind the Marvels April 28, 2016 Raymond P. Podzorski, ph.d., D(ABMM) Ph.d. Microbiologist St. Mary s Hospital Laboratory Wisconsin Region SSMHC Madison, WI 608-258-6393
More informationPolymerase Chain Reaction (PCR)
Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Dissecting binding of a β-barrel outer membrane
More informationAmerican Society of Cytopathology Core Curriculum in Molecular Biology
American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Alternatives to PCR, Part I
More informationIsothermal DNA Amplification
Isothermal DNA Amplification Update 2015/16 ROBUST TECHNOLOGIES FOR RAPID NUCLEIC ACID DETECTION What is isothermal DNA amplification? The Polymerase Chain Reaction (PCR) is a well-known approach for amplifying
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Product specifications 1 Product specifications The innumix Standard PCR MasterMix contains all reagents required for routine high throughput PCR amplifications
More informationstrain devoid of the aox1 gene [1]. Thus, the identification of AOX1 in the intracellular
Additional file 2 Identification of AOX1 in P. pastoris GS115 with a Mut s phenotype Results and Discussion The HBsAg producing strain was originally identified as a Mut s (methanol utilization slow) strain
More informationUniversal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Supporting materials Universal Split Spinach Aptamer (USSA) for Nucleic Acid Analysis and DNA Computation
More informationA high efficient electrochemiluminescence resonance energy. transfer system in one nanostructure: its application for
Supporting Information for A high efficient electrochemiluminescence resonance energy transfer system in one nanostructure: its application for ultrasensitive detection of microrna in cancer cells Zhaoyang
More informationElectronic Supplementary Information
Electronic Supplementary Information One-step ultrasensitive detection of microrns with loop-mediated isothermal amplification (LMP) Cuiping Li, a Zhengping Li,* a Hongxia Jia a and Jingli Yan a a Key
More informationDNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents
DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment
More informationGuidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature
Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons
More informationDNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli
Supplementary Information DNA supercoiling, a critical signal regulating the basal expression of the lac operon in Escherichia coli Geraldine Fulcrand 1,2, Samantha Dages 1,2, Xiaoduo Zhi 1,2, Prem Chapagain
More informationAmplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires
Supporting information for the paper: Amplified Analysis of DNA by the Autonomous Assembly of Polymers Consisting of DNAzyme Wires Fuan Wang, Johann Elbaz, Ron Orbach, Nimrod Magen and Itamar Willner*
More informationEngineering D66N mutant using quick change site directed mutagenesis. Harkewal Singh 09/01/2010
Engineering D66N mutant using quick change site directed mutagenesis Harkewal Singh 09/01/2010 1 1- What is quick change site directed mutagenesis? 2- An overview of the kit contents. 3- A brief information
More informationAmplification and Labeling of DNA for Microarray Hybridization, using the Round A/B/C Random DNA Amplification Protocol
Amplification and Labeling of DNA for Microarray Hybridization, using the Round A/B/C Random DNA Amplification Protocol Goal: To amplify and label DNA prior to hybridization to a microarray, in a relatively
More informationApplication of DNA machine in amplified DNA detection
Electronic Supplementary Information Application of DNA machine in amplified DNA detection Hailong Li, Jiangtao Ren, Yaqing Liu,* and Erkang Wang* State Key Lab of Electroanalytical Chemistry, Changchun
More informationAdd 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH).
Bisulfite Treatment of DNA Dilute DNA sample to 2µg DNA in 50µl ddh 2 O. Add 5µl of 3N NaOH to DNA sample (final concentration 0.3N NaOH). Incubate in a 37ºC water bath for 30 minutes. To 55µl samples
More informationCat. # R006A. For Research Use. TaKaRa Z-Taq DNA Polymerase. Product Manual. v201411da
Cat. # R006A For Research Use TaKaRa Z-Taq DNA Polymerase Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Specifications... 3 IV. Optimization of Reaction Conditions... 4
More informationTable of Contents. Description Kit Components Reagents not supplied in the kit Equipment required Storage...
Table of Contents Description... 2 Kit Components... 2 Reagents not supplied in the kit... 2 Equipment required... 2 Storage... 2 References... 2 Principle... 3 Protocol... 4 Identification of HPV types...
More informationElectronic Supplementary Information
Electronic Supplementary Information Ultrasensitive and Selective DNA Detection Based on Nicking Endonuclease Assisted Signal Amplification and Its Application in Cancer Cells Detection Sai Bi, Jilei Zhang,
More informationCircLigase ssdna Ligase
Cat. Nos. CL4111K and CL4115K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 222 10/2012 1 EPILIT222
More informationPolymerase Chain Reaction (PCR)
Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an
More informationQuiz Submissions Quiz 4
Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present
More informationCircular bivalent aptamers enable in vivo stability and recognition
Supporting Information Circular bivalent aptamers enable in vivo stability and recognition Hailan Kuai,, Zilong Zhao,, Liuting Mo, Hui Liu, Xiaoxiao Hu, Ting Fu, Xiaobing Zhang, Weihong Tan*,, Molecular
More informationSupplemental Data Supplemental Figure 1.
Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)
More informationIntroduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
More informationInstructions for Use Life Science Kits & Assays
Instructions for Use Life Science Kits & Assays Content Content 1 Product and order number... I 2 Storage conditions... I 3 Description... II 3.1 Quality data... II 3.2 Unit definition... II 4 Delivered
More informationCGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS
5 CGTAAGAGTACGTCCAGCATCGGF ATCATTATCTACATCXXXXXTACCATTCATTCAGATCTCACTATCGCATTCTCATGCAGGTCGTAGCCXS 29 Supplementary Figure 1 Sequence of the DNA primer/template pair used in Figure 1bc. A 23nt primer is
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationqpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Label-Free and Ultrasensitive Detection of Polynucleotide
More informationKAPA HiFi HotStart Uracil+ ReadyMix PCR Kit
ReadyMix PCR Kit KR043 v4.7 Product Description KAPA HiFi HotStart is a novel B-family DNA polymerase, engineered to have increased affinity for DNA, without the need for accessory proteins or DNA-binding
More informationLigation-Independent Mechanism of Multiplex Ligation-Dependent Probe Amplification
ANALYTICAL SCIENCES AUGUST 2014, VOL. 30 805 2014 The Japan Society for Analytical Chemistry Ligation-Independent Mechanism of Multiplex Ligation-Dependent Probe Amplification Naoki UNO and Katsunori YANAGIHARA
More informationSupplementary Information. Construction of Lasso Peptide Fusion Proteins
Supplementary Information Construction of Lasso Peptide Fusion Proteins Chuhan Zong 1, Mikhail O. Maksimov 2, A. James Link 2,3 * Departments of 1 Chemistry, 2 Chemical and Biological Engineering, and
More informationFigure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis
1 2 3 4 5 6 7 8 9 10 11 12 Figure S1. Characterization of the irx9l-1 mutant. (A) Diagram of the Arabidopsis IRX9L gene drawn based on information from TAIR (the Arabidopsis Information Research). Exons
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationGenetics and Genomics in Medicine Chapter 3. Questions & Answers
Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Simultaneous Elimination of Carryover Contamination and Detection of DNA
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationFundamentals of Real Time PCR
Fundamentals of Real Time PCR Mohamed Abdel Fattah Senior Technical Specialist Scientific Support - Molecular Biology Dept. AnalysisAB Co. Mobile: 012 27 906 74 E-mail: analysis@analysis-ab.com What is
More informationLabel-Free Homogeneous Electroanalytical Platform for Pesticide. Detection Based on Acetylcholinesterase-Mediated DNA
Supporting Information Label-Free Homogeneous Electroanalytical Platform for Pesticide Detection Based on Acetylcholinesterase-Mediated DNA Conformational Switch Integrated with Rolling Circle Amplification
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationDNA Hybridization and Detection
Chapter 6 DNA Hybridization and Detection Fluorescence Polarization Detection of DNA Hybridization........................................................ 6-2 Introduction.............................................................................................................
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Supporting Information for Expanding the Genetic
More informationPremix Ex Taq (Probe qpcr)
For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.
More informationProtocol T45 Community Reference Laboratory for GM Food and Feed
EUROPEAN COMMISSION DIRECTORATE GENERAL JRC JOINT RESEARCH CENTRE INSTITUTE FOR HEALTH AND CONSUMER PROTECTION COMMUNITY REFERENCE LABORATORY FOR GM FOOD AND FEED Event-specific Method for the Quantification
More informationRestorase DNA Polymerase with 10 Reaction Buffer. Catalog Number R1028 Storage Temperature 20 C TECHNICAL BULLETIN
Restorase DNA Polymerase with 10 Reaction Buffer Catalog Number R1028 Storage Temperature 20 C TECHNICAL BULLETIN Product Description Restorase DNA Polymerase with 10 Reaction Buffer combines Sigma s Long
More informationA green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ
Electronic Supplementary Material A green method of staining DNA in polyacrylamide gel electrophoresis based on fluorescent copper nanoclusters synthesized in situ Xiaoli Zhu 1, Hai Shi 1, Yalan Shen 1,
More informationProcedure & Checklist - Preparing Asymmetric SMRTbell Templates
Procedure & Checklist - Preparing Asymmetric SMRTbell Templates Before You Begin In this procedure, PCR products are generated using two rounds of amplification. The first round uses target specific primers
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationSequence Design for DNA Computing
Sequence Design for DNA Computing 2004. 10. 16 Advanced AI Soo-Yong Shin and Byoung-Tak Zhang Biointelligence Laboratory DNA Hydrogen bonds Hybridization Watson-Crick Complement A single-stranded DNA molecule
More informationElectronic Supplementary Information
Electronic Supplementary Information Highly sensitive detection of telomerase using telomeres-triggered isothermal exponential amplificationbased DNAzyme biosensor Yan Zhang, Li-juan Wang, and Chun-yang
More informationConflicts of Interest. Rapid Cycle PCR (20 60 second cycles) How long does it take to. 10/16/2014
Extreme PCR Efficient Amplification in Less Than One Minute Carl Wittwer, MD, PhD, Department of Pathology, University of Utah Conflicts of Interest BioFire/Idaho Technology CoFounder and Chairman Royalties,
More informationMgCl 2 (25 mm) 1.6 ml 1.6 ml 1.6 ml 1.6 ml
Technical Data Sheet KAPA2G Fast PCR Kit Kit components KK 5008 Product codes KK 5010 KK 5009 KK 5011 KAPA2G Fast DNA polymerase (5 U/μl) 100 U 100 U 250 U 250 U 1. Production Description The KAPA2G Fast
More informationWet Lab Tutorial: Genelet Circuits
Wet Lab Tutorial: Genelet Circuits DNA 17 This tutorial will introduce the in vitro transcriptional circuits toolkit. The tutorial will focus on the design, synthesis, and experimental testing of a synthetic
More informationCircLigase II ssdna Ligase
Cat. Nos. CL9021K and CL9025K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 298 12/2012 1 EPILIT298
More informationSYBR Premix Ex Taq (Tli RNaseH Plus)
Cat. # RR420A For Research Use SYBR Premix Ex Taq (Tli RNaseH Plus) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Kit Components... 4 IV. Materials Required but not Provided...
More informationBiotechnology. Explorer Program. Serious About Science Education 5/17/09 1
Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA
More informationMethods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
More informationCat. # For Research Use. BcaBEST Labeling Kit. Product Manual. v201701da
Cat. # 6046 For Research Use BcaBEST Labeling Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Principles... 4 V. Protocol... 5 VI. Effect of Template
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationIntroduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
More informationAlizarin Red S for Online Pyrophosphate Detection Identified by a Rapid Screening Method
Supporting Information Alizarin Red S for Online Pyrophosphate Detection Identified by a Rapid Screening Method Jens Fischbach, Qiuting Loh, Frank F. Bier, Theam Soon Lim, Marcus Frohme, Jörn Glökler Table
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationSYBR Advantage qpcr Premix User Manual
SYBR Advantage qpcr Premix User Manual Cat. No. 639676 PT3883- (PR65850) Published 3 May 006 Table of Contents I. I ntroduction 4 II. List of Components 6 III. Additional Materials Required 6 IV. General
More information1. COMPONENTS. PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) 2. STORAGE 3. DESCRIPTION
1 2 1 PyroStart Fast PCR Master Mix (2X) (#K0211 for 250 reactions of 20µl) TABLE OF CONTENTS 1. COMPONENTS... 2 2. STORAGE... 2 3. DESCRIPTION... 2 4. PROTOCOL FOR FAST PCR... 3 4.1. General Considerations...
More informationApplication Note Detecting low copy numbers. Introduction. Methods A08-005B
Application Note Detecting low copy numbers A08-005B Introduction Sensitivity of a qpcr assay is highly dependent on primer efficiency. Not all assays will be capable of detecting a single copy of template
More informationLaboratory #7 PCR PCR
1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual KOD -Plus- 1207 F0934K KOD -Plus- Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2.
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationNucleic Acid Amplification
Nucleic Acid Amplification Chapter 7 Objectives Describe the principle of amplification by polymerase chain reaction (PCR). Discuss how products are detected. Describe examples of modifications that have
More informationSYBR Premix DimerEraser (Perfect Real Time)
Cat. # RR091A or Research Use SYBR Premix DimerEraser (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Principle... 3 III. Components... 4 IV. Storage... 5 V. eatures... 5 VI.
More informationMolekulargenetische Reagenzien. Raumtemperaturstabile PCR und qpcr Reagenzien
Molekulargenetische Reagenzien Raumtemperaturstabile PCR und qpcr Reagenzien Polypeptide Stabilization Technology: Stability TAG Ice-free reaction set-up Our temperature stable enzymes allow you to change
More informationUSB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
More informationSupplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR
Supplemental Dataset Supplemental Table 1. Mutant ADAMTS3 alleles detected in HEK293T clone 4C2. DNA sequence Amino acid sequence WT CCTGTCACTTTGGTTGATAGC MVLLSLWLIAAALVEVR Allele 1 CCTGTC------------------GATAGC
More informationKAPA Library Preparation Kits
Technical Data Sheet KAPA Library Preparation Kits Illumina series Product Description The KAPA Library Preparation Kit provides all of the enzymes and reaction buffers required for constructing libraries
More informationMicroarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays Aminoallyl Method AfCS Procedure Protocol PP Version 1, 10/20/03
Microarray Protocol for Agilent Inkjet-Deposited Presynthesized Oligo Arrays AfCS Procedure Protocol PP00000184 Version 1, 10/20/03 The following procedure details the preparation of fluorescently labeled
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSession 3 Cloning Overview & Polymerase Chain Reaction
Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful
More informationSYBR Advantage qpcr Premix. User Manual
User Manual SYBR Advantage qpcr Premix User Manual United States/Canada 800.66.566 Asia Pacific +.650.99.7300 Europe +33.(0).3904.6880 Japan +8.(0)77.543.66 Clontech Laboratories, Inc. A Takara Bio Company
More informationTable of content. 1. Description Component Specification Optimization of parameters Extension time...
Table of content 1. Description... 2 2. Component... 2 3. Specification... 2 4. Optimization of parameters... 3 4-1. Extension time... 3 4-2. Enzyme concentration... 3 4-3. Template DNA... 3 4-4. Primer...
More informationThermophylic Polymerases
THOUSANDS OF REAGENTS ONE MARKETPLACE Thermophylic Polymerases A Users Guide Traditional Enzymes & Engineered Variants Polymerase Pedigree Polymerase Selection Guide Convenience versus Flexibility Taq
More informationSupplemental Data. mir156-regulated SPL Transcription. Factors Define an Endogenous Flowering. Pathway in Arabidopsis thaliana
Cell, Volume 138 Supplemental Data mir156-regulated SPL Transcription Factors Define an Endogenous Flowering Pathway in Arabidopsis thaliana Jia-Wei Wang, Benjamin Czech, and Detlef Weigel Table S1. Interaction
More informationMagnetic nanobeads present during enzymatic amplification and labeling for a simplified DNA detection protocol based on AC susceptometry
Magnetic nanobeads present during enzymatic amplification and labeling for a simplified DNA detection protocol based on AC susceptometry Rebecca S. Bejhed, Maria Strømme, Peter Svedlindh, Annika Ahlford,
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More information