Genes and How They Work. Chapter 15

Transcription

1 Genes and How They Work Chapter 15 1

2 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria is inherited via a recessive allele Proposed that patients with the disease lacked a particular enzyme These ideas connected genes to enzymes 2

3 Beadle and Tatum 1941 Deliberately set out to create mutations in chromosomes and verify that they behaved in a Mendelian fashion in crosses Studied Neurospora crassa Used X-rays to damage DNA Looked for nutritional mutations Had to have minimal media supplemented to grow 3

4 Beadle and Tatum looked for fungal cells lacking specific enzymes The enzymes were required for the biochemical pathway producing the amino acid arginine They identified mutants deficient in each enzyme of the pathway One-gene/one-enzyme hypothesis has been modified to one-gene/one-polypeptide hypothesis 4

5 Experimental Procedure Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. No growth on minimal medium Results Wild-type Neurospora crassa Mutagenize with X-rays Grow on rich medium arg mutants Growth on minimal medium plus arginine Mutation in Enzyme E Plus Ornithine Plus Citruline Plus Arginosuccinate Plus Arginine F Conclusion Glutamate Ornithine Citruline Arginosuccinate Arginine G Enzymes encoded by arg genes E F G H H arg genes arg E arg F arg G arg H 5

6 Central Dogma First described by Francis Crick Information only flows from DNA RNA protein Transcription = DNA RNA Translation = RNA protein Retroviruses violate this order using reverse transcriptase to convert their RNA genome into DNA 6

7 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Prokaryotes Eukaryotes 5 DNA template strand 3 Transcription mrna 3 Translation 5 Protein 7

8 Transcription DNA-directed synthesis of RNA Only template strand of DNA used U (uracil) in DNA replaced by T (thymine) in RNA mrna used to direct synthesis of polypeptides Translation Synthesis of polypeptides Takes place at ribosome Requires several kinds of RNA 8

9 RNA All synthesized from DNA template by transcription Messenger RNA (mrna) Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear RNA (snrna) Signal recognition particle RNA (SRP RNA) Micro-RNA (mirna) 9

10 Genetic Code Francis Crick and Sydney Brenner determined how the order of nucleotides in DNA encoded amino acid order Codon block of 3 DNA nucleotides corresponding to an amino acid Introduced single nulcleotide insertions or deletions and looked for mutations Frameshift mutations Indicates importance of reading frame 10

11 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. One Bases Deleted Met Pro Thr His Arg Asp Ala Ser Amino acids AUGCCUACGCACCGCGACGCAUCA Delete one bases AUGCCUAGCACCGCGACGCAUCA Met Pro Ser Thr Ala Thr His All amino acids changed after deletion Three Bases Deleted Met Pro Thr His Arg Asp Ala Ser Amino acids AUGCCUACGCACCGCGACGCAUCA Delete three bases AUGCCUCACCGCGACGCAUCA Met Pro His Arg Asp Ala Ser Amino acids do not change after third deletion 11

12 Spaced or unspaced codons Spaced Codon sequence in a gene punctuated Unspaced codons adjacent to each other 12

13 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. SCIENTIFIC THINKING Sentence with Spaces WHY DID THE RED BAT EAT THE FAT RAT Delete one letter WHY DID HE RED BAT EAT THE FAT RAT Only one word changed Sentence with No Spaces WHYDIDTHEREDBATEATTHEFATRAT Delete one letter WHYDIDHEREDBATEATTHEFATRAT All words after deletion changed 13

14 Marshall Nirenberg identified the codons that specify each amino acid Stop codons 3 codons (UUA, UGA, UAG) used to terminate translation Start codon Codon (AUG) used to signify the start of translation Code is degenerate, meaning that some amino acids are specified by more than one codon 14

15 15

16 Code practically universal Strongest evidence that all living things share common ancestry Advances in genetic engineering Mitochondria and chloroplasts have some differences in stop signals 16

17 Prokaryotic transcription Single RNA polymerase Initiation of mrna synthesis does not require a primer Requires Promoter Start site Transcription unit Termination site 17

18 Promoter Forms a recognition and binding site for the RNA polymerase Found upstream of the start site Not transcribed Asymmetrical indicate site of initiation and direction of transcription 18

19 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Prokaryotic RNA polymerase a. 19

20 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Template strand Coding strand TATAAT Promoter ( 10 sequence) 5 Downstream 3 Start site (+1) TTGACA Promoter ( 35 sequence) Prokaryotic RNA polymerase 5 3 Upstream a. b. 20

21 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Coding strand Template strand TATAAT Promoter ( 10 sequence) 5 Downstream 3 Start site (+1) binds to DNA 5 3 TTGACA Promoter ( 35 sequence) Helix opens at 10 sequence a. Prokaryotic RNA polymerase 5 3 b. Upstream

22 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Coding strand Template strand TATAAT Promoter ( 10 sequence) 5 Downstream 3 Start site (+1) TTGACA Promoter ( 35 sequence) Prokaryotic RNA polymerase 5 3 Upstream a. b. binds to DNA RNA polymerase bound to unwound DNA Transcription Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. bubble 5 3 dissociates Helix opens at 10 sequence Start site RNA synthesis begins ATP

23 Elongation Grows in the 5 -to-3 direction as ribonucleotides are added Transcription bubble contains RNA polymerase, DNA template, and growing RNA transcript After the transcription bubble passes, the now-transcribed DNA is rewound as it leaves the bubble 23

24 RNA polymerase Start site Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA Codingstrand Unwinding Rewinding 3' 5 3' 5 Downstream 3' Upstream mrna 5 Template strand Transcription bubble 24

25 Termination Marked by sequence that signals stop to polymerase Causes the formation of phosphodiester bonds to cease RNA DNA hybrid within the transcription bubble dissociates RNA polymerase releases the DNA DNA rewinds Hairpin 25

26 RNA polymerase Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA and RNA Polymerase dissociates DNA mrna dissociates from DNA 3' 5 5 3' Four or more U ribonucleotides mrna hairpin causes RNA polymerase to pause 5 Cytosine Guanine Adenine Uracil 26

27 Prokaryotic transcription is coupled to translation mrna begins to be translated before transcription is finished Operon Grouping of functionally related genes Multiple enzymes for a pathway Can be regulated together 27

28 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display µm RNA polymerase DNA mrna Ribosomes Polyribosome Polypeptide chains 28 Dr. Oscar Miller

29 Eukaryotic Transcription 3 different RNA polymerases RNA polymerase I transcribes rrna RNA polymerase II transcribes mrna and some snrna RNA polymerase III transcribes trna and some other small RNAs Each RNA polymerase recognizes its own promoter 29

30 Initiation of transcription Requires a series of transcription factors Necessary to get the RNA polymerase II enzyme to a promoter and to initiate gene expression Interact with RNA polymerase to form initiation complex at promoter Termination Termination sites not as well defined 30

31 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Other transcription factors Transcription factor Eukaryotic DNA TATA box 1. A transcription factor recognizes and binds to the TATA box sequence, which is part of the core promoter. 31

32 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Other transcription factors RNA polymerase II Transcription factor Eukaryotic DN A TATA box 1. A transcription factor recognizes and binds to the TATA box sequence, which is part of the core promoter. 2. Other transcription factors are recruited, and the initiation complex begins to build. 32

33 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Other transcription factors RNA polymerase II Transcription factor Eukaryotic DNA TATA box 1. A transcription factor recognizes and binds to the TATA box sequence, which is part of the core promoter. 2. Other transcription factors are recruited, and the initiation complex begins to build. Initiation complex 3. Ultimately, RNA polymerase II associates with the transcription factors and the DNA, forming the initiation complex, and transcription begins. 33

34 mrna modifications In eukaryotes, the primary transcript must be modified to become mature mrna Addition of a 5 cap Protects from degradation; involved in translation initiation Addition of a 3 poly-a tail Created by poly-a polymerase; protection from degradation Removal of non-coding sequences (introns) Pre-mRNA splicing done by spliceosome 34

35 5 cap Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. HO OH CH 2 P P P N + CH 3 + Methyl group 3 P P P mrna 5 CH 3 35

36 Eukaryotic pre-mrna splicing Introns non-coding sequences Exons sequences that will be translated Small ribonucleoprotein particles (snrnps) recognize the intron exon boundaries snrnps cluster with other proteins to form spliceosome Responsible for removing introns 36

37 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. E1 I1 E2 I2 E3 I3 E4 I4 cap 5 DNA template Transcription Exons Introns poly-a tail 33 Primary RNA transcript Introns are removed poly-a tail 3 cap 5 a. Mature mrna 37

38 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. E1 I1 E2 I2 E3 I3 E4 I4 5' cap DNA template Transcription Exons Introns 3' poly-a tail Primary RNA transcript Introns are removed 5' cap 3' poly-a tail a. Mature mrna 1 Intron b. c. mrna DNA 5 6 Exon b: Courtesy of Dr. Bert O Malley, Baylor College of Medicine 7 38

39 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron A Exon Branch point A 1. snrna forms base-pairs with 5 end of intron, and at branch site. 39

40 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 5 Intron Branch point A A Exon snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome snrnps associate with other factors to form spliceosome. 40

41 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron A Exon 2 5 Branch point A 3 1. snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome snrnps associate with other factors to form spliceosome. Lariat A end of intron is removed and forms bond at branch site, forming a lariat. The 3 end of the intron is then cut. 41

42 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron Exon 2 A 5 3 Branch point A 1. snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome snrnps associate with other factors to form spliceosome. Lariat A end of intron is removed and forms bond at branch site, forming a lariat. The 3 end of the intron is then cut. 5 Exon 1 Exon 2 Mature mrna 3 Excised intron 4. Exons are joined; spliceosome disassembles. 42

43 Alternative splicing Single primary transcript can be spliced into different mrnas by the inclusion of different sets of exons 15% of known human genetic disorders are due to altered splicing 35 to 59% of human genes exhibit some form of alternative splicing Explains how 25,000 genes of the human genome can encode the more than 80,000 different mrnas 43

44 trna and Ribosomes trna molecules carry amino acids to the ribosome for incorporation into a polypeptide Aminoacyl-tRNA synthetases add amino acids to the acceptor stem of trna Anticodon loop contains 3 nucleotides complementary to mrna codons 44

45 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 2D Cloverleaf Model Acceptor end 3 5 3D Ribbon-like Model Acceptor end Anticodon loop Anticodon loop 3D Space-filled Model Acceptor end Icon Acceptor end Anticodon loop Anticodon end c: Created by John Beaver using ProteinWorkshop, a product of the RCSB PDB, and built using the Molecular Biology Toolkit developed by John Moreland and Apostol Gramada (mbt.sdsc.edu). The MBT is financed by grant GM

46 trna charging reaction Each aminoacyl-trna synthetase recognizes only 1 amino acid but several trnas Charged trna has an amino acid added using the energy from ATP Can undergo peptide bond formation without additional energy Ribosomes do not verify amino acid attached to trna 46

47 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Amino group NH 3 + Trp Carboxyl group C O trna site P i ATP P i O Amino acid site Accepting site OH trna Aminoacyl-tRNA synthetase Anticodon specific to tryptophan 1. In the first step of the reaction, the amino acid is activated. The amino acid reacts with ATP to produce an intermediate with the carboxyl end of the amino acid attached to AMP. The two terminal phosphates (pyrophosphates) are cleaved from ATP in this reaction. 47

48 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. trna site Amino group NH 3 + P i ATP P i Trp Carboxyl group C O O Amino acid site Aminoacyl-tRNA synthetase 48

49 Amino group NH 3 + Trp Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Carboxyl group C O trna site P i ATP P i O Amino acid site Accepting site OH trna Aminoacyl-tRNA synthetase Anticodon specific to tryptophan 49

50 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Amino group Carboxyl group Charged trna travels to ribosome NH 3 + P i ATP P i Trp C O O Amino acid site Accepting site OH NH 3 + Trp C O O trna site trna Aminoacyl-tRNA synthetase Anticodon specific to tryptophan Charged trna dissociates 1. In the first step of the reaction, the amino acid is activated. The amino acid reacts with ATP to produce an intermediate with the carboxyl end of the amino acid attached to AMP. The two terminal phosphates (pyrophosphates) are cleaved from ATP in this reaction. 2. The amino acid-amp complex remains bound to the enzyme. The trna next binds to the enzyme. 3. The second step of there action transfers the amino acid from AMP to the trna, Producing a charged trna and AMP. The charged trna consists of a specific amino acid attached to the 3 accept or stem of it srna. 50

51 The ribosome has multiple trna binding sites P site binds the trna attached to the growing peptide chain A site binds the trna carrying the next amino acid E site binds the trna that carried the last amino acid 51

52 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Large subunit 3 90 Small subunit Large subunit 0 Large subunit Small subunit mrna Small subunit 5 52

53 The ribosome has two primary functions Decode the mrna Form peptide bonds Peptidyl transferase Enzymatic component of the ribosome Forms peptide bonds between amino acids 53

54 Translation In prokaryotes, initiation complex includes Initiator trna charged with N-formylmethionine Small ribosomal subunit mrna strand Ribosome binding sequence (RBS) of mrna positions small subunit correctly Large subunit now added Initiator trna bound to P site with A site empty 54

55 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. fmet 3 U A C 5 AUG mrna Initiation factor Initiation factor 3 Small subunit 5 GTP GDP + P i Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Large subunit U A A U C G E site trna in P site A site 3 3 GTP GDP P i Initiation complex Complete ribosome 55

56 Initiations in eukaryotes similar except Initiating amino acid is methionine More complicated initiation complex Lack of an RBS small subunit binds to 5 cap of mrna 56

57 Elongation adds amino acids 2 nd charged trna can bind to empty A site Requires elongation factor called EF-Tu to bind to trna and GTP Peptide bond can then form Addition of successive amino acids occurs as a cycle 57

58 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Amino acid 1 NH 3 + NH 3 + Amino acid 2 Polypeptide chain NH 3 + N Amino group Amino acid 1 Peptide bond Amino acid 2 Amino end (N terminus) NH 3 + Amino acid 1 Amino acid 2 Amino acid 3 3 O O Peptide bond formation Empty trna OH O Amino acid 4 Amino acid 5 Amino acid 6 5 Amino acid 7 COO A site P site Carboxyl end (C terminus) 58

59 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 3 GDP + P i Elongation factor E P A GTP Elongation factor E P A E P A 5 Sectioned ribosome 5 Next round GTP Elongation factor Ejected trna Growing polypeptide GTP GDP Elongation factor + P i E P A E P A 5 59

60 There are fewer trnas than codons Wobble pairing allows less stringent pairing between the 3 base of the codon and the 5 base of the anticodon This allows fewer trnas to accommodate all codons 60

61 Termination Elongation continues until the ribosome encounters a stop codon Stop codons are recognized by release factors which release the polypeptide from the ribosome 61

62 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Polypeptide chain releases Dissociation Release factor Sectioned ribosome E P A 62

63 Protein targeting In eukaryotes, translation may occur in the cytoplasm or the rough endoplasmic reticulum (RER) Signal sequences at the beginning of the polypeptide sequence bind to the signal recognition particle (SRP) The signal sequence and SRP are recognized by RER receptor proteins Docking holds ribosome to RER Beginning of the protein-trafficking pathway 63

64 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Rough endoplasmic reticulum (RER) Cytoplasm Lumen of the RER Protein channel Signal recognition particle (SRP) SRP binds to signal peptide, arresting elongation Docking NH 2 Polypeptide elongation continues Signal Exit tunnel Ribosome synthesizing peptide 64

65 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II RNA polymerase II 3 5 Primary RNA transcript 65

66 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 66

67 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap Large subunit mrna Small subunit Cytoplasm 67

68 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap mrna Small subunit Large subunit Cytoplasm Cytoplasm Amino acids trna arrivesin A site 3 mrna 5 A site P site E site 4. The ribosome cycle begins with the growing peptide attached to the trna in the P site. The next charged trna binds to the A site with its anticodon complementary to the codon in the mrna in this site. 68

69 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap mrna Small subunit Large subunit Cytoplasm Amino acids trna arrivesin A site Cytoplasm Lengthening polypeptide chain 3 mrna Emptyt RNA 3 5 A site P site E site 5 4. The ribosome cycle begins with the growing peptide attached to the trna in the P site. The next charged trna binds to the A site with its anticodon complementary to the codon in the mrna in this site. 5. Peptide bonds form between the amino terminus of the next amino acid and the carboxyl terminus of the growing peptide. This transfers the growing peptide to the trna in the A site, leaving the trna in the P site empty. 69

70 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap mrna Small subunit Large subunit Cytoplasm Amino acids trna arrivesin A site Cytoplasm Lengthening polypeptide chain Empty trna moves into E site and is ejected 3 Emptyt RNA 3 3 mrna 5 A site P site E site The ribosome cycle begins with the growing peptide attached to the trna in the P site. The next charged trna binds to the A site with its anticodon complementary to the codon in the mrna in this site. 5. Peptide bonds form between the amino terminus of the next amino acid and the carboxyl terminus of the growing peptide. This transfers the growing peptide to the trna in the A site, leaving the trna in the P site empty. 6. Ribosome translocation moves the ribosome relative to the mrna and its bound trnas. This moves the growing chain into the P site, leaving the empty trna in the E site and the A site ready to bind the next charged trna. 70

71 71

72 72

73 Mutation: Altered Genes Point mutations alter a single base Base substitution substitute one base for another Silent mutation same amino acid inserted Missense mutation changes amino acid inserted Transitions Transversions Nonsense mutations changed to stop codon 73

74 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. C G A T A T Coding Template mrna 5 ATGCCTTATCGCTGA 3 3 TACGGAATAGCGACT 5 5 AUGCCUUAUCGCUGA 3 Protein Met Pro Thr Arg Stop a. Silent Mutation C G Coding Template mrna 5 ATGCCCTATCGCTGA 3 3 TACGGGATAGCGACT 5 5 AUGCCCUAUCGCUGA 3 Protein Met Pro Thr Arg Stop b. 74

75 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Missense Mutation A T Coding Template mrna 5 ATGCCCTATCACTGA 3 3 TACGGGATAGTGACT 5 5 AUGCCCUAUCACUGA 3 Protein Met Pro Thr His Stop c. Nonsense Mutation A T Coding Template mrna 5 ATGCCCTAACGCTGA 3 3 TACGGGATTGCGACT 5 5 AUGCCCUAACGCUGA 3 Protein Met Pro Stop d. 75

76 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Normal HBB Sequence Polar Leu Thr Pro Glu Glu C T G A C T C C T G A G A A G A Lys A G T Ser C T Amino acids Nucleotides Normal Deoxygenated Tetramer Abnormal Deoxygenated Tetramer Abormal HBB Sequence Nonpolar (hydrophobic) Hemoglobin tetramer "Sticky" nonpolar sites Leu Thr Pro val Glu Lys Ser Amino acids C T G A C T C C T G T G G A G A A G T C T Nucleotides Tetramers form long chains when deoxygenated. This distorts the normal red blood cell shape into a sickle shape. 76

77 Frameshift mutations Addition or deletion of a single base Much more profound consequences Alter reading frame downstream Triplet repeat expansion mutation Huntington disease Repeat unit is expanded in the disease allele relative to the normal 77

78 Chromosomal mutations Change the structure of a chromosome Deletions part of chromosome is lost Duplication part of chromosome is copied Inversion part of chromosome in reverse order Translocation part of chromosome is moved to a new location 78

79 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Deleted Deletion A B C D E F G H I J A E F G H I J a. Duplication Duplicated A B C D E F G H I J A B C D B C D E F G H I J b. 79

80 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Inversion Inverted A B C D E F G H I J A D C B E F G H I J c. Reciprocal Translocation A B C D E F G H I J K L M D E F G H I J K L M N O P Q R A B C N O P Q R d. 80

81 Mutations are the starting point for evolution Too much change, however, is harmful to the individual with a greatly altered genome Balance must exist between amount of new variation and health of species 81