Genes and How They Work. Chapter 15

Size: px

Start display at page:

Download "Genes and How They Work. Chapter 15"

Rolf O’Neal’
6 years ago
Views:

1 Genes and How They Work Chapter 15 1

2 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria (black urine disease) is inherited via a recessive allele Proposed that patients with the disease lacked a functional enzyme for tyrosine degradation pathway X These ideas connected genes to enzymes 2

Had to have minimal media supplemented to grow Neurospora crassa Big Question: What information does DNA encode?

3 The Nature of Genes Beadle and Tatum (1941): Deliberately set out to create mutations in chromosomes and verify that they behaved in a Mendelian fashion in crosses Studied Neurospora crassa Used X-rays to damage DNA Looked for nutritional mutations Had to have minimal media supplemented to grow Neurospora crassa Big Question: What information does DNA encode? -OR- What happens if you damage the DNA code? 3 Image:

The Nature of Genes Beadle and Tatum looked for fungal cells lacking specific enzymes The enzymes were required for the biochemical pathway producing the amino

4 The Nature of Genes Beadle and Tatum looked for fungal cells lacking specific enzymes The enzymes were required for the biochemical pathway producing the amino acid arginine They identified mutants deficient in each enzyme of the pathway One-gene/one-enzyme hypothesis has been modified to one-gene/one-polypeptide hypothesis 4

5 The Nature of Genes Beadle and Tatum Experiment Step One: Create mutants of Neurospora using X-rays Look for mutants that cannot synthesize (make) arginine on their own, have to be given arginine in their media Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

The Nature of Genes Beadle and Tatum Experiment Step Two: Analyze Results Determine why mutation prevents the synthesis of Arginine Different enzyme mutations (1 st column) lead to

6 The Nature of Genes Beadle and Tatum Experiment Step Two: Analyze Results Determine why mutation prevents the synthesis of Arginine Different enzyme mutations (1 st column) lead to different growth Note: it takes several steps to make arginine (part of a metabolic pathway) Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

7 The Nature of Genes Beadle and Tatum Experiment Conclusions Each mutated enzyme disrupted one key enzyme in the metabolic pathway Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

8 The Nature of Genes The Central Dogma: DNA RNA protein First described by Francis Crick Information only flows from Eukaryotes Prokaryotes Transcription 5 DNA template strand mrna DNA RNA protein Transcription: DNA RNA Translation: RNA protein 5 Translation Protein 8

9 The Nature of Genes DNA RNA protein Transcription = DNA RNA Prokaryotes Translation = RNA protein Eukaryotes 5 DNA template strand Retroviruses violate this order using reverse transcriptase to convert RNA genome into DNA Transcription: DNA RNA Translation: RNA protein 5 Transcription Translation Protein mrna 9

10 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Prokaryotes Eukaryotes 5 DNA template strand Transcription mrna Transcription: DNA RNA Translation Translation: RNA protein 5 Protein 10

11 DNA RNA protein Transcription DNA-directed synthesis of RNA Only template strand of DNA used U (uracil) in DNA replaced by T (thymine) in RNA mrna used to direct synthesis of polypeptides Translation Synthesis of polypeptides Takes place at ribosome Requires several kinds of RNA Eukaryotes Transcription : DNA RNA Translation: RNA protein 5 Prokaryotes Transcription Translation Protein 5 DNA template strand mrna 11

12 The Nature of Genes RNA All synthesized from DNA template by transcription Messenger RNA (mrna) Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear RNA (snrna) Signal recognition particle RNA (SRP RNA) Micro-RNA (mirna) 12

13 The Genetic Code The Genetic Code: Francis Crick & Sydney Brenner determined how the order of nucleotides in DNA encoded amino acid order Introduced single nulcleotide insertions or deletions and looked for mutations Frameshift mutations Indicates importance of reading frame One Base Deleted Met Pro Thr His Arg Asp Ala Ser AUGCCUACGCACCGCGACGCAUCA Delete one base AUGCCUAGCACCGCGACGCAUCA Met Pro Ser Thr Ala Thr His Three Bases Deleted Met Pro Thr His Arg Asp Ala Ser AUGCCUACGCACCGCGACGCAUCA Delete three bases AUGCCUCACCGCGACGCAUCA Met Pro His Arg Asp Ala Ser Amino acids All amino acids changed after deletion Amino acids Amino acids do not change after third deletion 13

14 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. One Base Deleted Met Pro Thr His Arg Asp Ala Ser Amino acids AUGCCUACGCACCGCGACGCAUCA Delete one base AUGCCUAGCACCGCGACGCAUCA Met Pro Ser Thr Ala Thr His All amino acids changed after deletion Three Bases Deleted Met Pro Thr His Arg Asp Ala Ser Amino acids AUGCCUACGCACCGCGACGCAUCA Delete three bases AUGCCUCACCGCGACGCAUCA Met Pro His Arg Asp Ala Ser Amino acids do not change after third deletion 14

15 The Genetic Code The Genetic Code: Codon blocks of three DNA nucleotides correspond to an amino acid (triplet code) One Base Deleted Met Pro Thr His Arg Asp Ala Ser AUGCCUACGCACCGCGACGCAUCA Delete one base AUGCCUAGCACCGCGACGCAUC A Met Pro Ser Thr Ala Thr His Amino acids All amino acids changed after deletion Three Bases Deleted Met Pro Thr His Arg Asp Ala Ser Amino acids AUGCCUACGCACCGCGACGCAUCA Delete three bases AUGCCUCACCGCGACGCAUCA Met Pro His Arg Asp Ala Ser Amino acids do not change after third deletion 15

The Genetic Code Alternative hypotheses for triplet arrangement Spaced Codons Codon sequence in a gene punctuated Only one word changes after deletion Unspaced Codons Codons adjacent to each other

16 The Genetic Code Alternative hypotheses for triplet arrangement Spaced Codons Codon sequence in a gene punctuated Only one word changes after deletion Unspaced Codons Codons adjacent to each other All words change Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. SCIENTIFIC THINKING Sentence with Spaces WHY DID THE RED BAT EAT THE FAT RAT Delete one letter WHY DID HE RED BAT EAT THE FAT RAT Only one word changed Sentence with No Spaces WHYDIDTHEREDBATEATTHEFATRAT Delete one letter WHYDIDHEREDBATEATTHEFATRAT All words after deletion changed 16

Marshall Nirenberg identified the codons that specify each amino acid Stop codons 3 codons (UUA, UGA, UAG) used to terminate translation Start codon The Genetic Code

17 Marshall Nirenberg identified the codons that specify each amino acid Stop codons 3 codons (UUA, UGA, UAG) used to terminate translation Start codon The Genetic Code Codon (AUG) used to signify the start of translation Also codes for methionine Code is degenerate, meaning that some amino acids are specified by more than one codon 17

18 Code is degenerate, meaning that most amino acids are specified by more than one codon, but unambigous 18

19 The Genetic Code Code practically universal Strongest evidence that all living things share common ancestry Advances in genetic engineering Mitochondria and chloroplasts have some differences in stop signals 19

20 The Nature of Genes DNA RNA protein Prokaryotes Transcription = DNA RNA Eukaryotes Transcription 5 DNA template strand mrna Translation = RNA protein Transcription: DNA RNA Translation: RNA protein 5 Translation Protein 20

21 Prokaryotic Transcription Single RNA polymerase Initiation of mrna synthesis does not require a primer Requires 1. Promoter 2. Start site Transcription unit 3. Termination site 21

22 Prokaryotic Transcription Transcription occurs in three major stages: 1. Initiation 2. Elongation 3. Termination 22

Prokaryotic Transcription Stage 1: Initiation RNA polymerase binds to the promoter site Promoter Forms a recognition and binding site for the RNA polymerase Found upstream of the

23 Prokaryotic Transcription Stage 1: Initiation RNA polymerase binds to the promoter site Promoter Forms a recognition and binding site for the RNA polymerase Found upstream of the start site Promoter is not transcribed Asymmetrical indicates site of initiation and direction of transcription 23

24 Prokaryotic Transcription Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Prokaryotic RNA polymerase a. Prokaryotic RNA Polymerase Largeprotein that reads DNA and makes an RNA copy Made of several subunits 24

25 Prokaryotic Transcription Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Template strand Coding strand TATAAT Promoter ( 10 sequence) 5 Downstream Start site (+1) TTGACA Promoter ( 35 sequence) Prokaryotic RNA polymerase 5 Upstream a. b. Prokaryotic RNA Polymerase binding to DNA at the promoter region of DNA 25

26 Stage 1: Initiation Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Core enzyme Holoenzyme Coding strand Template strand TATAAT Promoter ( 10 sequence) 5 Downstream Start site (+1) binds to DNA 5 TTGACA Promoter ( 35 sequence) Helix opens at 10 sequence a. Prokaryotic RNA polymerase 5 b. Upstream 5 Prokaryotic RNA Polymerase binds promoter region of DNA RNA Polymerase unwinds small region of DNA called transcription bubble (needs to read the DNA) 26

binds to DNA RNA polymerase bound to unwound DNA Transcription Copyright The McGraw-Hill Companies, Inc.

27 Core enzyme Holoenzyme Stage 1: Initiation Coding strand Template strand TATAAT Promoter ( 10 sequence) 5 Downstream Start site (+1) TTGACA Promoter ( 35 sequence) Prokaryotic RNA polymerase 5 Upstream a. b. binds to DNA RNA polymerase bound to unwound DNA Transcription Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. bubble 5 dissociates Helix opens at 10 sequence Start site RNA synthesis begins ATP 5 27 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

28 Prokaryotic Transcription Stage 2: Elongation RNA transcript grows in the 5 -to- direction as ribonucleotides are added Transcription bubble contains RNA polymerase, DNA template, and growing RNA transcript After the transcription bubble passes, the now-transcribed DNA is rewound as it leaves the bubble 28

29 RNA polymerase Start site Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA Stage 2: Elongation Codingstrand Unwinding Rewinding 3' 5 3' 5 Downstream 3' Upstream mrna 5 Template strand Transcription bubble 29

30 Prokaryotic Transcription Stage 3: Termination Marked by sequence that signals stop to polymerase Causes formation of phosphodiester bonds to cease RNA DNA hybrid within transcription bubble dissociates RNA polymerase releases DNA DNA rewinds Hairpin in RNA causes RNA polymerase to pause U:A base pairs weaken the DNA/RNA bonding RNA polymerase 5 3' DNA mrna hairpin causes RNA polymerase to pause DNA and RNA Polymerase dissociates mrna dissociates from DNA Four or more U ribonucleotides 5 3' 5 U:A base pairs weaken the DNA/RNA bonding Cytosine Guanine Adenine Uracil 30

31 RNA polymerase Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA DNA and RNA Polymerase dissociates mrna dissociates from DNA 3' 5 3' Four or more U ribonucleotides 5 U:A base pairs weaken the DNA/RNA bonding mrna hairpin causes RNA polymerase to pause 5 Cytosine Guanine Adenine Uracil 31

Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in presentation mode (Slide Show view).

32 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in presentation mode (Slide Show view). You may see blank slides in the Normal or Slide Sorter views. All animations will appear after viewing in Slide Show mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

33 Prokaryotic Transcription Prokaryotic transcription is coupled to translation mrna begins to be translated before transcription is finished Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Polyribsomes is a mrna molecule with multiple ribosomes translating the mrna RNA polymerase DNA 0.25 µm mrna Ribosomes Polyribosome Polypeptide chains 33 Dr. Oscar Miller

34 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display µm RNA polymerase DNA mrna Ribosomes Polyribosome Polypeptide chains 34 Dr. Oscar Miller

35 Prokaryotic Transcription Operon Grouping of functionally related structural genes Multiple enzymes for a pathway Can be regulated together 35

36 Eukaryotic Transcription 3 different RNA polymerases RNA polymerase I transcribes rrna RNA polymerase II transcribes mrna and some snrna RNA polymerase III transcribes trna and some other small RNAs Each RNA polymerase recognizes its own promoter 36

37 Eukaryotic Transcription Initiation of transcription Requires a series of transcription factors Necessary to get the RNA polymerase II enzyme to a promoter and to initiate gene expression Interact with RNA polymerase to form initiation complex at promoter Elongation: RNA transcribed from the DNA template Termination Termination sites not as well defined 37

RNA polymerase Forms the initiation complex Other

box sequence, which is part of the core promoter. 2.

initiation complex begins to build. Initiation complex 3.

transcription factors and the DNA, forming the initiation

38 Eukaryotic Transcription Initiation of Transcription Transcription factors bind to promoter region and recruit RNA polymerase Forms the initiation complex Other transcription factors RNA polymerase II Transcription factor Eukaryotic DNA TATA box 1. A transcription factor recognizes and binds to the TATA box sequence, which is part of the core promoter. 2. Other transcription factors are recruited, and the initiation complex begins to build. Initiation complex 3. Ultimately, RNA polymerase II associates with the transcription factors and the DNA, forming the initiation complex, and transcription begins. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 38

39 Eukaryotic Transcription mrna modifications In eukaryotes, the primary transcript must be modified to become mature mrna Addition of a 5 cap Protects from degradation Involved in translation initiation Addition of a poly-a tail Created by poly-a polymerase Protection from degradation 5 cap Removal of non-coding sequences (introns) 5 cap P CH 2 Methyl group Pre-mRNA splicing done by spliceosome N + HO CH 3 OH + 5 P P P P P CH 3 mrna 39

40 Eukaryotic Transcription 5 cap HO 5 cap OH mrna modifications CH 2 P P P N + CH 3 + Methyl group P P P mrna 5 CH 3 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 40

Eukaryotic Transcription Eukaryotic pre-mrna splicing Introns non-coding sequences Exons sequences that will be translated (expressed) Through post-transcriptional splicing, introns are removed

41 Eukaryotic Transcription Eukaryotic pre-mrna splicing Introns non-coding sequences Exons sequences that will be translated (expressed) Through post-transcriptional splicing, introns are removed before translation Form mature mrna E1 I1 E2 I2 E3 I3 E4 I4 DNA template Transcription cap 5 a. Exons Introns Primary RNA transcript Introns are removed poly-a tail 3 cap 5 Mature mrna poly-a tail 33 41

42 Eukaryotic Transcription mrna modifications: Splicing E1 I1 E2 I2 E3 I3 E4 I4 cap 5 DNA template Transcription Exons Introns poly-a tail 33 Primary RNA transcript Introns are removed poly-a tail 3 cap 5 a. Mature mrna Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 42

43 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. E1 I1 E2 I2 E3 I3 E4 I4 5' cap DNA template Transcription Exons Introns 3' poly-a tail Primary RNA transcript Introns are removed 5' cap 3' poly-a tail a. Mature mrna 1 Intron b. c. mrna DNA 5 6 Exon b: Courtesy of Dr. Bert O Malley, Baylor College of Medicine 7 43

44 Eukaryotic Transcription Eukaryotic pre-mrna splicing Small ribonucleoprotein particles (snrnps snurps ) recognize the intron exon boundaries snrnps cluster with other proteins to form spliceosome Responsible for removing introns Exon 1 5 snrna Intron Branch point A snrnps 1. snrna forms base-pairs with 5 end of intron, and at branch site snrnps associate with other factors to form spliceosome. 5 Lariat 3. 5 end of intron is removed and forms bond at branch site, forming a lariat. The end of the intron is then cut. A A A Spliceosome Exon 2 5 Exon 1 Exon 2 Mature mrna Excised intron 4. Exons are joined; spliceosome disassembles. 44

45 mrna modifications: Splicing Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron A Exon 2 5 Branch point A 1. snrna forms base-pairs with 5 end of intron, and at branch site. 45

46 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 5 Intron Branch point A A Exon 2 1. snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome 5 2. snrnps associate with other factors to form spliceosome. 46

47 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron A Exon 2 5 Branch point A 1. snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome 5 2. snrnps associate with other factors to form spliceosome. Lariat A end of intron is removed and forms bond at branch site, forming a lariat. The end of the intron is then cut. 47

A Spliceosome 5 2. snrnps associate with other factors to form spliceosome. Lariat A 5 3.

48 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. snrna snrnps Exon 1 Intron Exon 2 A 5 Branch point A 1. snrna forms base-pairs with 5 end of intron, and at branch site. A Spliceosome 5 2. snrnps associate with other factors to form spliceosome. Lariat A end of intron is removed and forms bond at branch site, forming a lariat. The end of the intron is then cut. 5 Exon 1 Exon 2 Mature mrna Excised intron 4. Exons are joined; spliceosome disassembles. 48

49 Eukaryotic Transcription Alternative splicing Single primary transcript can be spliced into different mrnas by the inclusion of different sets of exons 15% of known human genetic disorders are due to altered splicing 35 to 59% of human genes exhibit some form of alternative splicing Explains how 25,000 genes of the human genome can encode the more than 80,000 different mrnas 49

50 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in presentation mode (Slide Show view). You may see blank slides in the Normal or Slide Sorter views. All animations will appear after viewing in Slide Show mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

51 trna and Ribosomes trna (transfer RNA) molecules that carry amino acids to ribosome for incorporation into a polypeptide Aminoacyl-tRNA synthetases add amino acids to the acceptor stem of trna Anticodon loop contains three nucleotides complementary to mrna codons 2D Cloverleaf Model Acceptor end Anticodon loop 51

Copyright The McGraw-Hill Companies, Inc.

2D Cloverleaf Model Acceptor end 3 5 3D Ribbon-like Model Acceptor end Anticodon loop

end Anticodon loop Anticodon end c: Created by John Beaver using ProteinWorkshop, a

52 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 2D Cloverleaf Model Acceptor end 3 5 3D Ribbon-like Model Acceptor end Anticodon loop 3D Space-filled Model Acceptor end More realistic shapes Anticodon loop Icon Acceptor end Anticodon loop Anticodon end c: Created by John Beaver using ProteinWorkshop, a product of the RCSB PDB, and built using the Molecular Biology Toolkit developed by John Moreland and Apostol Gramada (mbt.sdsc.edu). The MBT is financed by grant GM

trna and Ribosomes trna charging reaction: Each aminoacyl-trna synthetase recognizes only 1 amino acid but several trnas Charged trna has an amino acid added using ATP energy Can undergo peptide bond

53 trna and Ribosomes trna charging reaction: Each aminoacyl-trna synthetase recognizes only 1 amino acid but several trnas Charged trna has an amino acid added using ATP energy Can undergo peptide bond formation without additional energy Ribosomes do not verify amino acid attached to Amino Carboxyl Charged trna travels to ribosome group group trna trna site NH 3 + P i ATP P i Trp C O O Amino acid site Accepting site OH trna NH 3 + Trp C O O Aminoacyl-tRNA synthetase Anticodon specific to tryptophan Charged trna dissociates 53

Amino group NH 3 + Trp Carboxyl group C O trna site P i ATP P i O Amino acid site

In the first step of the reaction, the amino acid is activated.

54 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Amino group NH 3 + Trp Carboxyl group C O trna site P i ATP P i O Amino acid site Accepting site OH trna Aminoacyl-tRNA synthetase Anticodon specific to tryptophan 1. In the first step of the reaction, the amino acid is activated. The amino acid reacts with ATP to produce an intermediate with the carboxyl end of the amino acid attached to AMP. The two terminal phosphates (pyrophosphates) are cleaved from ATP in this reaction. 54

55 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Amino group NH 3 + Trp Carboxyl group C O trna site P i ATP P i O Amino acid site Aminoacyl-tRNA synthetase 55

Carboxyl group C O trna site P i ATP P i O Amino acid site

56 Amino group NH 3 + Trp Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Carboxyl group C O trna site P i ATP P i O Amino acid site Accepting site OH trna Aminoacyl-tRNA synthetase Anticodon specific to tryptophan 56

trna Charging Reaction: Aminoacyl-tRNA synthetase recognizes only 1 amino acid but several trnas Due to degenerate code Amino group Carboxyl group Charged trna travels to ribosome trna site NH 3 + P

57 trna Charging Reaction: Aminoacyl-tRNA synthetase recognizes only 1 amino acid but several trnas Due to degenerate code Amino group Carboxyl group Charged trna travels to ribosome trna site NH 3 + P i ATP P i Trp C O O Amino acid site Accepting site OH trna NH 3 + Trp C O O Aminoacyl-tRNA synthetase Anticodon specific to tryptophan Charged trna dissociates 1. In the first step of the reaction, the amino acid is activated. The amino acid reacts with ATP to produce an intermediate with the carboxyl end of the amino acid attached to AMP. The two terminal phosphates (pyrophosphates) are cleaved from ATP in this reaction. 2. The amino acid-amp complex remains bound to the enzyme. The trna next binds to the enzyme. 3. The second step of there action transfers the amino acid from AMP to the trna, Producing a charged trna and AMP. The charged trna consists of a specific amino acid attached to the accept or stem of it srna. 57 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

58 trna and Ribosomes Ribosomes have multiple trna binding sites A site: binds the trna carrying the next amino acid P site: binds the trna attached to the growing peptide chain E site: binds the trna that carried the last amino acid, trna exits ribosome 5 mrna Large subunit Small subunit 58

59 Ribosomes Large subunit 90 Small subunit Large subunit 0 Large subunit Small subunit mrna Small subunit 5 59 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

60 trna and Ribosomes The ribosome has two primary functions 1. Decode the mrna 2. Form peptide bonds Peptidyl transferase Enzymatic component of the ribosome Forms peptide bonds between amino acids 60

61 The Nature of Genes DNA RNA protein Prokaryotes Transcription = DNA RNA Eukaryotes Transcription 5 DNA template strand mrna Translation = RNA protein Transcription: DNA RNA Translation: RNA protein 5 Translation Protein 61

62 Translation Process by which the mrna transcript is read by the ribosomes and used to make a polypeptide Occurs in 3 main stages 1. Initiation 2. Elongation 3. Termination There are some important differences between translation in prokaryotes and eukaryotes 62

63 Translation In prokaryotes, initiation complex includes Initiator trna charged with N-formylmethionine Small ribosomal subunit mrna strand Ribosome binding sequence (RBS) of mrna positions small subunit correctly Large subunit then added Initiator trna aligned to P site with A and E sites empty U A Large subunit GTP C GDP + P i fmet 5 AUG mrna Small subunit Initiation complex Initiation factor U A A C U G Initiation factor E site GTP trna in P site A site Complete ribosome 63 GDP + P i

64 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Prokaryotic Initiation Complex fmet U A C 5 AUG mrna Initiation factor Initiation factor Small subunit 5 GTP GDP + P i Large subunit U A A U C G E site trna in P site A site GTP GDP P i Initiation complex Complete ribosome 64

Translation Initiations in eukaryotes similar except Initiating amino acid is methionine More complicated initiation complex Lack of an RBS small subunit binds to 5 cap of mrna U A Large

65 Translation Initiations in eukaryotes similar except Initiating amino acid is methionine More complicated initiation complex Lack of an RBS small subunit binds to 5 cap of mrna U A Large subunit GTP C GDP + P i Met 5 AUG mrna Small subunit Initiation factor U A A C U G 5 cap 5 5 Initiation factor E site GTP trna in P site A site GDP + P i Initiation complex Complete ribosome 65

Translation Elongation adds amino acids 2 nd charged trna can bind to empty A site Requires elongation factor called EF-Tu to bind to trna and GTP (not shown) Peptide bond can then form Addition of

66 Translation Elongation adds amino acids 2 nd charged trna can bind to empty A site Requires elongation factor called EF-Tu to bind to trna and GTP (not shown) Peptide bond can then form Addition of successive amino acids occurs as a cycle Amino acid 1 NH 3 + NH 3 + Amino acid 2 Polypeptide chain NH 3 + N Amino group Amino acid 1 Peptide bond Amino acid 2 O O Peptide bond formation Empty trna OH O 5 66 A site P site

bond formation Empty trna OH O Amino acid 4 Amino acid 5 Amino acid 6 5 Amino acid 7 COO A site P site

67 Elongation Amino acid 1 NH 3 + NH 3 + Amino acid 2 Polypeptide chain NH 3 + N Amino group Amino acid 1 Peptide bond Amino acid 2 Amino end (N terminus) NH 3 + Amino acid 1 Amino acid 2 Amino acid 3 O O Peptide bond formation Empty trna OH O Amino acid 4 Amino acid 5 Amino acid 6 5 Amino acid 7 COO A site P site Carboxyl end (C terminus) 67 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

68 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Elongation Addition of successive amino acids occurs as a cycle Elongation factor E P A GDP + GTP P i Elongation factor 5 E P A E P A 5 Sectioned ribosome 5 Next round GTP Elongation factor Ejected trna Growing polypeptide GTP GDP Elongation factor + P i 5 E P A E P A 5 68

Translation There are fewer trnas than codons Wobble pairing allows less stringent pairing between the base of the codon and the 5 base of the anticodon

69 Translation There are fewer trnas than codons Wobble pairing allows less stringent pairing between the base of the codon and the 5 base of the anticodon This allows fewer trnas to accommodate all codons Allowed by degenerate code 69

Translation Termination Elongation continues

70 Translation Termination Elongation continues until the ribosome encounters a stop codon Release factor Polypeptide chain releases Dissociation 5 Stop codons are recognized by release factors which release the polypeptide from the ribosome 5 Sectioned ribosome E P A 70

71 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Termination Polypeptide chain releases Dissociation Release factor 5 5 Sectioned ribosome E P A 71

72 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in presentation mode (Slide Show view). You may see blank slides in the Normal or Slide Sorter views. All animations will appear after viewing in Slide Show mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

73 Protein Targeting In eukaryotes, translation may occur in the cytoplasm or the rough endoplasmic reticulum (RER) Free ribosomes cytoplasm Bound ribosomes RER Free ribosome Exit tunnel Ribosome synthesizing peptide 73

74 Protein Targeting Bound ribsomes RER Signal sequences at the beginning of polypeptide sequence bind to the signal recognition particle (SRP) Signal sequence The signal sequence & SRP are recognized by RER receptor proteins Docking holds ribosome to RER ( bound ribosome) Beginning of the proteintrafficking pathway 74

75 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Protein Targeting Fig Signal recognition particle (SRP) Signal Exit tunnel Ribosome synthesizing peptide

76 Protein Targeting Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. SRP binds to signal peptide, arresting elongation Signal recognition particle (SRP) Signal Exit tunnel Ribosome synthesizing peptide

77 Protein Targeting Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Rough endoplasmic reticulum (RER) Protein channel Cytoplasm Lumen of the RER SRP binds to signal peptide, arresting elongation Docking Signal recognition particle (SRP) Signal Exit tunnel Ribosome synthesizing peptide

78 Protein Targeting Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Rough endoplasmic reticulum (RER) Protein channel Cytoplasm Lumen of the RER Signal recognition particle (SRP) SRP binds to signal peptide, arresting elongation Docking NH 2 Polypeptide elongation continues Signal Exit tunnel Ribosome synthesizing peptide 78

79 Fig (page 298) Overview of Gene Expression in Eukaryotes 79

80 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II RNA polymerase II 3 5 Primary RNA transcript 80

RNA polymerase II in the nucleus copies one strand of the DNA

RNA polymerase II 3 5 Primary RNA transcript 2.

cap, cleavage and polyadenylation of the end, and removal of

81 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 81

transcript. RNA polymerase II 3 5 Primary RNA transcript 2.

polyadenylation of the 3 end, and removal of introns.

Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3.

82 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the 3 end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap Large subunit mrna Small subunit Cytoplasm 82

83 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap mrna Small subunit Large subunit Cytoplasm Cytoplasm Amino acids trna arrivesin A site mrna 5 A site P site E site 4. The ribosome cycle begins with the growing peptide attached to the trna in the P site. The next charged trna binds to the A site with its anticodon complementary to the codon in the mrna in this site. 83

introns. The mature mrna is then exported through nuclear pores to the cytoplasm.

The 5 cap of the mrna associates with the small subunit of the ribosome.

5 cap mrna Small subunit Large subunit Cytoplasm Amino acids trna arrivesin A site Cytoplasm Lengthening polypeptide chain

84 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1. RNA polymerase II in the nucleus copies one strand of the DNA to produce the primary transcript. RNA polymerase II 3 5 Primary RNA transcript 2. The primary transcript is processed by addition of a 5 methyl-g cap, cleavage and polyadenylation of the end, and removal of introns. The mature mrna is then exported through nuclear pores to the cytoplasm. Primary RNA transcript Cut intron 5 cap Poly-A tail Mature mrna 3. The 5 cap of the mrna associates with the small subunit of the ribosome. The initiator trna and large subunit are added to form an initiation complex. 5 cap mrna Small subunit Large subunit Cytoplasm Amino acids trna arrivesin A site Cytoplasm Lengthening polypeptide chain mrna Emptyt RNA 5 A site P site E site 5 4. The ribosome cycle begins with the growing peptide attached to the trna in the P site. The next charged trna binds to the A site with its anticodon complementary to the codon in the mrna in this site. 5. Peptide bonds form between the amino terminus of the next amino acid and the carboxyl terminus of the growing peptide. This transfers the growing peptide to the trna in the A site, leaving the trna in the P site empty. 84

85 85

86 86

87 Mutation: Altered Genes Point mutations alter a single base Base substitution substitute one base for another Silent mutation same amino acid inserted Due to degenerate code Reduces affect of mutations a. Coding Template mrna Protein Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Normal Sequence C G A T A T 5 ATGCCTTATCGCTGA TACGGAATAGCGACT 5 5 AUGCCUUAUCGCUGA Met Pro Thr Arg Stop Silent Mutation C G CCU and CCC both code for proline Coding Template mrna Protein b. 5 ATGCCCTATCGCTGA TACGGGATAGCGACT 5 5 AUGCCCUAUCGCUGA Met Pro Thr Arg Stop 87

88 Code is degenerate, meaning that most amino acids are specified by more than one codon, but unambigous 88

89 Mutation: Altered Genes Missense mutation changes amino acid with substitution Transitions Transversions Coding Template mrna Protein c. Substitute Arg (CGC) for His (CAC) Met Missense Mutation A T 5 ATGCCCTATCACTGA TACGGGATAGTGACT 5 5 AUGCCCUAUCACUGA Pro Thr His Stop Nonsense mutations changed to stop codon Coding Template mrna Nonsense Mutation A T 5 ATGCCCTAACGCTGA TACGGGATTGCGACT 5 5 AUGCCCUAACGCUGA Protein Met Pro Stop 89 d.

90 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Normal Sequence C G A T A T Coding Template mrna 5 ATGCCTTATCGCTGA TACGGAATAGCGACT 5 5 AUGCCUUAUCGCUGA Protein Met Pro Thr Arg Stop a. Silent Mutation C G Coding Template mrna 5 ATGCCCTATCGCTGA TACGGGATAGCGACT 5 5 AUGCCCUAUCGCUGA Protein Met Pro Thr Arg Stop b. 90

91 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Missense Mutation A T Coding Template mrna 5 ATGCCCTATCACTGA TACGGGATAGTGACT 5 5 AUGCCCUAUCACUGA Protein Met Pro Thr His Stop c. Nonsense Mutation A T Coding Template mrna 5 ATGCCCTAACGCTGA TACGGGATTGCGACT 5 5 AUGCCCUAACGCUGA Protein Met Pro Stop d. 91

Mutation: Altered Genes Copyright The McGraw-Hill Companies, Inc.

Normal HBB Sequence Polar Leu Thr Pro Glu Glu C T G A C T C C T G A G A A G A

Abnormal Deoxygenated Tetramer 2 1 1 2 2 Abormal HBB Sequence Nonpolar

Lys Ser Amino acids C T G A C T C C T G T G G A G A A G T C T Nucleotides

This distorts the normal red blood cell shape into a sickle shape.

92 Mutation: Altered Genes Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Normal HBB Sequence Polar Leu Thr Pro Glu Glu C T G A C T C C T G A G A A G A Lys A G T Ser C T Amino acids Nucleotides Normal Deoxygenated Tetramer Abnormal Deoxygenated Tetramer Abormal HBB Sequence Nonpolar (hydrophobic) Hemoglobin tetramer "Sticky" nonpolar sites Leu Thr Pro val Glu Lys Ser Amino acids C T G A C T C C T G T G G A G A A G T C T Nucleotides Tetramers form long chains when deoxygenated. This distorts the normal red blood cell shape into a sickle shape. In hemoglobin gene, a base substitution (A replaced with T) causes Valine to be substituted for Glutamate. This causes the hemoglobin molecules to stick together, causing sickle cell anemia 92

http://staff.tuhsd.k12.az.us/gfoster/standard/bmut.

profound consequences Alter reading frame downstream of mutation 93 Triplet repeat expansion mutation

93 Mutation: Altered Genes Frameshift mutations Addition or deletion of a single base Much more profound consequences Alter reading frame downstream of mutation 93 Triplet repeat expansion mutation Huntington disease Repeat units expand in disease allele relative to normal protein degenerates neurons

94 Chromosomal mutations Change the structure of a chromosome Deletions part of chromosome is lost Deleted A B C D E F G H I a. J Deletion A E F G H I J Duplication part of chromosome is copied Inversion part of chromosome in reverse order Duplicated A B C D E F G H I J b. Inverted A B C D E F G H I J Duplication A B C D B C D E F G H I J Inversion A D C B E F G H I J 94 Translocation part of chromosome is moved to a new location c. Reciprocal Translocation A B C D E F G H I J K L M D E F G H I J K L M N O P Q R A B C N O P Q R d.

95 Chromosomal mutations Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Deleted Deletion A B C D E F G H I J A E F G H I J a. Duplication Duplicated A B C D E F G H I J A B C D B C D E F G H I J b. 95

96 Chromosomal mutations Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Inversion Inverted A B C D E F G H I J A D C B E F G H I J c. Reciprocal Translocation A B C D E F G H I J K L M D E F G H I J K L M N O P Q R A B C N O P Q R d. 96

97 Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in presentation mode (Slide Show view). You may see blank slides in the Normal or Slide Sorter views. All animations will appear after viewing in Slide Show mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

http://www.philly.com/philly/blogs/evolution/white-horses-and-other-beautiful-mutants.

Too much change, however, is harmful to the individual with a greatly altered genome Balance must

98 Mutation: Altered Genes Mutations are the starting point for evolution Source of new alleles Too much change, however, is harmful to the individual with a greatly altered genome Balance must exist between amount of new variation and health of species 98

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 1 The Nature of Genes Early ideas to explain how genes work came from studying human diseases Archibald Garrod 1902 Recognized that alkaptonuria is inherited via a recessive