Nature Medicine: doi: /nm.2171

Size: px
Start display at page:

Download "Nature Medicine: doi: /nm.2171"

Transcription

1

2

3

4 Table 1. Anti-cystic effect of Genz in jck mouse model of PKD No No of animals Gender Dose (% in feed) Body weight (g) K/BW ratio (%) Cystic volume (%BW) BUN (mg dl 1 ) 1 Vehicle 10 F ± ± ± ± Genz F ± ± 0.16* 0.5 ± 0.05* 26.4 ± 1.3* 3 Genz F ± 0.5* 3.35 ± 0.08* 0.5 ± 0.03* 32.3 ± 2.3* 4 Vehicle 9 M ± ± ± ± Genz M ± ± 0.24* 1.5 ± 0.1* 48.3 ± 3.1* 6 Genz M ± 0.6* 4.36 ± 0.14* 0.8 ± 0.1* 35.0 ± 4.5* * indicates P<0.05 for reduction in Genz treated vs. vehicle treated animals

5 Table 2. Anti-cystic effect of Genz in pcy model of PKD No No of Body weight K/BW ratio Cystic Fibrosis (%) animals (g) (%) volume (%BW) 1 Vehicle ± ± ± ± Genz ± 0.66* 2.64 ± 0.13* 0.40 ± 0.05* 17.0 ± 1.3* * indicates P<0.05 for reduction in Genz treated vs. vehicle treated animals

6 Table 3. Anti-cystic effect of Genz in Pkd1 cko mice No No of animals Body weight (g) K/BW ratio (%) Cystic volume (%BW) BUN (mg dl 1 ) 1 Vehicle ± ± ± ± Genz ± ± 0.29* 0.80 ± 0.12* ± 9.73* * indicates P<0.05 for reduction in Genz treated vs. vehicle treated animals

7 SUPPLEMENTARY METHODS Generation of Pkd1 conditional knockout animals: To generate the Pkd1 conditional knockout mice (Pkd1 tm1gztn ), a positive/negative gene replacement vector containing LoxP sites flanking exons 21, 22 and 23 of the Pkd1 gene, as well as a selectable cassette, was electroporated into 129S7- strain AMK ES cells. Correctly targeted ES cells were expanded, and a Cre-expression plasmid was transiently introduced to delete the drug selection cassette, yet retain the floxed exons Correctly recombined ES cells were microinjected into C57BL/6 mouse blastocysts to generate chimeric mice. All animals were backcrossed to C57BL/6 mice for >4 generations before use. Cell culture: The rat kidney epithelial cell line NRK-52E (NRK; ATCC) was maintained in high glucose Dulbecco s modified Eagle s medium (DMEM) containing 10% fetal bovine serum, 1 mm Glutamine, 100 U ml 1 penicillin, and 100 g ml 1 streptomycin (Invitrogen) at 37 C under 5% CO 2 in a humidified incubator. We dispersed cells using 0.25% Trypsin-EDTA (Invitrogen), and plated them at 5x10 5 cells per 10 cm petri dish for routine culture. We established WT and jck kidney epithelial cells from wild-type or jck mouse kidneys as follows. Briefly, we disaggregated 64 day old jck kidneys with collagenase Class IV (Worthington Biochemicals) in DMEM containing DNase I (Sigma- Aldrich) as described 1. We plated the resulting single cell suspension onto collagen I- coated plates (Becton-Dickinson) in DMEM containing 10% fetal calf serum for 24 hours, then maintained them in REGM (Lonza) until confluent. We transfected the cells with an SV40 T-ag (T-Ag P427L ) expression vector using a Nucleofector apparatus (Lonza) 2, then isolated clonal lines by serial dilution. We selected epithelial cells based

8 on phenotypic characterization of marker expression. Both WT and jck cells express SV40 T-Ag, cytokeratins, Na + K + -ATPase and AQP2 and are negative for expression of AQP1 and Tamm-Horsfall Glycoprotein. We maintained cells on collagen-i coated plates at 33 C. For IGF-I induction experiments, cells were serum starved in DMEM media containing 0.1% BSA with or without 2 M Genz for 16 hours prior to the addition of IGF-1 (RnD Systems) for the indicated times. All cells used for glycosphingolipid analysis were washed twice with TBS before homogenization in distilled water. sirna transfection: We obtained sirna reagents from Applied Biosystems. We transiently transfected GCS specific (Ugcg, catalog #s136139) and negative control (Negative Control #1, catalog # ) small interfering RNAs (sirnas) into NRK cells for 8 hours using 150 pmole sirna and 20 l Lipofectamine RNAiMAX (Invitrogen) per 100 mm petri dish according to the manufacturer s guidelines. We harvested cells for glycosphingolipid analysis and quantitative RT-PCR analysis 48 hours after transfection. Quantitative RT-PCR analysis: We extracted RNA and processed it for RT-PCR as previously described 3. We performed quantitative RT-PCR for glucosylceramide synthase (Ugcg) using Applied Biosystems predesigned TaqMan Gene Expression Assays Rn _m1 (rat) or Mm _m1 (mouse), and normalized to rodent 18S RNA.

9 Cell cycle analysis: To synchronize cells in the G0/G1 phase of the cell cycle, we treated them for 16 hours with 1.5 µg ml 1 aphidicolin (Sigma-Aldrich), then washed them twice with PBS before incubating them for 6 hours in growth media or media containing Genz where indicated. For GlcCer synthase sirna knock down studies, we performed sirna-mediated knockdown as described above. 24 hours after sirna transfection, we synchronized the cells as described above, then released them back into the cell cycle for 6 hours in growth media. We then disassociated the cells using trypsin/edta, fixed them with 70% ethanol, washed them twice with PBS and stained them in PBS containing 50 g ml 1 propidium iodide and 10 g ml 1 RNase A (Sigma-Aldrich). We analyzed samples on a FACSCalibur flow cytometer (Becton-Dickinson) and analyzed the data using FlowJo software (Tree Star Inc). 1. Humes, H.D., et al. Metabolic replacement of kidney function in uremic animals with a bioartificial kidney containing human cells. Am J Kidney Dis 39, (2002). 2. Loeber, G., Tevethia, M.J., Schwedes, J.F. & Tegtmeyer, P. Temperaturesensitive mutants identify crucial structural regions of simian virus 40 large T antigen. J Virol 63, (1989). 3. Natoli, T.A., et al. Pkd1 and Nek8 mutations affect cell-cell adhesion and cilia in cysts formed in kidney organ cultures. Am J Physiol Renal Physiol 294, F73-83 (2008).

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Amaxa Cell Line Nucleofector Kit L

Amaxa Cell Line Nucleofector Kit L Amaxa Cell Line Nucleofector Kit L For 3T3-L1 (adipocytes) [ATCC CL-173, cryopreserved] Mouse embryonal fibroblast, differentiated into adipocytes; Fibroblast-like cells before differentiation; adipocyte-like

More information

VDL602.2 RAPID ASSAY FOR DETERMINING ADENOVIRAL VECTOR TITER

VDL602.2 RAPID ASSAY FOR DETERMINING ADENOVIRAL VECTOR TITER 1. Purpose 1.1. The purpose of this protocol is to determine the number of infectious adenoviral particles. 1.2. The starting material is purified adenoviral vectors. 1.3. This protocol is based upon the

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

Plasmid DNA transfection of LN-229 human glioblastoma cells with the Biontex K2 Transfection System

Plasmid DNA transfection of LN-229 human glioblastoma cells with the Biontex K2 Transfection System Plasmid DNA transfection of human glioblastoma cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt, Theodor-Stern-Kai

More information

EUCOMM Protocol for ES cells

EUCOMM Protocol for ES cells EUCOMM Protocol for ES cells 1. SNL Feeder Cells 1.1. Preparing inactivated SNL Feeder Cells 1) Thaw one vial of SNL cells (approximately1.5-2 x 10 6 cells per vial) in a 37 C water bath and dilute into

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000

High throughput screening: Huh-7 cells were seeded into 96-well plate (2000 1 SUPPLEMENTARY INFORMATION METHODS 6 7 8 9 1 11 1 1 1 1 16 17 18 19 High throughput screening: Huh-7 cells were seeded into 96-well plate ( cells/well) and infected with MOI of DENV-. One hour post-infection

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 Supporting Information Cell culture. C2C12 cells (ATCC CRL 1772) were cultured in 75 cm 2

More information

Code No Retrovirus Packaging Kit Ampho

Code No Retrovirus Packaging Kit Ampho Code No. 6161 Retrovirus Packaging Kit Ampho Precautions for the use of this product Please follow the guideline for experiments using recombinant DNA issued by the relevant authorities and the safety

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Supplemental Information

Supplemental Information Supplemental Information Intrinsic protein-protein interaction mediated and chaperonin assisted sequential assembly of a stable Bardet Biedl syndome protein complex, the BBSome * Qihong Zhang 1#, Dahai

More information

Alt-R CRISPR-Cpf1 System:

Alt-R CRISPR-Cpf1 System: user guide Alt-R CRISPR-Cpf1 System: Delivery of ribonucleoprotein complexes in HEK-293 cells using the Amaxa Nucleofector System See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after

Supplementary Information: Materials and Methods. GST and GST-p53 were purified according to standard protocol after Supplementary Information: Materials and Methods Recombinant protein expression and in vitro kinase assay. GST and GST-p53 were purified according to standard protocol after induction with.5mm IPTG for

More information

Technion Protocol Human Embryonic Stem Cells: Laboratory Manual

Technion Protocol Human Embryonic Stem Cells: Laboratory Manual Technion Protocol Human Embryonic Stem Cells: Laboratory Manual This material was cultured and frozen using Technion s protocols. WiCell recommends that stem cells should be thawed and established in the

More information

Percent survival. Supplementary fig. S3 A.

Percent survival. Supplementary fig. S3 A. Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

More information

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D

Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D Reprogramming of Murine Somatic Cells Using mir302/367 lentivirus Modification by: Frederick Anokye-Danso, Ph.D MATERIALS Media Sodium Pyruvate (Mediatech; Cat# MT25-000-CI) Leukemia Inhibitory Factor

More information

The presence of T cell epitopes is important for induction of antibody

The presence of T cell epitopes is important for induction of antibody The presence of T cell epitopes is important for induction of antibody responses against antigens directed to DEC25 + dendritic cells Kelly N. S. Amorim, Eline V. Rampazo, Renan Antonialli, Marcio M. Yamamoto,

More information

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and

We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and Mice We designed the targeting vector in such a way that the first exon was flanked by two LoxP sites and an Frt flanked neo cassette (Fig. S1A). Targeted BA1 (C57BL/6 129/SvEv) hybrid embryonic stem cells

More information

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer

Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Supplementary Information Temperature-responsive Gene Silencing by a Smart Polymer Mingming Wang, Yiyun Cheng * Shanghai Key Laboratory of Regulatory Biology, School of Life Sciences, East China Normal

More information

Establishing sirna assays in primary human peripheral blood lymphocytes

Establishing sirna assays in primary human peripheral blood lymphocytes page 1 of 7 Establishing sirna assays in primary human peripheral blood lymphocytes This protocol is designed to establish sirna assays in primary human peripheral blood lymphocytes using the Nucleofector

More information

Experimental genetics - 2 Partha Roy

Experimental genetics - 2 Partha Roy Partha Roy Experimental genetics - 2 Making genetically altered animal 1) Gene knock-out k from: a) the entire animal b) selected cell-type/ tissue c) selected cell-type/tissue at certain time 2) Transgenic

More information

PromoFectin-HUVEC Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50

PromoFectin-HUVEC Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50 PromoFectin-HUVEC Cell Transfection Reagent Instruction Manual Cat.No. PK-CT-2000-HUV-10 PK-CT-2000-HUV-50 2 Instruction Manual Contents Content 3 Formulation and Storage 3 General Considerations 3 Transient

More information

Supplementary Protocol. sirna transfection methodology and performance

Supplementary Protocol. sirna transfection methodology and performance Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

293T/17 Cell Avalanche Transfection Reagent

293T/17 Cell Avalanche Transfection Reagent The Transfection & Gene Expression Experts 293T/17 Cell Avalanche Transfection Reagent Cat. No. EZT-293T-1 Size: 0.5 ml 1.5 ml Store at 4 C Cell Line Information: Designations: 293T/17 [HEK 293T/17] Depositors:

More information

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW

More information

Boston University. Supply Center Product List

Boston University. Supply Center Product List Boston University Supply Center Product List Supply Center Location 72 East Concord Street Supply Center Room L901 (behind elevators) Boston, MA To find out more about your Supply Center, request product

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Convoy TM Transfection Reagent

Convoy TM Transfection Reagent Convoy TM Transfection Reagent Catalog No.11103 0.25ml (40-80 transfections in 35mm dishes) Catalog No.11105 0.5 ml (80-165 transfections in 35mm dishes) Catalog No.11110 1.0 ml (165-330 transfections

More information

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406

Data Sheet. MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Data Sheet MAPK/ERK Signaling Pathway SRE Reporter HEK293 Cell Line Catalog #: 60406 Description The MAPK/ERK signaling pathway is a major participant in the regulation of cell growth and differentiation.

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Size: 0.75 ml 1.5 ml Store at 4 C Description Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP)

Flag-Rac Vector V12 V12 N17 C40. Vector C40 pakt (T308) Akt1. Myc-DN-PAK1 (N-SP) a b FlagRac FlagRac V2 V2 N7 C4 V2 V2 N7 C4 p (T38) p (S99, S24) p Flag (Rac) NIH 3T3 COS c +Serum p (T38) MycDN (NSP) Mycp27 3 6 2 3 6 2 3 6 2 min p Myc ( or p27) Figure S (a) Effects of Rac mutants on

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Materials and Methods

Materials and Methods Materials and Methods Construction of noxa / mice and genotyping The targeting vector (see Fig. S) was prepared from a C57BL/6 DNA λ phage library (Stratagene) by replacing a 2.7 kb region encompassing

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Description Size: 0.75 ml 1.5 ml Store at 4 C Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

More information

Cignal Reporter Assay Handbook

Cignal Reporter Assay Handbook January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and

More information

PromoFectin-Hepatocyte Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50

PromoFectin-Hepatocyte Cell Transfection Reagent. Instruction Manual. Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50 PromoFectin-Hepatocyte Cell Transfection Reagent Instruction Manual Cat.No. PK-CT-2000-HEP-10 PK-CT-2000-HEP-50 2 Instruction Manual Contents Content 3 Formulation and Storage 3 General Considerations

More information

Assay ID Assay name Description Components of the assay SYS-A115 DRD5/ARRB2 targetscreener

Assay ID Assay name Description Components of the assay SYS-A115 DRD5/ARRB2 targetscreener DRD5/ARRB2 targetscreener Assay SYS-A115 SYS-A115C4 systasy bioscience GmbH Adams-Lehmann-Str. 56 80797 München Tel. +49 (0) 89 2155 3085 Fax. +49 (0) 89 4400 55853 E-mail: support@systasy.de Product Description

More information

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling

More information

Avalanche -Everyday Transfection Reagent

Avalanche -Everyday Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Everyday Transfection Reagent Cat. No. EZT-EVDY-1 Description Size: 0.75 ml 1.5 ml Store at 4 C As the simplified version of our most popular and powerful

More information

Knockdown of Arhgef-1 expression in VSMCs To knockdown rat VSMCs Arhgef-1 expression, three sets of sirna against rat

Knockdown of Arhgef-1 expression in VSMCs To knockdown rat VSMCs Arhgef-1 expression, three sets of sirna against rat Supplemental Material Chemicals and Reagents PGE2 and sulprostone were respectively purchased from Cayman Chemical (Ann Arbor, MI) and BioMol Research Laboratories (Plymouth Meeting, PA). M&B28767 was

More information

Assay ID Assay name Description Components of the assay SYS-A044 ERBB2-3/ SH2(GRB2) receptor. readout

Assay ID Assay name Description Components of the assay SYS-A044 ERBB2-3/ SH2(GRB2) receptor. readout ERBB2-3/SH2(GRB2) targetscreener Assay SYS-A044 SYS-A044C10 systasy bioscience GmbH Adams-Lehmann-Str. 56 80797 München Tel. +49 (0) 89 2155 3085 Fax. +49 (0) 89 4400 55853 E-mail: support@systasy.de Product

More information

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides

Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides Supplementary Figure 1. Confirmation of sirna in PC3 and H1299 cells PC3 (a) and H1299 (b) cells were transfected with sirna oligonucleotides targeting RCP (SMARTPool (RCP) or two individual oligos (RCP#1

More information

Student Learning Outcomes (SLOS) - Advanced Cell Biology

Student Learning Outcomes (SLOS) - Advanced Cell Biology Course objectives The main objective is to develop the ability to critically analyse and interpret the results of the scientific literature and to be able to apply this knowledge to afford new scientific

More information

Amaxa Basic Neuron SCN Nucleofector Kit

Amaxa Basic Neuron SCN Nucleofector Kit Amaxa Basic Neuron SCN Nucleofector Kit For Primary Mouse Hippocampal Neurons (Small-Cell-Number) Embryonic mouse hippocampal neurons transfected using the Nucleofector Technology A B Approximately 100.000

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM

Protocol Reprogramming MEFs using the Dox Inducible Reprogramming Lentivirus Set: Mouse OKSM STEMGENT Page 1 OVERVIEW The following protocol describes the reprogramming of one well of mouse embryonic fibroblasts (MEFs) into induced pluripotent stem (ips) cells in a 6-well format. Transduction

More information

The Effects of Serum Starvation on Cell Cycle Synchronization

The Effects of Serum Starvation on Cell Cycle Synchronization OSR Journal of Student Research Volume 1 Article 4 2013 The Effects of Serum Starvation on Cell Cycle Synchronization Negin Baghdadchi California State University, San Bernardino Follow this and additional

More information

jetprime DNA & sirna transfection reagent

jetprime DNA & sirna transfection reagent jetprime in vitro DNA & sirna Transfection Protocol Company Information... 2 Product Information... 3 1. Transient DNA transfection protocol... 4 1.1 Cell seeding... 4 1.2 DNA Transfection Protocol...

More information

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology

Mouse Engineering Technology. Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Mouse Engineering Technology Musculoskeletal Research Center 2016 Summer Educational Series David M. Ornitz Department of Developmental Biology Core service and new technologies Mouse ES core Discussions

More information

MOD1 DNA ENGINEERING. Day 6. Why you owe Your Life to Homologous Recombina9on. Engelward, Fall Rad51 / Normal

MOD1 DNA ENGINEERING. Day 6. Why you owe Your Life to Homologous Recombina9on. Engelward, Fall Rad51 / Normal MOD1 DNA ENGINEERING Engelward, Fall 2009 Lecture 1: Intro to importance of HR Polymerases & PCR Lecture 2: How HR works Overview of experiments & discussion of controls (single digests) Lecture 3: Why

More information

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells

Protocol Using a Dox-Inducible Polycistronic m4f2a Lentivirus to Reprogram MEFs into ips Cells STEMGENT Page 1 OVERVIEW The following protocol describes the transduction and reprogramming of one well of Oct4-GFP mouse embryonic fibroblasts (MEF) using the Dox Inducible Reprogramming Polycistronic

More information

Supporting Information

Supporting Information Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05574 SUPPLEMENTARY INFORMATION Supplementary Results Additional Materials and Methods Analysis of epidermal wholemounts and sections: Tail epidermis. The patterned organisation of tail

More information

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.

Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA

More information

RNA-based, transient modulation of gene expression in human haematopoietic stem

RNA-based, transient modulation of gene expression in human haematopoietic stem Supplementary Information RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells Yvonne Diener 1, Marion Jurk 1, Britta Kandil 1, Yeong-Hoon Choi 2, Stefan

More information

Revised: RG-RV2 by Fukuhara et al.

Revised: RG-RV2 by Fukuhara et al. Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

More information

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System)

Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) Nucleofection (electroporation) of Cas9/ synthetic RNA ribonucleoprotein (RNP) complexes for CRISPR/Cas9 genome editing (Lonza Nucleofection System) BACKGROUND This protocol describes how to transfect

More information

Assay ID Assay name Description Components of the assay. 1. SYS-V441, phtr2a-v2r-ntev-tevs-gv. Cells 1. SYS-C10, PC12 (only SYS-A102C10)

Assay ID Assay name Description Components of the assay. 1. SYS-V441, phtr2a-v2r-ntev-tevs-gv. Cells 1. SYS-C10, PC12 (only SYS-A102C10) HTR2A/ARRB2 targetscreener Assay SYS-A102 SYS-A102C10 systasy bioscience GmbH Adams-Lehmann-Str. 56 80797 München Tel. +49 (0) 89 2155 3085 Fax. +49 (0) 89 4400 55853 E-mail: support@systasy.de Product

More information

Mouse Embryonic Stem Cell Differentiation to Hematopoietic Precursors Hogune Im

Mouse Embryonic Stem Cell Differentiation to Hematopoietic Precursors Hogune Im Mouse Embryonic Stem Cell Differentiation to Hematopoietic Precursors Hogune Im Molecular and Cellular Pharmacology Program, Department of Pharmacology, University of Wisconsin Medical School, Madison,

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Suspension Culture raav-modified GS -/- CHO Cell Line

Suspension Culture raav-modified GS -/- CHO Cell Line Suspension Culture raav-modified GS -/- CHO Cell Line CATALOG NO. HD-BIOP3 1.0 Product Description/Overview The raav-modified GS -/- CHO (Chinese Hamster Ovary) cell line HD-BIOP1 was created using Horizon

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D.

Use of Gene Editing Technologies in Rodents. Carlisle P. Landel, Ph.D. Use of Gene Editing Technologies in Rodents Carlisle P. Landel, Ph.D. The Mouse as A Model Mammal Small, easy to maintain, fecund Well understood genetics Similarity to humans >90% Availability of inbred

More information

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected

More information

Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes

Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes Human Skeletal Muscle Myoblast Care Manual: Maintenance and Differentiation from Myoblasts to Myocytes STORAGE CONDITIONS Media: Short Term 4 C 6 months -20 C F or research use only. Not approved for human

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

3T3-L1 Differentiation Protocol

3T3-L1 Differentiation Protocol 3T3-L1 Differentiation Protocol Written by Eisuke Kato on 2013/10/09 MATERIALS Dulbecco's Modified Eagles Medium (D-MEM) (High Glucose) with L-Glutamine and Phenol Red High glucose (Wako Chem 044-29765,

More information

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409

Data Sheet. Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Data Sheet Hedgehog Signaling Pathway Gli Reporter NIH3T3 Cell Line Catalog #: 60409 Product Description The Gli Reporter NIH3T3 Cell Line is designed for monitoring the activity of the hedgehog signaling

More information

THE DELIVERY EXPERTS PROTOCOL

THE DELIVERY EXPERTS PROTOCOL THE DELIVERY EXPERTS jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful molecule based on a polymer formulation manufactured at Polyplustransfection. jetprime

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

Supporting Information

Supporting Information Supporting Information Patel et al. 10.1073/pnas. SI Materials and Methods Cells and Reagents. Hepatocyte-derived H35 cells were grown in high glucose DMEM (Gibco) media, supplemented with 10% FBS, 2%

More information

Amaxa 4D-Nucleofector Protocol for Undifferentiated Human Mesenchymal Stem Cells [MSC] For 4D-Nucleofector X Unit Transfection in suspension

Amaxa 4D-Nucleofector Protocol for Undifferentiated Human Mesenchymal Stem Cells [MSC] For 4D-Nucleofector X Unit Transfection in suspension Amaxa 4D-Nucleofector Protocol For 4D-Nucleofector X Unit Transfection in suspension Self-isolated or Poietics Human Mesenchymal Stem Cells from bone marrow [Lonza, Cat. No. PT- 2501] Example for Nucleofection

More information

OPPF-UK Standard Protocols: Mammalian Expression

OPPF-UK Standard Protocols: Mammalian Expression OPPF-UK Standard Protocols: Mammalian Expression Joanne Nettleship joanne@strubi.ox.ac.uk Table of Contents 1. Materials... 3 2. Cell Maintenance... 4 3. 24-Well Transient Expression Screen... 5 4. DNA

More information

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x

To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x Supplementary methods: Cellular growth assay and cell cycle analysis To determine MRK-003 IC50 values, cell lines were plated in triplicate in 96-well plates at 3 x 10 3 cells/well (except for TALL1 and

More information

Long-lived protein degradation assay

Long-lived protein degradation assay Long-lived protein degradation assay Shun Kageyama, Takashi Ueno, Masaaki Komatsu METHOD Pulse and chase 1. Seed cells in 24-well plates in regular medium supplemented with 10% (v/v) heat-inactivated FBS

More information

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use

Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture. Catalog Number Guidelines for Use Corning BioCoat Matrigel Matrix 6-well Plates for Embryonic Stem (ES) Cell Culture Catalog Number 354671 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Growth and Maintenance of the 293A Cell Line

Growth and Maintenance of the 293A Cell Line Growth and Maintenance of the 293A Cell Line USER GUIDE Catalog Number R705-07 Publication Number MAN0000303 Revision A.0 For Research Use Only. Not for use in diagnostic procedures. The information in

More information

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and

8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna

More information

Supporting Online Material Y. Tang et al., published 1/24/03

Supporting Online Material Y. Tang et al., published 1/24/03 Y. Tang SOM, p. 1 Supporting Online Material Y. Tang et al., published 1/24/03 MATERIALS AND METHODS Construction of the Targeting Vector and Generation of Mice Carrying Mutations Targeting vector. Recombinant

More information

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Cellomics ToxInsight Phospho-ATM Activation Cartridge

Cellomics ToxInsight Phospho-ATM Activation Cartridge INSTRUCTIONS Cellomics ToxInsight Phospho-ATM Activation Cartridge High-Content Imaging Reagents Number Description 8408702 Phospho-ATM Activation Cartridge, sufficient materials for 5 96 wells Contents:

More information

Application Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction

Application Note. Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells. Introduction Laminin/Entactin Complex: A Feeder-Free Surface for Culture of Human Embryonic Stem Cells Deepa Saxena, Ph.D. and Susan Qian, Ph.D. Corning Incorporated, Tewksbury, MA, USA Application Note Contents 1

More information

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273

The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell

More information

Assay ID Assay name Description Components of the assay SYS-A124 ADRB2/ARRB2 targetscreener

Assay ID Assay name Description Components of the assay SYS-A124 ADRB2/ARRB2 targetscreener ADRB2/ARRB2 targetscreener Assay SYS-A124 SYS-A124C5 systasy bioscience GmbH Adams-Lehmann-Str. 56 80797 München Tel. +49 (0) 89 2155 3085 Fax. +49 (0) 89 4400 55853 E-mail: support@systasy.de Product

More information

ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita *

ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita * ips Cell Induction from Human Non-T, B Cells from Peripheral Blood Keisuke Okita * Department of Reprogramming Science, Center for ips Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan

More information

jetprime in vitro DNA & sirna transfection reagent PROTOCOL

jetprime in vitro DNA & sirna transfection reagent PROTOCOL jetprime in vitro DNA & sirna transfection reagent PROTOCOL DESCRIPTION jetprime is a novel powerful transfection reagent based on a polymer formulation manufactured at Polyplus-transfection. jetprime

More information

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days,

Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, Supplementary Figure 1. Expressions of stem cell markers decreased in TRCs on 2D plastic. TRCs were cultured on plastic for 1, 3, 5, or 7 days, respectively, and their mrnas were quantified by real time

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System)

Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) Electroporation of Cas9/Synthetic RNA Ribonucleoprotein (RNP) Complexes for CRISPR/Cas9 Genome Editing (Thermo Neon System) BACKGROUND This protocol describes how to transfect cultured cells with ribonucleoprotein

More information

species- Mus musculus Engineering the mouse genome David Ornitz

species- Mus musculus Engineering the mouse genome David Ornitz species- Mus musculus Engineering the mouse genome David Ornitz How do we analyze gene function in mice? Gene addition (transgenic approach) Permits GOF, DN and knockdown experiments Ectopic (spatial or

More information