8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and
|
|
- Lionel Stevens
- 5 years ago
- Views:
Transcription
1 1 Supplemental information 2 3 Materials and Methods 4 Reagents and animals 5 8Br-cAMP was purchased from Sigma (St. Louis, MO). Silencer Negative Control sirna #1 and 6 Silencer Select Pre-designed sirna for NR5A2 (s5380 and s5381; Ambion, Carlsbad, CA). Immature 7 C57BL/6J mice (21 28 d of age) were purchased from Charles River Laboratory (Wilmington, MA). 8 Fresh-frozen rabbit ovary was purchased from Funakoshi Co. (Tokyo, Japan). Fresh-frozen human ovary 9 was purchased from ILSbio (ILS7190 N03-DS1; Chestertown, MD) RACE 12 Total RNAs were extracted from immature C57BL/6J mice (21 28 d of age) ovary and fresh-frozen 13 rabbit ovary. The 5 RACE-Ready cdnas were synthesized using the GeneRacer Kit (Invitrogen) 14 or SMARTer RACE cdna Amplification Kit (Clontech Laboratories, Inc., Mountain View, CA) 15 according to the manufacturer s instructions. Cap site cdna dt Rat Ovary was purchased from 16 Nippon Gene (Tokyo, Japan). PCR for RACE was performed in a 50 μl reaction mixture comprising 17 KOD -Plus- (Toyobo). The gene-specific primers for RACE are listed in Supplemental Table
2 19 Progesterone production 20 KGN cells were infected with the recombinant adenoviruses. Culture media were collected at 48 h 21 after infection for the measurement of progesterone production by an ELISA kit (Cayman Chemical 22 Co., Ann Arbor, MI) according to the manufacturer s instructions Supplemental figure legends 25 Supplemental FIG. 1. Identification of novel LRH-1 transcripts in rodent and rabbit ovaries. 26 Genomic structure, nucleotide and deduced amino acid sequences of rat (A), mouse (B) and rabbit (C) 27 ovarian LRH-1 are shown. Exons are shown as filled boxes. The novel exon (exon 2o or exon 3o) is 28 shown as an open box. The reported TSS and ovarian TSS are shown as arrows Supplemental FIG. 2. Human ovarian LRH-1 promotes expression of steroidogenesis-related genes 31 in KGN cells. A, Activation of promoter activities of CYP11A1, HSD3B2 and StAR by granulosa 32 cell-derived LRH-1 (gc-lrh-1). KGN cells were transiently transfected with reporter plasmids ( ng) and expression vector (5 ng). KGN cells were treated with or without 8Br-cAMP (1mM) for 12 h 34 before measurements of luciferase activities. Luciferase activities were measured and relative 35 activities are shown. B, Effects of sirna for LRH-1 on endogenous LRH-1 and SF-1 in KGN cells. 36 Synthetic sirnas for LRH-1 (s5380: silrh-1 #1; s5381: silrh-1 #2) or control (sicontrol) were 2
3 37 introduced into KGN cells. C, Effects of sirna on expression of steroidogenesis-related genes in 38 KGN cells. KGN cells were treated with or without 8Br-cAMP (1mM) for 12 h before RNA 39 extraction. The gene-specific primers for RT-PCR are listed in Supplemental Table 1. Lanes C, #1 and 40 #2 represent sicontrol, silrh-1 #1 or #2 transfection. Each value represents the mean ± SE of three 41 independent experiments. *, P < 0.05; and **, P < 0.01 vs. control Supplemental FIG. 3. Identification of the transcription factor binding sites of a GC box (A and B) 44 and a putative SF-1 binding site (C and D) by EMSA. Each end-labeled oligonucleotide was 45 incubated with μg nuclear extracts from KGN cells (A), fresh-frozen human ovary (B), 46 HEK293 cells transfected with pcmv-tag3b-sf-1 (C) or HEK293 cells transfected with 47 pcmv-tag3b-gc-lrh-1 (D). DNA-protein complexes were separated by electrophoresis on a 48 nondenaturing 4% (A) or 6% (B-D) polyacrylamide gel. Unlabeled wild-type (WT) and mutated 49 (Mut) oligonucleotides were used as competitor DNAs. Wild-type and mutated oligonucleotides 50 sequences are shown in the left panel. Bold capital letters indicate mutated sequences. Where 51 indicated, antibodies against Sp1, Sp3 or LRH-1 were used for supershift analysis. Arrows indicate 52 specific DNA-protein complexes. Arrowheads indicate supershifted complexes Supplemental FIG. 4. A, Effect of mutation in the GC box within the promoter region of human 3
4 55 ovarian LRH-1 in KGN cells. The mutant promoter constructs used are drawn schematically. B, 56 Dose-dependent effects of SF-1 on the promoter activity of human ovarian LRH-1 in KGN cells. 57 Reporter plasmids (100 ng) and expression vectors (0, 1, 2.5, 5 ng) were transiently transfected into 58 KGN cells. The total amount of transfected plasmid was adjusted with an empty vector. Luciferase 59 activities were measured and relative activities are shown. Each value represents the mean ± SE of 60 three independent transfection experiments. Letters indicate a significant difference (P < 0.05) Supplemental FIG Progesterone production was augmented with PGC-1α in KGN cells. KGN cells were infected with 64 Adx-GFP or Adx-PGC-1α. Medium was collected at 48 h after infection for measurement of 65 progesterone at the end of culture. Progesterone levels were measured by an ELISA kit. Each value 66 represents the mean ± SE of three independent experiments. N.D., Not detected. 4
5 67 Supplemental Figure 1 68 A new exon (exon 3o) 3o ovarian LRH-1 exon 3 B new exon (exon 3o) 3o ovarian LRH-1 exon 3 C new exon (exon 2o) 2o ovarian LRH-1 exon 2 5
6 69 Supplemental Figure 2 70 A Relative luciferase activity (Fold) * ** CYP11A1 2.3kb HSD3B2 1.25kb ** pcdna3 gc-lrh-1 pcdna3 + camp gc-lrh-1 + camp ** ** ** ** ** StAR 1.3kb B C 1.0 LRH SF-1 Relative mrna level ( LRH-1 / β-actin) sicontrol ** ** silrh-1 #1 silrh-1 #2 Relative mrna level ( SF-1 / β-actin) sicontrol silrh-1 #1 silrh-1 #2 LRH-1 SF-1 CYP11A1 HSD3B2 StAR CYP19A1 β-actin camp(-) camp(+) C #1 #2 C #1 #2 6
7 71 Supplemental Figure 3 72 A GC box WT : gccccgaggaggcggaggca Mut1: gccccttggaggcggaggca Mut2: gccccgattaggcggaggca Mut3: gccccgaggttgcggaggca Mut4: gccccgaggagttggaggca Mut5: gccccgaggaggcttaggca Mut6: gccccgaggatttttaggca probe -72/-53-72/-53 antibody competitor Sp1 Sp3 Sp3 super shift B probe -72/-53 antibody competitor Sp1/Sp3 Sp C probe -157/ /-130 competitor - - D probe -157/-130 antibody competitor - - SF-1 binding sites WT : ttttttaaccctgacctcctcctcgcag Mut1: ttttttaaccctgaaatcctcctcgcag Mut2: ttttttaaaactgacctcctcctcgcag Mut3: ttttttaaaactgaaatcctcctcgcag Mut4: ttttttaaccctgacctaataatcgcag Mut5: ttttttaaaactgaaataataatcgcag SF-1 LRH-1 7
8 73 74 Supplemental Figure 4 A B -67/+68-57/+68 pgl3 Basic Relative luciferase activity (Fold) GC box X a a a a Luc -67/+68 Mut-GC box Luc Luc Luc a a Relative luciferase activity (Fold) b c c b b c SF pgl3 Basic -205/+68 (ng) 8
9 75 Supplemental Figure Progesterone (ng/mg protein) N.D. GFP PGC-1α 9
10 77 Supplemental TABLE 1. Nucleotide sequences of oligonucleotides used in PCR Usage Sense Antisense RACE-PCR Rat 5'-RACE 1 st PCR 5'-GATGCTAGCTGCGAGTCAAGTC-3' 5'-CAGACACTTTATCGCCACACACAGG-3' Rat 5'-RACE 2 nd PCR 5'-CGAGTCAAGTCGACGAAGTGC-3' 5'-GTTCCCCATGCGATCGGACCAGTCC-3' Mouse 5'-RACE 1 st PCR 5'-CGACTGGAGCACGAGGACACTGA-3' 5'-CAGACACTTTATCGCCACACACAGG-3' Mouse 5'-RACE 2 nd PCR 5'-GGACACTGACATGGACTGAAGGAGTA-3' 5'-GTTCCCCATGCGATCGGACCAGTCC-3' Rabbit 5'-RACE 1 st PCR 5'-CTAATACGACTCACTATAGGGC-3' 5'-CATGCGGTCGGCTCTTACAGCTTCC-3' Rabbit 5'-RACE 2 nd PCR 5'-AAGCAGTGGTATCAACGCAGAGT-3' 5'-TCCACACACGGGGCACAGCTCCTCG-3' RT-PCR SF-1 5'-ACCACATCTACCGCCAGGTCCAG-3' 5'-TACTCCTTGGCCTGCATGCTCAG-3' CYP11A1 5'-GAAAGGAAGTGTTCACCACG-3' 5'-TAGTGTCTCCTTGATGCTGG-3' HSD3B2 5'-GTGACAGGAGCAGGAGGG-3' 5'-CTGGGTACCTTTCACATTGACAT-3' StAR 5'-GAGAGTCAGCAGGACAATGG-3' 5'-CTGGTTGATGATGCTCTTGG-3' CYP19A1 5'-GTGGACTTGGTCATGCGCA-3' 5'-TCATCATCACCATGGCGATG-3' 10
Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationLegend for Supplemental Figures and Tables
Legend for Supplemental Figures and Tables Supplemental Fig. 1. Negative regulation of the CYP27B1 promoter in a ligand-dependent manner (A) OK-P cells were transfected with pcdna-trα, pcdna-trβ1 or pcdna3
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationTable 1. Primers, annealing temperatures, and product sizes for PCR amplification.
Table 1. Primers, annealing temperatures, and product sizes for PCR amplification. Gene Direction Primer sequence (5 3 ) Annealing Temperature Size (bp) BRCA1 Forward TTGCGGGAGGAAAATGGGTAGTTA 50 o C 292
More information/04/$15.00/0 Molecular Endocrinology 18(3): Copyright 2004 by The Endocrine Society doi: /me
0888-8809/04/$15.00/0 Molecular Endocrinology 18(3):588 605 Printed in U.S.A. Copyright 2004 by The Endocrine Society doi: 10.1210/me.2003-0090 Increased Cytochrome P450 17 -Hydroxylase Promoter Function
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationEstradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway
Estradiol-Estrogen Receptor α Mediates the Expression of the CXXC5 Gene through the Estrogen Response Element-Dependent Signaling Pathway Pelin Yaşar, Gamze Ayaz and Mesut Muyan SUPPLEMENTARY INFORMATION
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1154040/dc1 Supporting Online Material for Selective Blockade of MicroRNA Processing by Lin-28 Srinivas R. Viswanathan, George Q. Daley,* Richard I. Gregory* *To whom
More informationSupplemental Table S1. RT-PCR primers used in this study
Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------
More informationGenomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two
Supplemental Materials and Methods Genomic DNA fragments identified by ChIP-chip assay for MR [28] corresponding to two upstream regions of the human Klf9 gene (-5139 to -5771 bp and -3875 to -4211 bp)
More informationFig Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization
FIGURES AND TABLES Fig. 1-1. Hypoxia causes growth retardation and developmental delay. (A) Morphology of wildtype zebrafish embryos at 48 hours post fertilization (hpf) after 24 h of normoxia or hypoxia
More informationSite-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter
Supplement Supporting Materials and Methods Site-Directed Mutagenesis. Mutations in four Smad4 sites of mouse Gat1 promoter were independently generated using a two-step PCR method. The Smad4 binding site
More informationused at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies were
1 Supplemental Methods Reagents and chemicals: TGFβ was a generous gift from Genzyme Inc. (Cambridge, MA) and was used at a final concentration of 5 ng/ml. Rabbit anti-bim and mouse anti-mkp2 antibodies
More informationOnline Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
More informationSupplemental Data. Cui et al. (2012). Plant Cell /tpc a b c d. Stem UBC32 ACTIN
A Root Stem Leaf Flower Silique Senescence leaf B a b c d UBC32 ACTIN C * Supplemental Figure 1. Expression Pattern and Protein Sequence of UBC32 Homologues in Yeast, Human, and Arabidopsis. (A) Expression
More informationSupplemental Material Igreja and Izaurralde 1. CUP promotes deadenylation and inhibits decapping of mrna targets. Catia Igreja and Elisa Izaurralde
Supplemental Material Igreja and Izaurralde 1 CUP promotes deadenylation and inhibits decapping of mrna targets Catia Igreja and Elisa Izaurralde Supplemental Materials and methods Functional assays and
More informationTable S1. Primers used in RT-PCR studies (all in 5 to 3 direction)
Table S1. Primers used in RT-PCR studies (all in 5 to 3 direction) Epo Fw CTGTATCATGGACCACCTCGG Epo Rw TGAAGCACAGAAGCTCTTCGG Jak2 Fw ATCTGACCTTTCCATCTGGGG Jak2 Rw TGGTTGGGTGGATACCAGATC Stat5A Fw TTACTGAAGATCAAGCTGGGG
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL MATERIALS AND METHODS Generation of TSPOΔ/Δ murine embryonic fibroblasts Embryos were harvested from 13.5-day pregnant TSPOfl/fl mice. After dissection to eviscerate and remove the
More informationSupplementary Table 1. Sequences for BTG2 and BRCA1 sirnas.
Supplementary Table 1. Sequences for BTG2 and BRCA1 sirnas. Target Gene Non-target / Control BTG2 BRCA1 NFE2L2 Target Sequence ON-TARGET plus Non-targeting sirna # 1 (Cat# D-001810-01-05) sirna1: GAACCGACAUGCUCCCGGA
More informationKhaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
More informationSUPPLEMENTARY INFORMATION
6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplemental Table 1: Sequences of real time PCR primers. Primers were intronspanning
Symbol Accession Number Sense-primer (5-3 ) Antisense-primer (5-3 ) T a C ACTB NM_001101.3 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA 57 HSD3B2 NM_000198.3 CTTGGACAAGGCCTTCAGAC TCAAGTACAGTCAGCTTGGTCCT 60
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation
More informationFig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.
Fig. S1. Effect of p120-catenin overexpression on the interaction of SCUBE2 with E-cadherin. The expression plasmid encoding FLAG.SCUBE2, E-cadherin.Myc, or HA.p120-catenin was transfected in a combination
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationTable S1. Nucleotide sequences of synthesized oligonucleotides for quantitative
Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3
More informationSupplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
More informationSUPPLEMENTARY MATERIALS
SUPPLEMENTARY MATERIALS Supplementary Table S1: List of primers used for ChIP analysis and Oligo-pull-down assay. Genes Sequence mppargc1a FW 5 -GCGAGGTTTCTGCTTAGTCA-3 (-2317) RV 5 -ACAATGACTAAGCAGAAACCTCG-3
More informationComparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila
Molecular Cell, Volume 32 Supplemental Data Comparative Analysis of Argonaute-Dependent Small RNA Pathways in Drosophila Rui Zhou, Ikuko Hotta, Ahmet M. Denli, Pengyu Hong, Norbert Perrimon, and Gregory
More informationNUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE
NUCLEIC ACID PURIFICATION KITS FAST SIMPLE QUALITY CONVENIENT REPRODUCIBLE COMPANY PROFILE Since its founding in 1998,, Inc. has been at the forefront of nucleic acid purification by offering products
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationLiver receptor homolog 1 transcriptionally regulates human bile salt export pump expression
University of Rhode Island DigitalCommons@URI Biomedical and Pharmaceutical Sciences Faculty Publications Biomedical and Pharmaceutical Sciences 2008 Liver receptor homolog 1 transcriptionally regulates
More informationSupplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell
Supplementary Information Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell Supplementary Figures S1-S3 Supplementary Methods Supplementary Figure S1. Identification
More informationall samples of a band with a molecular weight close to that expected for the endogenous!-
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1 : Specificity of anti-!-arrestin Abs and levels of!-arrestin in WHIM wt leukocytes. (A and B) HEK 293T cells were transiently transfected using the reagent
More informationSupplementary Information. A novel human endogenous retroviral protein inhibits cell-cell fusion. Supplementary Figures:
Supplementary Information A novel human endogenous retroviral protein inhibits cell-cell fusion Jun Sugimoto, Makiko Sugimoto, Helene Bernstein, Yoshihiro Jinno and Danny J. Schust Supplementary Figures:
More informationSupplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2
Supplementary Figure 1 Phosphorylated tau accumulates in Nrf2 (-/-) mice. Hippocampal tissues obtained from Nrf2 (-/-) (10 months old, 4 male; 2 female) or wild-type (5 months old, 1 male; 11 months old,
More informationtranscription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected with the wwp-luc reporter, and FLAG-tagged FHL1,
Supplementary Data Supplementary Figure Legends Supplementary Figure 1 FHL-mediated TGFβ-responsive reporter transcription and the promoter occupancy of Smad proteins. (A) HepG2 cells were co-transfected
More informationDocument S1. Supplemental Experimental Procedures and Three Figures (see next page)
Supplemental Data Document S1. Supplemental Experimental Procedures and Three Figures (see next page) Table S1. List of Candidate Genes Identified from the Screen. Candidate genes, corresponding dsrnas
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12119 SUPPLEMENTARY FIGURES AND LEGENDS pre-let-7a- 1 +14U pre-let-7a- 1 Ddx3x Dhx30 Dis3l2 Elavl1 Ggt5 Hnrnph 2 Osbpl5 Puf60 Rnpc3 Rpl7 Sf3b3 Sf3b4 Tia1 Triobp U2af1 U2af2 1 6 2 4 3
More informationSupplementary Information
Supplementary Information Sam68 modulates the promoter specificity of NF-κB and mediates expression of CD25 in activated T cells Kai Fu 1, 6, Xin Sun 1, 6, Wenxin Zheng 1, 6, Eric M. Wier 1, Andrea Hodgson
More informationTranscriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex
POSTER PRESENTATION Transcriptional regulation of IFN-l genes in Hepatitis C virus-infected hepatocytes via IRF-3 IRF-7 NF- B complex Hai-Chon Lee *, Je-In Youn, Kyungwha Lee, Hwanyul Yong, Seung-Yong
More informationRevised: RG-RV2 by Fukuhara et al.
Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the
More informationSupplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.
Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of
More informationSupporting Information
Supporting Information SI Materials and Methods RT-qPCR The 25 µl qrt-pcr reaction mixture included 1 µl of cdna or DNA, 12.5 µl of 2X SYBER Green Master Mix (Applied Biosystems ), 5 µm of primers and
More informationSupplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern
Supplementary Figure 1 Validate the expression of mir-302b after bacterial infection by northern blot. Northern blot analysis of mir-302b expression following infection with PAO1, PAK and Kp in (A) lung
More informationSUPPLEMENTARY EXPEMENTAL PROCEDURES
SUPPLEMENTARY EXPEMENTAL PROCEDURES Plasmids- Total RNAs were extracted from HeLaS3 cells and reverse-transcribed using Superscript III Reverse Transcriptase (Invitrogen) to obtain DNA template for the
More informationSupplementary Fig.1. Over-expression of RNase L in stable polyclonal cell line
Supplemental Data mrna Protein A kda 75 40 NEO/vector NEO/RNase L RNASE L β-actin RNASE L β-actin B % of control (neo vector), normalized 240 ** 200 160 120 80 40 0 Neo Neo/RNase L RNase L Protein Supplementary
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationMeCP2. MeCP2/α-tubulin. GFP mir1-1 mir132
Conservation Figure S1. Schematic showing 3 UTR (top; thick black line), mir132 MRE (arrow) and nucleotide sequence conservation (vertical black lines; http://genome.ucsc.edu). a GFP mir1-1 mir132 b GFP
More informationFig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector.
Fig. S1. eif6 expression in HEK293 transfected with shrna against eif6 or pcmv-eif6 vector. (a) Western blotting analysis and (b) qpcr analysis of eif6 expression in HEK293 T cells transfected with either
More informationThyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation
1 2 3 4 5 SUPPLEMENTAL DATA Thyroid peroxidase gene expression is induced by lipopolysaccharide involving Nuclear Factor (NF)-κB p65 subunit phosphorylation Magalí Nazar, Juan Pablo Nicola, María Laura
More informationPartial list of differentially expressed genes from cdna microarray, comparing MUC18-
Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18
More informationSupplemental Data. Sethi et al. (2014). Plant Cell /tpc
Supplemental Data Supplemental Figure 1. MYC2 Binds to the E-box but not the E1-box of the MPK6 Promoter. (A) E1-box and E-box (wild type) containing MPK6 promoter fragment. The region shown in red denotes
More informationSUPPLEMENTARY INFORMATION
Secondary mutations as a mechanism of cisplatin resistance in BRCA2-mutated cancers Wataru Sakai, Elizabeth M. Swisher, Beth Y. Karlan, Mukesh K. Agarwal, Jake Higgins, Cynthia Friedman, Emily Villegas,
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Guide-it Products for Successful CRISPR/Cas9 Gene Editing - Why choose Guide-it products? Optimized methods designed for speed and ease of use Complete kits that don t
More informationCRISPR/Cas9 Gene Editing Tools
CRISPR/Cas9 Gene Editing Tools - Separations Simply Spectacular INDELS Identify indels Determine if one or both copies of your gene have indels The Guide-it Genotype Confirmation Kit: Simple detection
More informationQuant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
More informationUSP19 modulates autophagy and antiviral immune responses by. deubiquitinating Beclin-1
USP19 modulates autophagy and antiviral immune responses by deubiquitinating Beclin-1 Shouheng Jin 1,2,, Shuo Tian 1,, Yamei Chen 1,, Chuanxia Zhang 1,2, Weihong Xie, 1 Xiaojun Xia 3,4, Jun Cui 1,3* &
More information- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
More informationA novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase
A novel tool for monitoring endogenous alpha-synuclein transcription by NanoLuciferase tag insertion at the 3 end using CRISPR-Cas9 genome editing technique Sambuddha Basu 1, 3, Levi Adams 1, 3, Subhrangshu
More informationTranslation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
More informationRegulation of transcription by the MLL2 complex and MLL complex-associated AKAP95
Supplementary Information Regulation of transcription by the complex and MLL complex-associated Hao Jiang, Xiangdong Lu, Miho Shimada, Yali Dou, Zhanyun Tang, and Robert G. Roeder Input HeLa NE IP lot:
More informationGenomic DNA was extracted from 3 to 5 ml of blood collected in EDTA blood collection tubes
Supplementary information Methods DNA and RNA extraction Genomic DNA was extracted from to ml of blood collected in EDTA blood collection tubes using the Gentra Puregene Blood kit (Qiagen, California,
More informationSupplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice.
% (a) MII AII Pronucleus (b) 3 F-Actin / Tubulin / DAPI 1 WT KO Supplemental Figure 1. The parthenogenetic activation of oocytes recovered from oviducts of gcnrg1 KO mice and wild type mice. (a) Triple
More informationSupporting Information
Supporting Information Horie et al. 10.1073/pnas.1008499107 SI Materials and Methods ell ulture and Reagents. THP-1 cells were obtained from the American Type ell ollection. THP-1 cells were transformed
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationSupplementary Information
Supplementary Information Supplementary Figure 1: Synthetic annealed poly(ra):poly(dt) hybrid induces type I interferon response. a) Bone marrow derived macrophages (BMDM) were transfected with or without
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationBlimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling
1 2 3 4 5 6 7 8 9 10 11 Supplementary Methods Antibodies Blimp-1/PRDM1 rabbit monoclonal antibody (C14A4) was purchased from Cell Signaling (Danvers, MA) and used at 1:1000 to detect the total PRDM1 protein
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationA Repressor Complex Governs the Integration of
Developmental Cell 15 Supplemental Data A Repressor Complex Governs the Integration of Flowering Signals in Arabidopsis Dan Li, Chang Liu, Lisha Shen, Yang Wu, Hongyan Chen, Masumi Robertson, Chris A.
More informationQUICK-Clone TM User Manual. cdna
QUICK-Clone TM User Manual cdna PT1150-1 (PR752268) Published 25 May 2007 Table of Contents I. Introduction 3 II. Applications Discussion 4 A. Primer Design 4 B. Setting up the PCR Reaction 4 C. Example
More informationTITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach
AD Award Number: W81XWH-05-1-0109 TITLE: Restoration of Wild-Type Activity to Mutant p53 in Prostate Cancer: A Novel Therapeutic Approach PRINCIPAL INVESTIGATOR: James Manfredi, Ph.D. CONTRACTING ORGANIZATION:
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationCFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1
A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationSUPPLEMENTARY INFORMATION. LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans
SUPPLEMENTARY INFORMATION LIN-28 co-transcriptionally binds primary let-7 to regulate mirna maturation in C. elegans Priscilla M. Van Wynsberghe 1, Zoya S. Kai 1, Katlin B. Massirer 2-4, Victoria H. Burton
More informationDig System for Starters
Dig System for Starters Content 1. Powerful and Versatile DIG System 2. Labeling Nucleic Acids using the DIG System 3. Critical Hints for PCR Labeling 1 2 3 1. Powerful and Versatile DIG System Powerful
More informationThe Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273
Data Sheet The Transfection Collection TCF/LEF Transient Pack Wnt / -catenin Signaling Pathway Catalog #: 79273 Background The Wnt / -catenin signaling pathway controls a large and diverse set of cell
More informationConstruction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
More informationSomatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb
Cell Reports Supplemental Information Somatic Primary pirna Biogenesis Driven by cis-acting RNA Elements and Trans-Acting Yb Hirotsugu Ishizu, Yuka W. Iwasaki, Shigeki Hirakata, Haruka Ozaki, Wataru Iwasaki,
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationWeaver 4th ed Ch 4+5 Methods etc
Methods Weaver 4th ed Ch 4+5 Methods etc Chapter 4 Cloning pg 52 Restriction endonucleases pg 54 Vectors pg 56 Replica plating pg 63 Probes pg 64 cdnas pg 66 RACE (Rapid amplification of cdna ends) pg
More informationFile name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:
File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description: Supplementary Figure 1. dcas9-mq1 fusion protein induces de novo
More informationData Sheet. SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654
Data Sheet SBE Reporter Kit (TGFβ/SMAD signaling pathway) Catalog #: 60654 Background The transforming growth factor beta (TGFβ) signaling pathway is involved in a diverse range of cell processes such
More informationGuide-it sgrna In Vitro Transcription and Screening Systems User Manual
Clontech Laboratories, Inc. Guide-it sgrna In Vitro Transcription and Screening Systems User Manual Cat. Nos. 631438, 631439 & 631440 (042114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationSupporting Information
Supporting Information Patel et al. 10.1073/pnas. SI Materials and Methods Cells and Reagents. Hepatocyte-derived H35 cells were grown in high glucose DMEM (Gibco) media, supplemented with 10% FBS, 2%
More informationTRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:
TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene
More informationRapid amplification of cdna ends (RACE)
Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More information