Genome Scanning by Composite Likelihood Prof. Andrew Collins
|
|
- Cuthbert Hood
- 5 years ago
- Views:
Transcription
1 Andrew Collins and Newton Morton University of Southampton Frequency by effect Frequency Effect 2 Classes of causal alleles Allelic Usual Penetrance Linkage Association class frequency analysis Maj or gene Rare High Oligogene Common Low + ++ Polygene Common Very low Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 1
2 Fifty years of genetic epidemiology Double helix First steps Segregation and linkage Major loci, cytogenetics DNA markers Where are the causal genes? Complex inheritance Human genome Genome analyses, association mapping 4 Occurs during meiosis Recombination Essential for chromosome segregation Breaks haplotypes: increases haplotype diversity Breakage -> mapping disease-related loci Recombination not random hot-spots Recombination frequencies from linkage in families (polymorphic markers) Linkage map -> recombination structure 5 Linkage mapping of disease genes M D M D M D 6 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 2
3 Linkage disequilibrium LD - linked alleles inherited together more often than expected under random segregation Reflects inheritance of ancestral haplotypes (chromosome segments) transmitted un-recombined across many generations Disease polymorphism located using LD (association) between marker allele and disease status (-> case-control study) 7 Mapping disease genes by linkage disequilibrium M D After n generations D M D M M D D M D M D D 8 Not all allelic association is due to LD Direct causation: having allele M causes disease D Natural selection: having allele M is protective if you have disease D Population stratification - population subgroups with M and D more frequent in one subgroup Statistical artifact inadequate correction for number of tests Linkage disequilibrium - close linkage produces association with M if D chromosomes descended from a few ancestral chromosomes 9 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 3
4 Single nucleotide polymorphisms (SNPs) Single-base changes usually two allelic forms Very abundant in the genome (~15 million) A tiny proportion influence disease directly but most are markers for association with disease Ideal for automated chip genotyping technologies 500,000 SNP chips becoming cost effective 10 Association between pairs of SNPs SNP Marker Causal SNP B R b 1-R Total A Q Observed Expected AB n11 p 11 = QR + D Ab n12 p 12 = Q(1-R) - D Q a 1-Q Observed Expected ab n21 p 21 = R(1-Q) - D ab n22 p 22 = (1-R)(1-Q) + D 1-Q Total R 1-R 1 11 Association (ρ) Covariance D between pairs SNPs efficiently estimated for haplotypes and diplotypes Hill (1974 heredity, 33, )-> obtain D iteratively (EM) 3 x 3 genotype table reduces to haplotype frequencies: π11 π12 π21 π22 Allele frequencies: Q = π11 + π12 R = π11 + π21 ρ requires Q < R, Q<1-R, π11 π22 > π12 π21 D = π11 π22 π12 π21 ρ = D / Q (1- R) 12 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 4
5 Linkage disequilibrium (LD) by distance The Malecot model ρ = (1 - L) Me -εd + L 13 Linkage disequilibrium unit (LDU) maps and the LDMAP program What is an LD map? A map expressed in LD units (LDU) with additive distances discriminating blocks of conserved LD with distances and locations analogous to genetic linkage maps A linkage disequilibrium map is needed to: Facilitate gene mapping by association Enhance the resolution of the linkage map Compare populations Detect selective sweeps and other evolutionary events 15 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 5
6 Constructing linkage disequilibrium maps Linkage disequilibrium unit (LDU) SNP 2 ρ = (1 L) Me -εd + L SNP 3 SNP 4 SNP 5 Recombination hotspot SNP Physical Dist. (Kb) ρ ρ ρ ρ LDU Map SNP LDU = SNP 2, 3 SNP 4, 5 LDU = 0.5 LDU = 0.0 LDU = 0.0 LDU = ε X d Kb Kb Kb Kb 16 The graph of LD map, 216-Kb segment of class II region of MHC? Recombination hot spots from Jeffreys et al. (2001): 216-Kb 17 LD maps for isolated populations 11 population isolates + 1 outbred sample of Caucasians 200 unrelated individuals each Chromosome 22, ~ 2486 SNPs, ~ 13.8 Kb marker spacing Only 3.5% of gaps > 50 Kb Large sample, many populations, very uniform comparisons Service et al., Nat Genet 38, 2006, Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 6
7 Demographic history of population isolates Population Years since founding Founding group Pop. size Antioquia, Colombia (ANT) s 1000 s 4 million Ashkenazi (ASH) s 10.5 million Azores (AZO) 650 large 250,000 Costa Rican Central Valley (CR) million SW Netherlands (ERF) <400 <400 20,000 Early Settlement Fin (FIC) s 1000 s 130,000 Late Settlement Fin Kuusamo (FIK) ,000 Finland Nationwide (FIP) s 1000 s 5.2 million Newfoundland (NFL) 400 6,000 10, ,000 Afrikaner (SAF) million Sardinia (SAR) > , Isolates LD pattern conserved across populations Differences in extent of LD (20-45% shorter map for isolates compared to CAU) Kuusamo recent founding, famine bottleneck, few founders far more extensive LD Extensive LD: recently founded (CR, ANT); older but recent bottleneck (ASH, early settlement Finland) followed by rapid expansion Some isolates look like general populations (AZO, NFL): many founders, limited expansion (persons separated by more meiotic steps) Afrikaner population is a puzzle (less LD than expected) 21 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 7
8 Haplotype Map (HapMap) Project $100 million public-priv ate effort Objectiv e: To develop a genome-wide haplotype map for identifying haplotype blocks and the common haplotypes in Yoruban, CEPH, Japanese and Chinese samples ->millions of genotypes in two phases from the four populations 22 and genome-wide LD maps Caucasian (CEU), Chinese (CHB), Japanese (JPT), Yoruban (YRI) Phase I Phase II Number of SNPs 0.67~0.78 million 1.88~2.34 million SNP density 1 SNP per 3.75 ~4.40 Kb 1 SNP per 1.26~1.56 Kb Intervals 74% intervals <5 Kb 91% intervals <8 Kb 81% intervals <2 Kb 93% intervals <4 Kb Build 34 July 03 Build 35 May Phase I and phase II maps Linkage Disequilibrium Units (LDUs) CEU population Physical distance (Kb) 24 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 8
9 HapMap chromosome 19 LD and linkage maps 25 Phase II data for chromosome 22 Linkage Disequilibrium Units (LDUs) Kilo bases 26 Relationship between LDU (phase II) and linkage map 27 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 9
10 Association mapping by linkage disequilibrium and the CHROMSCAN program 28 HFE region of chromosome 6 29 Association mapping (CHROMSCAN) z = (ad-bc)/(a+b)(b+d) for SNP allele count x affection Z = (1-L)Me -ε (Sk-S) + L Model A (M = 0, L = Lp), model D (M, S, L estimated) compute difference (X) in Λ = ΣK z (z Z) 2 for models A and D Compute error variance (V) free of autocorrelation: ij denotes replicates (i) in region (j) Replicates (H 0):(-> rank of X) P ij X ij /χ 2 ij V ij For H 1 V j and hence P j estimated from replicates, location standard error (SE) from the information (K) about S 30 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 10
11 Composite likelihood and meta-analysis Disadvantage: Autocorrelation requires simulation by shuffling to obtain standard error (SE) of estimated location S Advantages: Information for meta-analysis is K = (1/SE) 2 Mean S = S ik i/ K i Does not assume causal SNP in sample Extracts appropriate LD information from regional LD map 31 LD mapping identifies 390 Kb region associated with CYP2D6 poor drug metabolizing activity CYP2D6 metabolises 20% of marketed drugs Poor metaboliser (PM) phenotype has frequency 5-10% in Caucasians Five mutations contribute to PM phenotype (> 99% of cases in Caucasians) 1018 Caucasians genotyped for 27 CYP2D6 polymorphisms, 41 individuals with predicted PM phenotype (Hosking et al., 2002, Pharmacogenomics J. 2(3): ) 32 Meng et al., (2003) Am J Hum Genet 73: Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 11
12 Comparison of kilobase and LDU maps Map Chi - square Location (Kb) Error (Kb) 95% CI Kb LDU (177) Kb (83) LDU HapMap and CYP LDU maps for the CYP2D6 region CYP HapMap Kb CYP2D6 35 Comparison of alternative LDU maps Map Scale Chisquare Location (Kb) Error (Kb) 95% CI CYP2D6 LDU (177) HapMap LDU (198) 36 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 12
13 Localization of CYP2D6 Authors Interv al (Kb) Error (Kb) Hosking et al. 390? Morris AP (2005) 185 >30 * (Genetic Epidemiol 29(2): ) This study * Estimated from graph 37 CFH gene identified from 96 cases + 50 controls (116,204 SNPs typed) Gene located on chromosome 1 in region implicated in linkage studies Nominal p-value = CHROMSCAN analysis of chromosome 1 yields 202 regions Permutation p-value for region 154 (A-D model) = , Chi-square (3df) = 27.6 Klein et al. (2005), Complement factor H polymorphism in age-related macular degeneration; Science 308, Chromosome 1 - AMD 39 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 13
14 mssnps Chi-squares for association between phenotype and individual SNPs commonly examined Most significant ms SNP used to guide further genotyping on more samples Potentially misleading: only small fraction of total SNPs tested, significance levels hugely distorted, information from LD structure and neighbouring SNPs ignored therefore power is low 40 mssnp Chi-squares (201 regions, chromosome 1) 6 Permutation-based (mean ~1) Uncorrected (mean ~4.7) 41 P value distribution for 201 regions on chromosome 1 (CFH data) 42 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 14
15 Genome-wide association: conclusions Modelling association between multiple SNPs and disease maximises power (using LD map) Robustly determined p-values require permutation-based test Parallel computing analyses regions efficiently on distributed cluster (e.g., Beowulf) First stage identifies small number of regions for follow up Further sample(s) to confirm interesting regions Simple meta-analysis can be applied given locations and standard errors from independent samples/studies Ultimately functional tests are required for putatively causal variants 43 Publications Maniatis et al., 2002; The first Linkage Disequilibrium (LD) maps: PNAS, USA; 99(4): Morton, N., Maniatis, N., Zhang, W., Ennis, S., Collins, A. Genome scanning by composite likelihood; Am J Hum Genet 80 (1), 2007, Software LDMAP - LD map construction CHROMSCAN - Disease mapping by association in LD maps 44 Acknowledgements Nik Maniatis Sarah Ennis Jane Gibson Will Tapper Winston Lau Tai-Yue Kuo Weihua Zhang Josephine Hoh (Yale) GlaxoSmithKline Funding sources: NIH, BBSRC 45 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 15
16 46 Linkage DisequilibriumThe screen versions of these slides have full details of copyright and acknowledgements 16
Association studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationLD Mapping and the Coalescent
Zhaojun Zhang zzj@cs.unc.edu April 2, 2009 Outline 1 Linkage Mapping 2 Linkage Disequilibrium Mapping 3 A role for coalescent 4 Prove existance of LD on simulated data Qualitiative measure Quantitiave
More informationQTL Mapping, MAS, and Genomic Selection
QTL Mapping, MAS, and Genomic Selection Dr. Ben Hayes Department of Primary Industries Victoria, Australia A short-course organized by Animal Breeding & Genetics Department of Animal Science Iowa State
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationHaplotypes, linkage disequilibrium, and the HapMap
Haplotypes, linkage disequilibrium, and the HapMap Jeffrey Barrett Boulder, 2009 LD & HapMap Boulder, 2009 1 / 29 Outline 1 Haplotypes 2 Linkage disequilibrium 3 HapMap 4 Tag SNPs LD & HapMap Boulder,
More informationThe Whole Genome TagSNP Selection and Transferability Among HapMap Populations. Reedik Magi, Lauris Kaplinski, and Maido Remm
The Whole Genome TagSNP Selection and Transferability Among HapMap Populations Reedik Magi, Lauris Kaplinski, and Maido Remm Pacific Symposium on Biocomputing 11:535-543(2006) THE WHOLE GENOME TAGSNP SELECTION
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More informationGenome-Wide Association Studies. Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey
Genome-Wide Association Studies Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey Introduction The next big advancement in the field of genetics after the Human Genome Project
More informationIntroduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationLINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION?
LINKAGE DISEQUILIBRIUM MAPPING USING SINGLE NUCLEOTIDE POLYMORPHISMS -WHICH POPULATION? A. COLLINS Department of Human Genetics University of Southampton Duthie Building (808) Southampton General Hospital
More informationPopulation Genetics II. Bio
Population Genetics II. Bio5488-2016 Don Conrad dconrad@genetics.wustl.edu Agenda Population Genetic Inference Mutation Selection Recombination The Coalescent Process ACTT T G C G ACGT ACGT ACTT ACTT AGTT
More informationSummary. Introduction
doi: 10.1111/j.1469-1809.2006.00305.x Variation of Estimates of SNP and Haplotype Diversity and Linkage Disequilibrium in Samples from the Same Population Due to Experimental and Evolutionary Sample Size
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationThe Human Genome Project has always been something of a misnomer, implying the existence of a single human genome
The Human Genome Project has always been something of a misnomer, implying the existence of a single human genome Of course, every person on the planet with the exception of identical twins has a unique
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationHuman SNP haplotypes. Statistics 246, Spring 2002 Week 15, Lecture 1
Human SNP haplotypes Statistics 246, Spring 2002 Week 15, Lecture 1 Human single nucleotide polymorphisms The majority of human sequence variation is due to substitutions that have occurred once in the
More informationPERSPECTIVES. A gene-centric approach to genome-wide association studies
PERSPECTIVES O P I N I O N A gene-centric approach to genome-wide association studies Eric Jorgenson and John S. Witte Abstract Genic variants are more likely to alter gene function and affect disease
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationProstate Cancer Genetics: Today and tomorrow
Prostate Cancer Genetics: Today and tomorrow Henrik Grönberg Professor Cancer Epidemiology, Deputy Chair Department of Medical Epidemiology and Biostatistics ( MEB) Karolinska Institutet, Stockholm IMPACT-Atanta
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationPerils in the Use of Linkage Disequilibrium for Fine Gene Mapping: Simple Insights from Population Genetics
3292 Hypothesis/Commentary Perils in the Use of Linkage Disequilibrium for Fine Gene Mapping: Simple Insights from Population Genetics Prakash Gorroochurn Division of Statistical Genetics, Department of
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2018 Human Genetics Series Thursday 4/5/18 Nancy L. Saccone, Ph.D. Dept of Genetics nlims@genetics.wustl.edu / 314-747-3263 What
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationA map of the human genome in linkage disequilibrium units
A map of the human genome in linkage disequilibrium units W. Tapper*, A. Collins, J. Gibson, N. Maniatis, S. Ennis, and N. E. Morton* Human Genetics Division, University of Southampton, Southampton General
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationHaplotype Association Mapping by Density-Based Clustering in Case-Control Studies (Work-in-Progress)
Haplotype Association Mapping by Density-Based Clustering in Case-Control Studies (Work-in-Progress) Jing Li 1 and Tao Jiang 1,2 1 Department of Computer Science and Engineering, University of California
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationHuman Genetic Variation. Ricardo Lebrón Dpto. Genética UGR
Human Genetic Variation Ricardo Lebrón rlebron@ugr.es Dpto. Genética UGR What is Genetic Variation? Origins of Genetic Variation Genetic Variation is the difference in DNA sequences between individuals.
More informationComputational Genomics
Computational Genomics 10-810/02 810/02-710, Spring 2009 Quantitative Trait Locus (QTL) Mapping Eric Xing Lecture 23, April 13, 2009 Reading: DTW book, Chap 13 Eric Xing @ CMU, 2005-2009 1 Phenotypical
More informationCS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes
CS 262 Lecture 14 Notes Human Genome Diversity, Coalescence and Haplotypes Coalescence Scribe: Alex Wells 2/18/16 Whenever you observe two sequences that are similar, there is actually a single individual
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationConcepts and relevance of genome-wide association studies
Science Progress (2016), 99(1), 59 67 Paper 1500149 doi:10.3184/003685016x14558068452913 Concepts and relevance of genome-wide association studies ANDREAS SCHERER and G. BRYCE CHRISTENSEN Dr Andreas Scherer
More informationGenetics and Psychiatric Disorders Lecture 1: Introduction
Genetics and Psychiatric Disorders Lecture 1: Introduction Amanda J. Myers LABORATORY OF FUNCTIONAL NEUROGENOMICS All slides available @: http://labs.med.miami.edu/myers Click on courses First two links
More informationModeling & Simulation in pharmacogenetics/personalised medicine
Modeling & Simulation in pharmacogenetics/personalised medicine Julie Bertrand MRC research fellow UCL Genetics Institute 07 September, 2012 jbertrand@uclacuk WCOP 07/09/12 1 / 20 Pharmacogenetics Study
More informationCross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing
Cross Haplotype Sharing Statistic: Haplotype length based method for whole genome association testing André R. de Vries a, Ilja M. Nolte b, Geert T. Spijker c, Dumitru Brinza d, Alexander Zelikovsky d,
More informationLinkage Disequilibrium. Adele Crane & Angela Taravella
Linkage Disequilibrium Adele Crane & Angela Taravella Overview Introduction to linkage disequilibrium (LD) Measuring LD Genetic & demographic factors shaping LD Model predictions and expected LD decay
More informationPopulation and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift
Population and Statistical Genetics including Hardy-Weinberg Equilibrium (HWE) and Genetic Drift Heather J. Cordell Professor of Statistical Genetics Institute of Genetic Medicine Newcastle University,
More informationGenome-wide analyses in admixed populations: Challenges and opportunities
Genome-wide analyses in admixed populations: Challenges and opportunities E-mail: esteban.parra@utoronto.ca Esteban J. Parra, Ph.D. Admixed populations: an invaluable resource to study the genetics of
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationCrash-course in genomics
Crash-course in genomics Molecular biology : How does the genome code for function? Genetics: How is the genome passed on from parent to child? Genetic variation: How does the genome change when it is
More informationStructure, Measurement & Analysis of Genetic Variation
Structure, Measurement & Analysis of Genetic Variation Sven Cichon, PhD Professor of Medical Genetics, Director, Division of Medcial Genetics, University of Basel Institute of Neuroscience and Medicine
More informationAlgorithms for Genetics: Introduction, and sources of variation
Algorithms for Genetics: Introduction, and sources of variation Scribe: David Dean Instructor: Vineet Bafna 1 Terms Genotype: the genetic makeup of an individual. For example, we may refer to an individual
More informationImprovement of Association-based Gene Mapping Accuracy by Selecting High Rank Features
Improvement of Association-based Gene Mapping Accuracy by Selecting High Rank Features 1 Zahra Mahoor, 2 Mohammad Saraee, 3 Mohammad Davarpanah Jazi 1,2,3 Department of Electrical and Computer Engineering,
More informationIntroduction to Quantitative Genomics / Genetics
Introduction to Quantitative Genomics / Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics September 10, 2008 Jason G. Mezey Outline History and Intuition. Statistical Framework. Current
More informationCourse Announcements
Statistical Methods for Quantitative Trait Loci (QTL) Mapping II Lectures 5 Oct 2, 2 SE 527 omputational Biology, Fall 2 Instructor Su-In Lee T hristopher Miles Monday & Wednesday 2-2 Johnson Hall (JHN)
More informationTrudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.
Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed
More informationb. (3 points) The expected frequencies of each blood type in the deme if mating is random with respect to variation at this locus.
NAME EXAM# 1 1. (15 points) Next to each unnumbered item in the left column place the number from the right column/bottom that best corresponds: 10 additive genetic variance 1) a hermaphroditic adult develops
More informationGenotype Prediction with SVMs
Genotype Prediction with SVMs Nicholas Johnson December 12, 2008 1 Summary A tuned SVM appears competitive with the FastPhase HMM (Stephens and Scheet, 2006), which is the current state of the art in genotype
More informationGenetics Effective Use of New and Existing Methods
Genetics Effective Use of New and Existing Methods Making Genetic Improvement Phenotype = Genetics + Environment = + To make genetic improvement, we want to know the Genetic value or Breeding value for
More informationLecture: Genetic Basis of Complex Phenotypes Advanced Topics in Computa8onal Genomics
Lecture: Genetic Basis of Complex Phenotypes 02-715 Advanced Topics in Computa8onal Genomics Genome Polymorphisms A Human Genealogy TCGAGGTATTAAC The ancestral chromosome From SNPS TCGAGGTATTAAC TCTAGGTATTAAC
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More informationPUBH 8445: Lecture 1. Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota
PUBH 8445: Lecture 1 Saonli Basu, Ph.D. Division of Biostatistics School of Public Health University of Minnesota saonli@umn.edu Statistical Genetics It can broadly be classified into three sub categories:
More informationLittle Loss of Information Due to Unknown Phase for Fine-Scale Linkage- Disequilibrium Mapping with Single-Nucleotide Polymorphism Genotype Data
Am. J. Hum. Genet. 74:945 953, 2004 Little Loss of Information Due to Unknown Phase for Fine-Scale Linkage- Disequilibrium Mapping with Single-Nucleotide Polymorphism Genotype Data A. P. Morris, 1 J. C.
More informationProf. Dr. Konstantin Strauch
Genetic Epidemiology and Personalized Medicine Prof. Dr. Konstantin Strauch IBE - Lehrstuhl für Genetische Epidemiologie Ludwig-Maximilians-Universität Institut für Genetische Epidemiologie Helmholtz-Zentrum
More informationHigh-density SNP Genotyping Analysis of Broiler Breeding Lines
Animal Industry Report AS 653 ASL R2219 2007 High-density SNP Genotyping Analysis of Broiler Breeding Lines Abebe T. Hassen Jack C.M. Dekkers Susan J. Lamont Rohan L. Fernando Santiago Avendano Aviagen
More informationRecombination, and haplotype structure
2 The starting point We have a genome s worth of data on genetic variation Recombination, and haplotype structure Simon Myers, Gil McVean Department of Statistics, Oxford We wish to understand why the
More informationEfficient Association Study Design Via Power-Optimized Tag SNP Selection
doi: 10.1111/j.1469-1809.2008.00469.x Efficient Association Study Design Via Power-Optimized Tag SNP Selection B. Han 1,H.M.Kang 1,M.S.Seo 2, N. Zaitlen 3 and E. Eskin 4, 1 Department of Computer Science
More informationPhasing of 2-SNP Genotypes based on Non-Random Mating Model
Phasing of 2-SNP Genotypes based on Non-Random Mating Model Dumitru Brinza and Alexander Zelikovsky Department of Computer Science, Georgia State University, Atlanta, GA 30303 {dima,alexz}@cs.gsu.edu Abstract.
More informationThe Lander-Green Algorithm. Biostatistics 666
The Lander-Green Algorithm Biostatistics 666 Last Lecture Relationship Inferrence Likelihood of genotype data Adapt calculation to different relationships Siblings Half-Siblings Unrelated individuals Importance
More informationGENES IN POPULATIONS and MULTIFACTORIAL INHERITANCE Peter D'Eustachio
GENES IN POPULATIONS and MULTIFACTORIAL INHERITANCE Peter D'Eustachio GOALS OF THIS SEGMENT OF THE COURSE Understand the use of the Hardy-Weinberg equation to relate allele and genotype frequencies in
More informationPopulation differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia
Population differentiation analysis of 54,734 European Americans reveals independent evolution of ADH1B gene in Europe and East Asia Kevin Galinsky Harvard T. H. Chan School of Public Health American Society
More informationA Tool for Selecting SNPs for Association Studies Based on Observed Linkage Disequilibrium Patterns
A Tool for Selecting SNPs for Association Studies Based on Observed Linkage Disequilibrium Patterns Francisco M. De La Vega, Hadar I. Isaac, and Charles R. Scafe Pacific Symposium on Biocomputing 11:487-498(2006)
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationEFFICIENT DESIGNS FOR FINE-MAPPING OF QUANTITATIVE TRAIT LOCI USING LINKAGE DISEQUILIBRIUM AND LINKAGE
EFFICIENT DESIGNS FOR FINE-MAPPING OF QUANTITATIVE TRAIT LOCI USING LINKAGE DISEQUILIBRIUM AND LINKAGE S.H. Lee and J.H.J. van der Werf Department of Animal Science, University of New England, Armidale,
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationAssociation Mapping. Mendelian versus Complex Phenotypes. How to Perform an Association Study. Why Association Studies (Can) Work
Genome 371, 1 March 2010, Lecture 13 Association Mapping Mendelian versus Complex Phenotypes How to Perform an Association Study Why Association Studies (Can) Work Introduction to LOD score analysis Common
More informationI See Dead People: Gene Mapping Via Ancestral Inference
I See Dead People: Gene Mapping Via Ancestral Inference Paul Marjoram, 1 Lada Markovtsova 2 and Simon Tavaré 1,2,3 1 Department of Preventive Medicine, University of Southern California, 1540 Alcazar Street,
More informationGenetic data concepts and tests
Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure
More informationAppendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by
Appendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by author] Statistical methods: All hypothesis tests were conducted using two-sided P-values
More informationStatistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
More informationQTL Mapping Using Multiple Markers Simultaneously
SCI-PUBLICATIONS Author Manuscript American Journal of Agricultural and Biological Science (3): 195-01, 007 ISSN 1557-4989 007 Science Publications QTL Mapping Using Multiple Markers Simultaneously D.
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2017 Human Genetics Series Tuesday 4/10/17 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationHISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY
Third Pavia International Summer School for Indo-European Linguistics, 7-12 September 2015 HISTORICAL LINGUISTICS AND MOLECULAR ANTHROPOLOGY Brigitte Pakendorf, Dynamique du Langage, CNRS & Université
More informationCMSC423: Bioinformatic Algorithms, Databases and Tools. Some Genetics
CMSC423: Bioinformatic Algorithms, Databases and Tools Some Genetics CMSC423 Fall 2009 2 Chapter 13 Reading assignment CMSC423 Fall 2009 3 Gene association studies Goal: identify genes/markers associated
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationSAC review Haplotype mapping in human disease
10.1576/toag.11.4.277.27532 http://onlinetog.org Haplotype mapping in human disease Author Linda Morgan Key content: Many obstetric and gynaecological disorders result from complex interactions between
More informationBST227 Introduction to Statistical Genetics. Lecture 3: Introduction to population genetics
BST227 Introduction to Statistical Genetics Lecture 3: Introduction to population genetics!1 Housekeeping HW1 will be posted on course website tonight 1st lab will be on Wednesday TA office hours have
More informationThe HapMap Project and Haploview
The HapMap Project and Haploview David Evans Ben Neale University of Oxford Wellcome Trust Centre for Human Genetics Human Haplotype Map General Idea: Characterize the distribution of Linkage Disequilibrium
More informationHaplotype Based Association Tests. Biostatistics 666 Lecture 10
Haplotype Based Association Tests Biostatistics 666 Lecture 10 Last Lecture Statistical Haplotyping Methods Clark s greedy algorithm The E-M algorithm Stephens et al. coalescent-based algorithm Hypothesis
More informationQuestions we are addressing. Hardy-Weinberg Theorem
Factors causing genotype frequency changes or evolutionary principles Selection = variation in fitness; heritable Mutation = change in DNA of genes Migration = movement of genes across populations Vectors
More informationNature Genetics: doi: /ng.3254
Supplementary Figure 1 Comparing the inferred histories of the stairway plot and the PSMC method using simulated samples based on five models. (a) PSMC sim-1 model. (b) PSMC sim-2 model. (c) PSMC sim-3
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationLecture 2: Height in Plants, Animals, and Humans. Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013
Lecture 2: Height in Plants, Animals, and Humans Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Is height a polygenic trait? http://en.wikipedia.org/wiki/gregor_mendel Case Study
More informationData Mining and Applications in Genomics
Data Mining and Applications in Genomics Lecture Notes in Electrical Engineering Volume 25 For other titles published in this series, go to www.springer.com/series/7818 Sio-Iong Ao Data Mining and Applications
More informationOverview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat
Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,
More informationOn the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study
On the Power to Detect SNP/Phenotype Association in Candidate Quantitative Trait Loci Genomic Regions: A Simulation Study J.M. Comeron, M. Kreitman, F.M. De La Vega Pacific Symposium on Biocomputing 8:478-489(23)
More informationProblem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait.
Problem! When Fisher Did This Work, It Was Virtually Impossible to Identify Any Specific Loci Influencing a Quantitative Trait. Therefore, No Genotypes Could be Measured, and No Genotypic Means Could Be
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationSupplementary Online Content
Supplementary Online Content Lee JH, Cheng R, Barral S, Reitz C, Medrano M, Lantigua R, Jiménez-Velazquez IZ, Rogaeva E, St. George-Hyslop P, Mayeux R. Identification of novel loci for Alzheimer disease
More informationMONTE CARLO PEDIGREE DISEQUILIBRIUM TEST WITH MISSING DATA AND POPULATION STRUCTURE
MONTE CARLO PEDIGREE DISEQUILIBRIUM TEST WITH MISSING DATA AND POPULATION STRUCTURE DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate
More informationSupplementary Methods 2. Supplementary Table 1: Bottleneck modeling estimates 5
Supplementary Information Accelerated genetic drift on chromosome X during the human dispersal out of Africa Keinan A, Mullikin JC, Patterson N, and Reich D Supplementary Methods 2 Supplementary Table
More informationBIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 25 no. 4 2009, pages 497 503 doi:10.1093/bioinformatics/btn641 Genetics and population analysis ATOM: a powerful gene-based association test by combining optimally weighted
More informationHuman linkage analysis. fundamental concepts
Human linkage analysis fundamental concepts Genes and chromosomes Alelles of genes located on different chromosomes show independent assortment (Mendel s 2nd law) For 2 genes: 4 gamete classes with equal
More informationRuns of Homozygosity Analysis Tutorial
Runs of Homozygosity Analysis Tutorial Release 8.7.0 Golden Helix, Inc. March 22, 2017 Contents 1. Overview of the Project 2 2. Identify Runs of Homozygosity 6 Illustrative Example...............................................
More information