RNA secondary structure
|
|
- Jeffry Sims
- 6 years ago
- Views:
Transcription
1 Sequence Analysis '17 -- Lecture 17 RNA secondary structure Functions Representations Predictions Many slides courtesy of M. Zuker, RP Math
2 When RNA secondary structure matters mrna --> protein protein ssrna Strong secondary structure can block translation.
3 especially sensitive is the... Anderson RBS family -- bacterial. RBS ribosome binding site fmet NNN NNNNAAAGA GA UUUCU CU NNNNNAUGNNNN NNNN 5' 3' 16s species specific! Registry of Standard Biological Parts
4 microrna (mir) Found in 3'UTR introns exons transcription, folding nucleus cytoplasm microrna primary-microrna passenger strand degraded dicer argonaut proteins microrna duplex blocks translation deadenylation endonuclease digestion
5 Ambiguous bases
6 RNA secondary structure is base pairing i j Rules for normal SS
7 Not just Watson-Crick.. Different ways of base-pairing allow RNA to adopt duplex structures beyond A and B helix. f any base-pair is possible, how do we predict pairings?
8 2D plot M B M Structure types within RNA sec struct E M B
9 B M M E M B note: No bp lines cross.
10 Converting from 2D plot sec struct to circle/tree.
11 Pseudoknots C G A G G GU Circle plot=====> C UC U C C C C A G G C A U C
12
13
14
15
16 Prediction of RNA secondary structure Comparative methods, phylogenetics Free energy calculations Dot plot - Easy. - Can be done on a single sequence. - Cannot find non-canonical base pairs. Mutual information (M) - Requires a deep multiple sequence alignment - Can find non-canonical base-pairs.
17 Comparative modeling assume conserved structure between homologs
18 RNA structure by energy minimization Assumes energy is the sum of base pairs. where, e(i,j) = 0 if j-i < 4 Forward summation of energy matrix E: too close, can't pair add to loop add to loop start a helix, or add a base pair join helices in multi-loop
19 RNA structure by energy minimization 2. base-pairing is found by tracing back from (1,n) Stack A becomes the answer: a list of base pairs Stack B is a list of unfinished segments energy matrix 1. energy matrix is initilized starting from diagonal.. Find k such that E i,j = E i,k + E k+1,j Push (i,k) and (k+1,j) onto Stack B. Stop with error if no such k exists.
20 RNA structure by Dot Plot
21 RNA structure by Dot Plot
22 RNA structure by Mutual nformation ow-to: 1) Run BLAST search to get homologs. 2) Prune sequences to remove redundancy.* 3) Prune columns to remove uninformative data. (conserved positions tell you nothing) 4) Calculate mutual information (M i,j ) for all pairs of positions (i,j). position position position
23 Mutual information, in general A measure of the surprisingness of a pair of events. frequency of a pair of events observed together= N(a,b events)/n(total events) in bits, because we used log2 M = Σ f(a,b) log 2 ( ) f(a,b) f(a)f(b) a,b {events} sum over all event pair types expected frequency of a,b events together is the product of the frquencies of the events separately
24 Mutual information for base-pairs A measure of the surprisingness of the evolution of two positions in the sequence. species i position j pair of sequence positions (i,j) frequency of base-pair (B 1, B2) at positions (i,j) =N(B1,B2)/N(total sequences) M(i,j) = Σ ( f i,j (B 1,B 2 ) ) f i,j (B 1,B 2 ) log 2 f i (B 1 )f j (B 2 ) B 1,B 2 {A,C,G,T} sum over all base-pair types expected frequency of base B1, B2 Exercise: Calculate M(i,j)=
25 Can you find pairs of positions with high M? W-C non-canonical
26 Mutual information matrix for 20 aligned sequences very noisy. Take home message: You need lots of sequence to do mutual information analysis. And this is for RNA where the signal is strong. Try protein. You'll need thousands of sequences...
27 Same RNA, M i,j for 302 aligned sequences cleaner
28 Corresponding structure. M elices now appear as straight lines of dots, after re-numbering to remove gaps in the MSA
29 Prediction of RNA secondary structure Comparative methods, phylogenetics Free energy calculations Dot plot - Easy. - Can be done on a single sequence. - Cannot find non-canonical base pairs. Mutual information (M) - Requires a deep multiple sequence alignment - Can find non-canonical base-pairs.
30 Review questions? 1. What are the UPAC codes? 2. What are the different types of RNA structure? 3. What is mutual information? ow is it calculated? 4. What are the sources of energy for RNA structure? 5. What algorithm is used to calculate the energy over all RNA structures? 6. What is expressed in a dot plot? 7. What is expressed in a circle plot? 8. What is a pseudoknot? 9. What is a non-canonical basepair? 10. Can you convert a dotplot into a graph? 11. Can you convert a graph into a circle plot? 12. Can you see a pseudoknot in a graph, circle, dotplot?
Sections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Background: Watson & Crick recognized that base pairing in the double helix allows DNA to be copied, or replicated Each strand in the double helix has all the information to remake
More informationRNA folding & ncrna discovery
I519 Introduction to Bioinformatics RNA folding & ncrna discovery Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Non-coding RNAs and their functions RNA structures RNA folding
More informationRNA Structure Prediction. Algorithms in Bioinformatics. SIGCSE 2009 RNA Secondary Structure Prediction. Transfer RNA. RNA Structure Prediction
Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri RNA Structure Prediction Secondary
More informationRNA secondary structure prediction and analysis
RNA secondary structure prediction and analysis 1 Resources Lecture Notes from previous years: Takis Benos Covariance algorithm: Eddy and Durbin, Nucleic Acids Research, v22: 11, 2079 Useful lecture slides
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More information90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationMicroRNA sequencing (mirnaseq)
, Robust experimental design Data analysis using the CAP-miRSeq: A comprehensive analysis pipeline for deep microrna sequencing E. Starr Hazard Over view of this first lecture 1) Review of very basic mirna
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationTranscription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016
Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red
More informationmicrorna Shifra Ben-Dor March 2010
microrna Shifra Ben-Dor March 2010 Outline Biology of mirna Prediction of mirna mirna Databases Prediction of mirna Targets micrornas (mirna) Naturally expressed small RNAs Involved in regulation of target
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationFrom Gene to Protein
8.2 Structure of DNA From Gene to Protein deoxyribonucleic acid - (DNA) - the ultimate source of all information in a cell This information is used by the cell to produce the protein molecules which are
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationtranslation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links
The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen
More informationSequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing
Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationDNA and the Production of Proteins Course Notes. Cell Biology. Sub-Topic 1.3 DNA and the Production of Proteins
Cell Biology Sub-Topic 1.3 DNA and the Production of Proteins On completion of this subtopic I will be able to state that: Chromosomes contain genetic information that gives rise to an organism s characteristics.
More informationWhich Process Is The First Step In Making A Protein From Dna Instructions >>>CLICK HERE<<<
Which Process Is The First Step In Making A Protein From Dna Instructions How do the instructions in DNA reach the ribosomes in the cytoplasm? RNA is needed for Then it helps build the protein. RNA is
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationDNA - DEOXYRIBONUCLEIC ACID
DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationBIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: CCS: 10.BIO.4 a, 5 a, 5 b.
BIOLOGY REVISION SHEET FINAL EXAM TERM-III Session: 2017-18 CCS: 10.BIO.4 a, 5 a, 5 b. Name: Grade: 10 CHAPTER.8: SECTION 8.1, SECTION 8.2, SECTION 8.3, SECTION 8.4 & SECTION 8.5. NOTE: THE STUDENTS SHOULD
More informationReading for lecture 2
Reading for lecture 2 1. Structure of DNA and RNA 2. Information storage by DNA 3. The Central Dogma Voet and Voet, Chapters 28 (29,30) Alberts et al, Chapters 5 (3) 1 5 4 1 3 2 3 3 Structure of DNA and
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationCOMP598: Advanced Computational Biology Methods & Research
COMP598: Advanced Computational Biology Methods & Research Introduction to RNA secondary structure prediction Jérôme Waldispühl School of Computer Science, McGill RNA world In prebiotic world, RNA thought
More informationI. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics
Ch 12 Lecture Notes - DNA I. To understand Genetics - A. Chemical nature of genes had to be discovered B. Allow us to understand how genes control inherited characteristics 1 II. Griffith and Transformation
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More informationLesson 8. DNA: The Molecule of Heredity. Gene Expression and Regulation. Introduction to Life Processes - SCI 102 1
Lesson 8 DNA: The Molecule of Heredity Gene Expression and Regulation Introduction to Life Processes - SCI 102 1 Genes and DNA Hereditary information is found in discrete units called genes Genes are segments
More information1/4/18 NUCLEIC ACIDS. Nucleic Acids. Nucleic Acids. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
More informationNUCLEIC ACIDS. ECS129 Instructor: Patrice Koehl
NUCLEIC ACIDS ECS129 Instructor: Patrice Koehl Nucleic Acids Nucleotides DNA Structure RNA Synthesis Function Secondary structure Tertiary interactions Wobble hypothesis DNA RNA Replication Transcription
More informationFrom DNA to Protein: Genotype to Phenotype
12 From DNA to Protein: Genotype to Phenotype 12.1 What Is the Evidence that Genes Code for Proteins? The gene-enzyme relationship is one-gene, one-polypeptide relationship. Example: In hemoglobin, each
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationDNA - The Double Helix
DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including cell reproduction,
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationDNA - The Double Helix
Name Date Period DNA - The Double Helix Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of the cell including
More informationDNA, RNA and protein synthesis
DNA, RNA and protein synthesis DNA is deoxyribonucleic acid DNA contains all the genetic instructions for making proteins within the cell. Each DNA molecule is made of repeating subunits called nucleotides.
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationName: Date: Pd: Nucleic acids
Name: Date: Pd: DNA - The Double Helix Nucleic acids Recall that the nucleus is a small spherical, dense body in a cell. It is often called the "control center" because it controls all the activities of
More informationSection 3: DNA Replication
Section 3: DNA Replication Main Idea: Replication- process by which DNA is copied during the cell cycle DNA Polymerase- a group of enzymes that bond the new nucleotides together 1 DNA Replication Replication
More informationCh 10 Molecular Biology of the Gene
Ch 10 Molecular Biology of the Gene For Next Week Lab -Hand in questions from 4 and 5 by TUES in my mailbox (Biology Office) -Do questions for Lab 6 for next week -Lab practical next week Lecture Read
More informationControl of Eukaryotic Genes
Control of Eukaryotic Genes 2007-2008 The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationDNA/RNA STUDY GUIDE. Match the following scientists with their accomplishments in discovering DNA using the statement in the box below.
Name: Period: Date: DNA/RNA STUDY GUIDE Part A: DNA History Match the following scientists with their accomplishments in discovering DNA using the statement in the box below. Used a technique called x-ray
More informationKEY CONCEPT DNA was identified as the genetic material through a series of experiments. Found live S with R bacteria and injected
Section 1: Identifying DNA as the Genetic Material KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage MAIN IDEA: Griffith finds a transforming
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationGenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
More informationName: Block: Date: Purpose: To better understand the roles played by DNA, m-rna, and t-rna and amino acids in enzyme formation and gene expression.
Name: Block: Date: Adapted from: Blueprint Gene to Working (Protein) Enzyme: Breaking the Genetic Code Purpose: To better understand the roles played by DNA, m-rna, and t-rna and amino acids in enzyme
More informationControl of Eukaryotic Genes. AP Biology
Control of Eukaryotic Genes The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different, specialized functions? Evolution
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationWrite: Unit 5 Review at the top.
Warm-up Take out a sheet of paper: Write: Unit 5 Review at the top. As each question goes on the board, write that question down and answer it. When answers come up, either write correct next to what you
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationRNA & PROTEIN SYNTHESIS
RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationCh 12.DNA and RNA.Biology.Landis
Identity Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the
More informationGriffith and Transformation (pages ) 1. What hypothesis did Griffith form from the results of his experiments?
Section 12 1 DNA (pages 287 294) This section tells about the experiments that helped scientists discover the relationship between genes and DNA. It also describes the chemical structure of the DNA molecule.
More informationDNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?
2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationII. DNA Deoxyribonucleic Acid Located in the nucleus of the cell Codes for your genes Frank Griffith- discovered DNA in 1928
HEREDITY = passing on of characteristics from parents to offspring I. DNA, Chromosomes, Chromatin, and Genes DNA = blueprint of life (has the instructions for making an organism) Chromatin= uncoiled DNA
More informationRegulation of bacterial gene expression
Regulation of bacterial gene expression Gene Expression Gene Expression: RNA and protein synthesis DNA ----------> RNA ----------> Protein transcription translation! DNA replication only occurs in cells
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationوراثة األحياء الدقيقة Microbial Genetics
وراثة األحياء الدقيقة Microbial Genetics د. تركي محمد الداود مكتب 2 ب 45 أساسيات في علم الوراثة Fundamentals of Genetics Lecture 4 Physical Chemistry of Nucleic Acids DNA and RNA molecules can appear in
More informationDNA and Biotechnology Form of DNA Form of DNA Form of DNA Form of DNA Replication of DNA Replication of DNA
21 DNA and Biotechnology DNA and Biotechnology OUTLINE: Replication of DNA Gene Expression Mutations Regulating Gene Activity Genetic Engineering Genomics DNA (deoxyribonucleic acid) Double-stranded molecule
More informationThe Structure of Proteins The Structure of Proteins. How Proteins are Made: Genetic Transcription, Translation, and Regulation
How Proteins are Made: Genetic, Translation, and Regulation PLAY The Structure of Proteins 14.1 The Structure of Proteins Proteins - polymer amino acids - monomers Linked together with peptide bonds A
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationCh. 10 Notes DNA: Transcription and Translation
Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that
More informationDNA, RNA, and Protein. The Whole Story
DNA, RNA, and Protein The Whole Story They didn t always know DNA was the Genetic Material. But they did know that the genetic material needed to do four things. The Master Molecule Contains Information
More information8.1. DNA was identified as the genetic material through a series of experiments. Injected mice with R bacteria. Injected mice with S bacteria
SECTION 8.1 IDENTIFYING DNA AS THE GENETIC MATERIAL Study Guide KEY CONCEPT DNA was identified as the genetic material through a series of experiments. VOCABULARY bacteriophage Griffith finds a transforming
More informationGene Expression - Transcription
DNA Gene Expression - Transcription Genes are expressed as encoded proteins in a 2 step process: transcription + translation Central dogma of biology: DNA RNA protein Transcription: copy DNA strand making
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationRNA Secondary Structure Prediction Computational Genomics Seyoung Kim
RNA Secondary Structure Prediction 02-710 Computational Genomics Seyoung Kim Outline RNA folding Dynamic programming for RNA secondary structure prediction Covariance model for RNA structure prediction
More informationProtein Synthesis. Lab Exercise 12. Introduction. Contents. Objectives
Lab Exercise Protein Synthesis Contents Objectives 1 Introduction 1 Activity.1 Overview of Process 2 Activity.2 Transcription 2 Activity.3 Translation 3 Resutls Section 4 Introduction Having information
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationPROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK?
PROTEIN SYNTHESIS WHAT IS IT? HOW DOES IT WORK? Learning Outcomes All: Will be able to describe simple steps in protein synthesis: Transcription and Translation and be able to distinguish between them.
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More information