Supporting Online Material, Matsumoto et al.

Size: px
Start display at page:

Download "Supporting Online Material, Matsumoto et al."

Transcription

1 Supporting Online Material, Matsumoto et al. Material and Methods Library. Poly(A) + mrna was purified from RAW264.7 cells stimulated with murine IFN-γ (100 units/ml) and bacterial LPS (100 ng/ml) for 0, 2, 4, 6, 8, 12, 18 and 24 hrs. cdnas were prepared using oligo(dt) and random primers, ligated to the EcoRI adaptor (5' AATTCGCGGCCGCGTCGAC 3') and cloned into the EcoRI site of pgad10 (Clontech) prey plasmids. The average insert size was 1.7 kbp and the range of insert size was 0.4 ~ 3.5 kbp. The resultant library was amplified once in E. coli to obtain the plasmid cdna library used for screening. PCR analysis with specific primers verified that the library contained apoptosis-related cdnas including caspase-3, -8, -9, Apaf-1, Bcl-2 and apoptosis inducing factor (AIF). Bait plasmids. An Nco I and Xho I digest of caspase-3 (S1) was integrated into pas2-1 (Clontech). The entire open reading frame of AIF was derived from I.M.A.G.E. clones (ATCC) and 25192, and sub-cloned into pas2-1 (between Nde I and EcoR I sites). DNA sequencing confirmed construct identities, and the expression of bait proteins (fused to binding domains, BD) was verified by immunobloting with monoclonal antibodies to the BD or bait-specific proteins or both. Modified two-hybrid screens. The YHB1 gene was deleted from yeast strain CG-1945 and the absence of NO consumption was verified (S2). Yeast two-hybrid screening was then performed in the CG-1945 yhb1 host. Cells were sequentially transformed with bait [selection in tryptophan (Trp)-deficient medium] and library [selection in Trp-leucine (Leu)-deficient medium] plasmids (S3). Cells containing pairs of interacting proteins were selected by their growth on histidine (His)-deficient medium and by expression of β-galactosidase (β-gal) activity. Specifically, interacting proteins reconstitute the active transcription factor Gal4, which drives transcription of β-gal and HIS3. Method 1: Auxotrophic selection was carried out on agar plates (15 cm diameter) made with Complete Supplement Mixture deficient in His-Trp-Leu (Q-Bio gene) (50 mm phosphate buffer, ph 7.2). Yeast were cultured for 4 days at 30 ºC in the presence or

2 absence of DETA-NO (40 µl of a 0.3M solution; Cayman Chemical). Clones that showed at least 3-fold greater growth in DETA-NO were selected and further analyzed for β-gal activity with O-nitrophenyl β-d-galactopyranoside (ONPG) as substrate. Prey plasmids were isolated from positive yeast clones and then re-introduced into the bait strain to confirm bait-prey interactions. Method 2: Cells seeded on 1.5% agar were covered with 3% low-melting-point agar, which in turn was layered with culture medium. NO donors (e.g. DETA-NO, 300 µm final concentration) were added to the liquid layer every 24 hours. Colonies were grown for 4 days as described in Method 1. Method 3: Auxotrophic selection was carried out in His-Trp-Leu-deficient buffered medium (see Method 1). Transformation with the cdna library was followed by overnight growth in medium deficient in Trp and Leu. Transformants were then grown for 3 days in His- deficient medium supplemented with DETA-NO (typically 200 µm final concentration). The plasmid DNA was harvested and transformed into E. coli. Individual clones were isolated, retransformed into bait strains, and reassessed for NOdependent growth and β-gal activity. Immunoprecipitation. Thirty million cells were lysed by homogenization in 1 ml IP buffer [10 mm NaPi, 100 mm NaCl, 1 mm EDTA, ph 7.9, with protease inhibitor cocktail (Roche)]. The supernatant obtained by centrifugation at 20,000x g for 10 min was used for immunoprecipitation. Caspase-3 immunoprecipitates (2.5 µg anti-caspase-3 monoclonal antibody, Transduction Laboratories) were washed, separated on 10% SDS- PAGE, and blotted with anti-asm antibody (Santa Cruz Biotechnology, and kindly provided by K. Sandhoff); 5% of the immunoprecipitate was blotted for caspase-3. Caspase-3 activity. Caspase-3 activity was measured with the EnzChek Caspase-3 kit (Molecular Probes) with Z-DEVD-AMC as substrate, and evaluated at 340/450 nm (excitation/emission). Acid sphingomyelinase activity. ASM activity was measured essentially as described (S4), using BODIPY FL C 5 -sphingomyelin (Molecular Probes) as substrate (1.5 nmol) in

3 assay buffer: 250 mm sodium acetate, ph 5.0, 10 mm EDTA. To assay Zn-stimulated ASM activity, 0.1 mm ZnCl was used without EDTA. Sample (30 µl) was incubated in assay buffer (70 µl) at 37 ºC for 1-3 hours. Reactions were terminated by adding 1.0 ml heptane and 0.29 ml isopropyl alcohol. Phases were then separated by adding 0.23 ml H 2 O, and the heptane phase was washed with 0.23 ml H 2 O. The fluorescence of the organic phase (containing BODIPY FL-ceramide) was assayed at 505/514 nm excitation/emission wavelengths. Mitochondrial purification. Isolation of mitochondria and determination of purity was as described (S5) with minor modification. Briefly, rat liver (10 g) or cultured cells collected from 15 dishes (15 cm diameter) were gently homogenized in 10 mm Tris-HCl, 200 mm mannitol and 50 mm sucrose, ph 7.4, using 10 strokes of a glass pestle (Wheaton Dounce). Following removal of nuclei and unbroken cells (centrifugation at 1000xg), heavy (3000xg) and light mitochondrial (20,000xg) fractions were separated further by Opti-Prep [60% solution (w/v) of iodixanol; Sigma] gradient centrifugation. Cytosolic (supernatant) and microsomal (pellet) fractions were separated at 100,000xg. Following protein quantification, each fraction was subjected to marker enzyme assays to determine purity of organelles. Acid phosphatase activity (lysosomal marker) was assayed by the hydrolysis of p-nitrophenyl phosphate to p-nirtophenolate anion and evaluated at 410 nm absorbance; succinate dehydrogenase activity (mitochondrial marker) was measured using sodium succinate as substrate and p-iodonitrotetrazolium violet (INT) as the electron acceptor, and evaluated at 490 nm (ε490 = 19,200 M -1 cm -1 ); catalase activity (peroxisomal marker) was derived from rates of H 2 O 2 consumption (S6). Removal of NO donor. DETA-NO treatment at neutral ph was followed by brief acidification (ph 5.0 x 10-min) to decompose the NO donor. ASM/procaspase-3 coincubations were then performed at ph 7.2.

4 Supporting Figures Fig. S1 Growth of yeast (CG-1945 yhb1) with sustained delivery of NO in the twohybrid assay. DETA-NO at less than 300 µm generates NO without inhibiting yeast growth (monitored by absorbance at 600 nm). Steady-state NO concentrations are maintained at ~100 nm-1 µm for several days as measured with an NO electrode (not shown).

5 Fig. S2 NO-dependent interaction of AIF with MIP-1α. Yeast ( yhb1) were transformed with Gal4 BD-AIF (Bait) and Gal4 AD-MIP-1α (Prey) (or Bait alone). (A) Robust growth of the AIF/MIP-1α clone requires NO (single asterisk, p<0.001 versus AIF/MIP-1α without NO; n=6). In contrast, the clone expressing AIF alone shows little growth in either the presence or absence of NO. Cells were grown in His-Trp-Leudeficient medium at 30 ºC for 72 hrs with or without 200 µm DETA-NO. (B) β- galactosidase activities in samples shown in A (single asterisk, p<0.001 vs. without NO; n=4). Supporting References and Notes S1. J. B. Mannick et al., Science 284, 651 (1999). S2. L. Liu, M. Zeng, A. Hausladen, J. Heitman, J. S. Stamler, Proc Natl Acad Sci USA 97, 4672 (2000). S3. P. L. Bartel, S. Fields, The Yeast Two-Hybrid System. A. Jacobson, Ed., Advances in Molecular Biology (Oxford University Press, New York, 1997). S4. E. Romiti et al., Mol Cell Biochem 205, 75 (2000).

6 S5. A. Okado-Matsumoto, I. Fridovich, J Biol Chem 276, (2001). S6. S. Nag, K. Saha, M. A. Choudhuri, Plant Science 157, 157 (2000).

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits

TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial

More information

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered

Supplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl

More information

Protocol for in vitro transcription

Protocol for in vitro transcription Protocol for in vitro transcription Assemble the reaction at room temperature in the following order: Component 10xTranscription Buffer rntp T7 RNA Polymerase Mix grna PCR DEPC H 2 O volume 2μl 2μl 2μl

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation

More information

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng

Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,

More information

Table S1 Yeast strains used in this study Strain Genotype JSY7452* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 JSY7453* MAT ade2-1 leu2-3

Table S1 Yeast strains used in this study Strain Genotype JSY7452* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 JSY7453* MAT ade2-1 leu2-3 Table S1 Yeast strains used in this study Strain Genotype JSY7452* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 JSY7453* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 mfb1::his3 JSY8272 MAT

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

(Supplementary Methods online)

(Supplementary Methods online) (Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial

More information

SUPPLEMENTAL MATERIALS

SUPPLEMENTAL MATERIALS SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURES Supplemental Figure S1. Analyses of the CRY1-SPA1 interaction (A) An auxotrophy growth assay (left) and a filter-based -galactosidase colorimetric assay (right)

More information

Supporting Information

Supporting Information Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and

More information

GENETIC ENGINEERING worksheet

GENETIC ENGINEERING worksheet Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA

More information

Solid Phase cdna Synthesis Kit

Solid Phase cdna Synthesis Kit #6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or

More information

Supplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes

Supplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh

Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

ENDEXT TM Technology. Wheat Germ Premium Expression Kit. Ver 1.7. CellFree Sciences Co., Ltd.

ENDEXT TM Technology. Wheat Germ Premium Expression Kit. Ver 1.7. CellFree Sciences Co., Ltd. ENDEXT TM Technology Wheat Germ Premium Expression Kit Ver 1.7 CellFree Sciences Co., Ltd. 1. Purpose Wheat Germ Premium Expression Kit is a starter kit to ascertain if the Wheat Germ Cell-Free System

More information

Supplementary Figures 1-12

Supplementary Figures 1-12 Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting

More information

The preparation of native chromatin from cultured human cells.

The preparation of native chromatin from cultured human cells. Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the

More information

Yeast 2-Hybrid Kayla Nygaard

Yeast 2-Hybrid Kayla Nygaard Yeast 2-Hybrid 2.26.18 Kayla Nygaard Y2H - What is it? A method to screen for protein-protein interactions in yeast Capitalizes on GAL4 system in yeast. GAL4 has 2 domains DNA-Binding Domain (DB) Transcriptional

More information

The yeast two-hybrid assay

The yeast two-hybrid assay Master program Molecular and Cellular Life Sciences Block 1: Intracellular membrane processes 11th October 2011 The yeast two-hybrid assay Fulvio Reggiori Department of Cell Biology, UMC Utrecht For what

More information

SensoLyte 620 HCV Protease Assay Kit *Fluorimetric*

SensoLyte 620 HCV Protease Assay Kit *Fluorimetric* SensoLyte 620 HCV Protease Assay Kit *Fluorimetric* Catalog # 71146 Kit Size 100 Assays (96-well plate) Convenient Format: Complete kit including all the assay components. Optimized Performance: Optimal

More information

HOOK 6X His Protein Purification (Yeast)

HOOK 6X His Protein Purification (Yeast) G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Purification (Yeast) For The Purification of His Tagged Proteins from

More information

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system

ENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53

Supplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53 Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -

More information

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-

Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- #1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Purification and biochemical characterization of acid phosphatase-i from seeds of Nelumbo nucifera Sanaullah Khan a*, Shahnaz Asmat c, Sajida Batool a, Mushtaq Ahmed b a Department

More information

Yeast Nuclei Isolation Kit

Yeast Nuclei Isolation Kit Yeast Nuclei Isolation Kit Catalog Number KA3951 50 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067

ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Supplementary Methods Plasmid constructs

Supplementary Methods Plasmid constructs Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

SUPPLEMENTAL DATA. Supplementary Methods

SUPPLEMENTAL DATA. Supplementary Methods SUPPLEMENTL DT Supplementary Methods TP agarose affinity chromatography Peroxisomes extracted from yeast transformed with CTS/pRS416-GPD were resuspended in solubilisation buffer [5 mm Tris-HCl ph 7.,

More information

1. QUANTITY OF LYSATE 2. LYSIS BUFFER

1. QUANTITY OF LYSATE 2. LYSIS BUFFER SAMPLE PREPARATION 1. QUANTITY OF LYSATE The amount of protein requested for the Kinex KAM-880 Antibody Microarray service is 100 µg per sample at an approximate concentration of 2 mg/ml. If your samples

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by

Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by deubiquitylases (DUBs) yielding mature Ub deubiquitylase FLAG 3

More information

Supplementary information

Supplementary information Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary

More information

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

of the Triphosphate of ATP

of the Triphosphate of ATP A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

AmpliScribe T7-Flash Transcription Kit

AmpliScribe T7-Flash Transcription Kit AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction

More information

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector

ITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph

More information

SUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary

SUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary SUPPLEMENTAL MATERIALS METHODS Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary and liver cells were prepared from the indicated transgenic mice, as described (Ho et al, 2002).

More information

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Kit Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and non-apoptotic

More information

Sarker et al. Supplementary Material. Subcellular Fractionation

Sarker et al. Supplementary Material. Subcellular Fractionation Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged

More information

NEBNext RNase III RNA Fragmentation Module

NEBNext RNase III RNA Fragmentation Module SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2

More information

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3

Transcriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3 ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated

More information

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065

Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

Z Competent E. coli Transformation

Z Competent E. coli Transformation 467PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Z Competent E. coli Transformation (Cat. # GZ 4, GZ 5) think proteins! think G-Biosciences

More information

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;

Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq

More information

Human Cell-Free Protein Expression System

Human Cell-Free Protein Expression System Cat. # 3281 For Research Use Human Cell-Free Protein Expression System Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...

More information

DNA miniprep by Alkaline Lysis (activity)

DNA miniprep by Alkaline Lysis (activity) DNA miniprep by Alkaline Lysis (activity) Contents 1 Alkaline Lysis 2 Exercise 1: Plasmid DNA Mini-Prep by Alkaline Lysis 3 Identification of Plasmid DNA 4 Exercise 2: Restriction Digestion Identification

More information

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7

CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 subunits of human mitochondrial Complex-I Q module N DUFS2, 3, 7 and 8 form the core subunits of

More information

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No

High Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No for isolation of total RNA from 50 samples Cat. No. 1 88 665 Principle A single reagent lyses the sample lysis and inactivates RNase. In the presence of a chaotropic salt (guanidine HCl), the released

More information

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences

Glutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences 191PR 05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786 280, 786 310, 786 311, 786 312) think proteins! think

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Jan 25, 05 His Bind Kit (Novagen)

Jan 25, 05 His Bind Kit (Novagen) Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,

More information

ZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube.

ZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube. 1 ZYMOLYASE PROTOCOLS Smash and Grab Zymolyase PROVIDED BY: DAVID AMBERG 1. Grow cells in 3mls selective media o/n 2. Pellet cells by 2 quick spins in a microfuge 3. Re-suspend cells in 200 u1 of the following

More information

Ren Lab ENCODE in situ HiC Protocol for Tissue

Ren Lab ENCODE in situ HiC Protocol for Tissue Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar

More information

BREEDING, GENETICS, AND PHYSIOLOGY. OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System

BREEDING, GENETICS, AND PHYSIOLOGY. OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System BREEDING, GENETICS, AND PHYSIOLOGY OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System M.R. Morsy and J.McD. Stewart ABSTRACT Low-temperature stress is a major limiting

More information

Supporting Information

Supporting Information Supporting Information Copper and zinc ions specifically promote non-amyloid aggregation of the highly stable human γ-d crystallin Liliana Quintanar, 1,* José A. Domínguez-Calva, 1 Eugene Serebryany, 2

More information

Mitochondria/Cytosol Fractionation Kit

Mitochondria/Cytosol Fractionation Kit Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)

More information

Adenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X

Adenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects

More information

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences

GST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences 191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name GST Elution Buffer (Cat. #786-541) think proteins! think G-Biosciences www.gbiosciences.com

More information

CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION. Recombinant DNA technology has revolutionized molecular biology and

CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION. Recombinant DNA technology has revolutionized molecular biology and 204 CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION SUMMARY Recombinant DNA technology has revolutionized molecular biology and genetics. Today, virtually any segment of DNA, the genetic material

More information

Molecular Techniques Third-year Biology

Molecular Techniques Third-year Biology PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed

More information

TransIT-TKO Transfection Reagent

TransIT-TKO Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery

More information

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.

BACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34. BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21

More information

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions

Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Maxim Biotech, Inc. 780 Dubuque Avenue, So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry of cytochrome c and mitochondria.

ApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry of cytochrome c and mitochondria. PROTOCOL ApoTrack Cytochrome c Apoptosis ICC Antibody Kit 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MSA07 Rev.1 DESCRIPTION ApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry

More information

ApoTrack Cytochrome c Apoptosis ICC Antibody

ApoTrack Cytochrome c Apoptosis ICC Antibody ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic

More information

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),

More information

Yeast Two-Hybrid Assay to Identify Interacting Proteins

Yeast Two-Hybrid Assay to Identify Interacting Proteins Yeast Two-Hybrid Assay to Identify Interacting Proteins Aurora Paiano, 1 Azzurra Margiotta, 1,2 Maria De Luca, 1 and Cecilia Bucci 1,3 1 Department of Biological and Environmental Sciences and Technologies

More information

Protein A Agarose Immunoprecipitation Kit

Protein A Agarose Immunoprecipitation Kit Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20

pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl

More information

Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on

Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on MS media, seedlings were transferred to soil and treated

More information

Hurricane Miniprep Kit PROTOCOL

Hurricane Miniprep Kit PROTOCOL Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The

More information

DNA Ligation Kit Ver. 1 Manual

DNA Ligation Kit Ver. 1 Manual Table of content Description... 2 Procedures and Examples A. Insertion of DNA into plasmid vectors... 3 B. Insertion of DNA into λ phage vectors... 4 C. Self-circulization of linear DNA... 4 D. Linker

More information

Gel/PCR Extraction Kit

Gel/PCR Extraction Kit Gel/PCR Extraction Kit Item No: EX-GP200 (200rxns) Content Content Binding Buffer BD Wash Buffer PE Elution Buffer (10 mm Tris-HCl, ph 8.5) Spin Columns EX-GP200 80 ml 20 mlx3 10 ml 200 each Description

More information

Amplification Products for PCR and RT-PCR

Amplification Products for PCR and RT-PCR Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format

More information

Solutions to 7.02 Quiz II 10/27/05

Solutions to 7.02 Quiz II 10/27/05 Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover

More information

PRODUCT INFORMATION. Composition of SOC medium supplied :

PRODUCT INFORMATION. Composition of SOC medium supplied : Product Name : Competent Cell BL21(DE3)pLysS Code No. : DS260 Size : 100 μl 10 Competency : > 5 10 7 cfu/μg (puc19) Supplied product : SOC medium, 1 ml 10 This product is for research use only Description

More information

Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria

Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria This protocol was written Dr. Marc Liesa. You may contact Dr. Liesa at Liesa@bu.edu This protocol has been established

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of

Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations

More information

RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013)

RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) WARNING: RNA Blue contains phenol and some other toxic components. After contact with skin, wash immediately with

More information

Marathon TM cdna Amplification Kit Protocol-at-a-Glance

Marathon TM cdna Amplification Kit Protocol-at-a-Glance (PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during

More information

Buffers & Gel Stain Chemicals

Buffers & Gel Stain Chemicals Buffers & Gel Stain Chemicals 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview Bioneer provides over 40 types of buffer and chemical essential for life science research.

More information

CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM

CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM 4.1 Introduction The aim of the present study was to generate an unbiased data of interactions among N, P, M and G proteins

More information

For the rapid isolation of Mitochondrial DNA in various cell and tissue samples.

For the rapid isolation of Mitochondrial DNA in various cell and tissue samples. ab65321 Mitochondrial DNA Isolation Kit Instructions for Use For the rapid isolation of Mitochondrial DNA in various cell and tissue samples. This product is for research use only and is not intended for

More information

MagExtactor -His-tag-

MagExtactor -His-tag- Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

M X 500 µl. M X 1000 µl

M X 500 µl. M X 1000 µl GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,

More information

BL21(DE3) expression competent cell pack DS265. Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube)

BL21(DE3) expression competent cell pack DS265. Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube) Product Name : Code No. : Kit Component : BL21(DE3) expression competent cell pack DS265 Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube) transfromation efficiency: 5 10

More information

VDL101.3 CLONING TRANSGENE INTO pad5f35

VDL101.3 CLONING TRANSGENE INTO pad5f35 Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to pad5/f35. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed

More information