Supporting Online Material, Matsumoto et al.
|
|
- Morgan Chambers
- 6 years ago
- Views:
Transcription
1 Supporting Online Material, Matsumoto et al. Material and Methods Library. Poly(A) + mrna was purified from RAW264.7 cells stimulated with murine IFN-γ (100 units/ml) and bacterial LPS (100 ng/ml) for 0, 2, 4, 6, 8, 12, 18 and 24 hrs. cdnas were prepared using oligo(dt) and random primers, ligated to the EcoRI adaptor (5' AATTCGCGGCCGCGTCGAC 3') and cloned into the EcoRI site of pgad10 (Clontech) prey plasmids. The average insert size was 1.7 kbp and the range of insert size was 0.4 ~ 3.5 kbp. The resultant library was amplified once in E. coli to obtain the plasmid cdna library used for screening. PCR analysis with specific primers verified that the library contained apoptosis-related cdnas including caspase-3, -8, -9, Apaf-1, Bcl-2 and apoptosis inducing factor (AIF). Bait plasmids. An Nco I and Xho I digest of caspase-3 (S1) was integrated into pas2-1 (Clontech). The entire open reading frame of AIF was derived from I.M.A.G.E. clones (ATCC) and 25192, and sub-cloned into pas2-1 (between Nde I and EcoR I sites). DNA sequencing confirmed construct identities, and the expression of bait proteins (fused to binding domains, BD) was verified by immunobloting with monoclonal antibodies to the BD or bait-specific proteins or both. Modified two-hybrid screens. The YHB1 gene was deleted from yeast strain CG-1945 and the absence of NO consumption was verified (S2). Yeast two-hybrid screening was then performed in the CG-1945 yhb1 host. Cells were sequentially transformed with bait [selection in tryptophan (Trp)-deficient medium] and library [selection in Trp-leucine (Leu)-deficient medium] plasmids (S3). Cells containing pairs of interacting proteins were selected by their growth on histidine (His)-deficient medium and by expression of β-galactosidase (β-gal) activity. Specifically, interacting proteins reconstitute the active transcription factor Gal4, which drives transcription of β-gal and HIS3. Method 1: Auxotrophic selection was carried out on agar plates (15 cm diameter) made with Complete Supplement Mixture deficient in His-Trp-Leu (Q-Bio gene) (50 mm phosphate buffer, ph 7.2). Yeast were cultured for 4 days at 30 ºC in the presence or
2 absence of DETA-NO (40 µl of a 0.3M solution; Cayman Chemical). Clones that showed at least 3-fold greater growth in DETA-NO were selected and further analyzed for β-gal activity with O-nitrophenyl β-d-galactopyranoside (ONPG) as substrate. Prey plasmids were isolated from positive yeast clones and then re-introduced into the bait strain to confirm bait-prey interactions. Method 2: Cells seeded on 1.5% agar were covered with 3% low-melting-point agar, which in turn was layered with culture medium. NO donors (e.g. DETA-NO, 300 µm final concentration) were added to the liquid layer every 24 hours. Colonies were grown for 4 days as described in Method 1. Method 3: Auxotrophic selection was carried out in His-Trp-Leu-deficient buffered medium (see Method 1). Transformation with the cdna library was followed by overnight growth in medium deficient in Trp and Leu. Transformants were then grown for 3 days in His- deficient medium supplemented with DETA-NO (typically 200 µm final concentration). The plasmid DNA was harvested and transformed into E. coli. Individual clones were isolated, retransformed into bait strains, and reassessed for NOdependent growth and β-gal activity. Immunoprecipitation. Thirty million cells were lysed by homogenization in 1 ml IP buffer [10 mm NaPi, 100 mm NaCl, 1 mm EDTA, ph 7.9, with protease inhibitor cocktail (Roche)]. The supernatant obtained by centrifugation at 20,000x g for 10 min was used for immunoprecipitation. Caspase-3 immunoprecipitates (2.5 µg anti-caspase-3 monoclonal antibody, Transduction Laboratories) were washed, separated on 10% SDS- PAGE, and blotted with anti-asm antibody (Santa Cruz Biotechnology, and kindly provided by K. Sandhoff); 5% of the immunoprecipitate was blotted for caspase-3. Caspase-3 activity. Caspase-3 activity was measured with the EnzChek Caspase-3 kit (Molecular Probes) with Z-DEVD-AMC as substrate, and evaluated at 340/450 nm (excitation/emission). Acid sphingomyelinase activity. ASM activity was measured essentially as described (S4), using BODIPY FL C 5 -sphingomyelin (Molecular Probes) as substrate (1.5 nmol) in
3 assay buffer: 250 mm sodium acetate, ph 5.0, 10 mm EDTA. To assay Zn-stimulated ASM activity, 0.1 mm ZnCl was used without EDTA. Sample (30 µl) was incubated in assay buffer (70 µl) at 37 ºC for 1-3 hours. Reactions were terminated by adding 1.0 ml heptane and 0.29 ml isopropyl alcohol. Phases were then separated by adding 0.23 ml H 2 O, and the heptane phase was washed with 0.23 ml H 2 O. The fluorescence of the organic phase (containing BODIPY FL-ceramide) was assayed at 505/514 nm excitation/emission wavelengths. Mitochondrial purification. Isolation of mitochondria and determination of purity was as described (S5) with minor modification. Briefly, rat liver (10 g) or cultured cells collected from 15 dishes (15 cm diameter) were gently homogenized in 10 mm Tris-HCl, 200 mm mannitol and 50 mm sucrose, ph 7.4, using 10 strokes of a glass pestle (Wheaton Dounce). Following removal of nuclei and unbroken cells (centrifugation at 1000xg), heavy (3000xg) and light mitochondrial (20,000xg) fractions were separated further by Opti-Prep [60% solution (w/v) of iodixanol; Sigma] gradient centrifugation. Cytosolic (supernatant) and microsomal (pellet) fractions were separated at 100,000xg. Following protein quantification, each fraction was subjected to marker enzyme assays to determine purity of organelles. Acid phosphatase activity (lysosomal marker) was assayed by the hydrolysis of p-nitrophenyl phosphate to p-nirtophenolate anion and evaluated at 410 nm absorbance; succinate dehydrogenase activity (mitochondrial marker) was measured using sodium succinate as substrate and p-iodonitrotetrazolium violet (INT) as the electron acceptor, and evaluated at 490 nm (ε490 = 19,200 M -1 cm -1 ); catalase activity (peroxisomal marker) was derived from rates of H 2 O 2 consumption (S6). Removal of NO donor. DETA-NO treatment at neutral ph was followed by brief acidification (ph 5.0 x 10-min) to decompose the NO donor. ASM/procaspase-3 coincubations were then performed at ph 7.2.
4 Supporting Figures Fig. S1 Growth of yeast (CG-1945 yhb1) with sustained delivery of NO in the twohybrid assay. DETA-NO at less than 300 µm generates NO without inhibiting yeast growth (monitored by absorbance at 600 nm). Steady-state NO concentrations are maintained at ~100 nm-1 µm for several days as measured with an NO electrode (not shown).
5 Fig. S2 NO-dependent interaction of AIF with MIP-1α. Yeast ( yhb1) were transformed with Gal4 BD-AIF (Bait) and Gal4 AD-MIP-1α (Prey) (or Bait alone). (A) Robust growth of the AIF/MIP-1α clone requires NO (single asterisk, p<0.001 versus AIF/MIP-1α without NO; n=6). In contrast, the clone expressing AIF alone shows little growth in either the presence or absence of NO. Cells were grown in His-Trp-Leudeficient medium at 30 ºC for 72 hrs with or without 200 µm DETA-NO. (B) β- galactosidase activities in samples shown in A (single asterisk, p<0.001 vs. without NO; n=4). Supporting References and Notes S1. J. B. Mannick et al., Science 284, 651 (1999). S2. L. Liu, M. Zeng, A. Hausladen, J. Heitman, J. S. Stamler, Proc Natl Acad Sci USA 97, 4672 (2000). S3. P. L. Bartel, S. Fields, The Yeast Two-Hybrid System. A. Jacobson, Ed., Advances in Molecular Biology (Oxford University Press, New York, 1997). S4. E. Romiti et al., Mol Cell Biochem 205, 75 (2000).
6 S5. A. Okado-Matsumoto, I. Fridovich, J Biol Chem 276, (2001). S6. S. Nag, K. Saha, M. A. Choudhuri, Plant Science 157, 157 (2000).
TECHNICAL BULLETIN. In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits
In Vitro Bacterial Split Fluorescent Protein Fold n Glow Solubility Assay Kits Catalog Numbers APPA001 In Vitro Bacterial Split GFP "Fold 'n' Glow" Solubility Assay Kit (Green) APPA008 In Vitro Bacterial
More informationSupplementary Information: Materials and Methods. Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered
Supplementary Information: Materials and Methods Immunoblot and immunoprecipitation. Cells were washed in phosphate buffered saline (PBS) and lysed in TNN lysis buffer (50mM Tris at ph 8.0, 120mM NaCl
More informationProtocol for in vitro transcription
Protocol for in vitro transcription Assemble the reaction at room temperature in the following order: Component 10xTranscription Buffer rntp T7 RNA Polymerase Mix grna PCR DEPC H 2 O volume 2μl 2μl 2μl
More informationSupplementary Information
Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation
More informationAnalysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng
Analysing protein protein interactions using a GST-fusion protein to pull down the interacting target from the cell lysate Hong Wang and Xin Zeng Department of Molecular Genetics, Biochemistry and Microbiology,
More informationTable S1 Yeast strains used in this study Strain Genotype JSY7452* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 JSY7453* MAT ade2-1 leu2-3
Table S1 Yeast strains used in this study Strain Genotype JSY7452* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 JSY7453* MAT ade2-1 leu2-3 his3-11,15 trp1-1 ura3-1 can1-100 mfb1::his3 JSY8272 MAT
More informationMitochondrial DNA Isolation Kit
Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More information(Supplementary Methods online)
(Supplementary Methods online) Production and purification of either LC-antisense or control molecules Recombinant phagemids and the phagemid vector were transformed into XL-1 Blue competent bacterial
More informationSUPPLEMENTAL MATERIALS
SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURES Supplemental Figure S1. Analyses of the CRY1-SPA1 interaction (A) An auxotrophy growth assay (left) and a filter-based -galactosidase colorimetric assay (right)
More informationSupporting Information
Supporting Information Tal et al. 10.1073/pnas.0807694106 SI Materials and Methods VSV Infection and Quantification. Infection was carried out by seeding 5 10 5 MEF cells per well in a 6-well plate and
More informationGENETIC ENGINEERING worksheet
Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA
More informationSolid Phase cdna Synthesis Kit
#6123 v.02.09 Table of Contents I. Description... 2 II. Kit components... 2 III. Storage... 2 IV. Principle... 3 V. Protocol V-1. Preparation of immobilized mrna... 4 Protocol A: Starting from Tissue or
More informationSupplemental Data. Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes
Cell, Volume 135 Supplemental Data Noncoding Transcription by RNA Polymerase Pol IVb/Pol V Mediates Transcriptional Silencing of Overlapping and Adjacent Genes Andrzej T. Wierzbicki, Jeremy R. Haag, and
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationJung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
More informationPresto Mini Plasmid Kit
Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationENDEXT TM Technology. Wheat Germ Premium Expression Kit. Ver 1.7. CellFree Sciences Co., Ltd.
ENDEXT TM Technology Wheat Germ Premium Expression Kit Ver 1.7 CellFree Sciences Co., Ltd. 1. Purpose Wheat Germ Premium Expression Kit is a starter kit to ascertain if the Wheat Germ Cell-Free System
More informationSupplementary Figures 1-12
Supplementary Figures 1-12 Supplementary Figure 1. The specificity of anti-abi1 antibody. Total Proteins extracted from the wild type seedlings or abi1-3 null mutant seedlings were used for immunoblotting
More informationThe preparation of native chromatin from cultured human cells.
Native chromatin immunoprecipitation protocol The preparation of native chromatin from cultured human cells. All solutions need to be ice cold. Sucrose containing solutions must be made up fresh on the
More informationYeast 2-Hybrid Kayla Nygaard
Yeast 2-Hybrid 2.26.18 Kayla Nygaard Y2H - What is it? A method to screen for protein-protein interactions in yeast Capitalizes on GAL4 system in yeast. GAL4 has 2 domains DNA-Binding Domain (DB) Transcriptional
More informationThe yeast two-hybrid assay
Master program Molecular and Cellular Life Sciences Block 1: Intracellular membrane processes 11th October 2011 The yeast two-hybrid assay Fulvio Reggiori Department of Cell Biology, UMC Utrecht For what
More informationSensoLyte 620 HCV Protease Assay Kit *Fluorimetric*
SensoLyte 620 HCV Protease Assay Kit *Fluorimetric* Catalog # 71146 Kit Size 100 Assays (96-well plate) Convenient Format: Complete kit including all the assay components. Optimized Performance: Optimal
More informationHOOK 6X His Protein Purification (Yeast)
G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name HOOK 6X His Protein Purification (Yeast) For The Purification of His Tagged Proteins from
More informationENDEXT Technology. Instruction manual for protein synthesis. with wheat germ cell-free system
ENDEXT Technology Instruction manual for protein synthesis with wheat germ cell-free system 1 Protocol Overview Plasmid DNA construction (see Section 3.1) Preparation of plasmid DNA for transcription (see
More informationRNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the
Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the
More informationSupplementary data. sienigma. F-Enigma F-EnigmaSM. a-p53
Supplementary data Supplemental Figure 1 A sienigma #2 sienigma sicontrol a-enigma - + ++ - - - - - - + ++ - - - - - - ++ B sienigma F-Enigma F-EnigmaSM a-flag HLK3 cells - - - + ++ + ++ - + - + + - -
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Purification and biochemical characterization of acid phosphatase-i from seeds of Nelumbo nucifera Sanaullah Khan a*, Shahnaz Asmat c, Sajida Batool a, Mushtaq Ahmed b a Department
More informationYeast Nuclei Isolation Kit
Yeast Nuclei Isolation Kit Catalog Number KA3951 50 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067
INSTRUCTION MANUAL ZR-96 Genomic DNA Clean & Concentrator -5 Catalog Nos. D4066 & D4067 Highlights 96-well plate recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage,
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationSupplementary Methods Plasmid constructs
Supplementary Methods Plasmid constructs. Mouse cdna encoding SHP-1, amplified from mrna of RAW264.7 macrophages with primer 5'cgtgcctgcccagacaaactgt3' and 5'cggaattcagacgaatgcccagatcacttcc3', was cloned
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationSUPPLEMENTAL DATA. Supplementary Methods
SUPPLEMENTL DT Supplementary Methods TP agarose affinity chromatography Peroxisomes extracted from yeast transformed with CTS/pRS416-GPD were resuspended in solubilisation buffer [5 mm Tris-HCl ph 7.,
More information1. QUANTITY OF LYSATE 2. LYSIS BUFFER
SAMPLE PREPARATION 1. QUANTITY OF LYSATE The amount of protein requested for the Kinex KAM-880 Antibody Microarray service is 100 µg per sample at an approximate concentration of 2 mg/ml. If your samples
More informationFigure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
More informationUbiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by
Ubiquitin (76 aa) UB genes encode linear fusions of UB either to itself (poly-ub genes) or to other proteins these fusions are cleaved by deubiquitylases (DUBs) yielding mature Ub deubiquitylase FLAG 3
More informationSupplementary information
Supplementary information Table of Content: Supplementary Results... 2 Supplementary Figure S1: Experimental validation of AP-MS results by coimmunprecipitation Western blot analysis.... 3 Supplementary
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More information1. Cross-linking and cell harvesting
ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine
More informationof the Triphosphate of ATP
A Small Aptamer with Strong and Specific Recognition of the Triphosphate of Peter L. Sazani, Rosa Larralde and Jack W. Szostak Howard Hughes Medical Institute, and Department of Molecular Biology, Massachusetts
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationAmpliScribe T7-Flash Transcription Kit
AmpliScribe T7-Flash Transcription Kit Cat. Nos. ASF3257 and ASF3507 Available exclusively thru Lucigen. lucigen.com/epibio www.lucigen.com MA191E AmpliScribe T7-Flash Transcription Kit 12/2016 1 1. Introduction
More informationITS Sequencing in Millepora. 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector
Page 1 of 5 10/09 Subcloning DNA Fragments into pbluescript Preparation of pbluescript Vector 1. Digest 1 µg of pbluescript with Eco RI 2. Following digestion, add 0.1 volumes of 3M sodium acetate (ph
More informationSUPPLEMENTAL MATERIALS. Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary
SUPPLEMENTAL MATERIALS METHODS Chromatin immunoprecipitation assays. Single-cell suspensions of pituitary and liver cells were prepared from the indicated transgenic mice, as described (Ho et al, 2002).
More informationApoTrack Cytochrome c Apoptosis ICC Antibody Kit
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Kit Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and non-apoptotic
More informationSarker et al. Supplementary Material. Subcellular Fractionation
Supplementary Material Subcellular Fractionation Transfected 293T cells were harvested with phosphate buffered saline (PBS) and centrifuged at 2000 rpm (500g) for 3 min. The pellet was washed, re-centrifuged
More informationNEBNext RNase III RNA Fragmentation Module
SAMPLE PREPARATION NEBNext RNase III RNA Fragmentation Module Instruction Manual NEB #E6146S 100 reactions NEBNext RNase III RNA Fragmentation Module Table of Contents: Description....2 Applications....2
More informationTranscriptional regulation of BRCA1 expression by a metabolic switch: Di, Fernandez, De Siervi, Longo, and Gardner. H3K4Me3
ChIP H3K4Me3 enrichment.25.2.15.1.5 H3K4Me3 H3K4Me3 ctrl H3K4Me3 + E2 NS + E2 1. kb kb +82 kb Figure S1. Estrogen promotes entry of MCF-7 into the cell cycle but does not significantly change activation-associated
More informationGenomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -25 Catalog Nos. D4064 & D4065 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationZ Competent E. coli Transformation
467PR G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Z Competent E. coli Transformation (Cat. # GZ 4, GZ 5) think proteins! think G-Biosciences
More informationQuantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript;
Supplemental Methods Quantitative and non-quantitative RT-PCR. cdna was generated from 500ng RNA (iscript; Bio-Rad, Hercules, CA, USA) and standard RT-PCR experiments were carried out using the 2X GoTaq
More informationHuman Cell-Free Protein Expression System
Cat. # 3281 For Research Use Human Cell-Free Protein Expression System Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage...
More informationDNA miniprep by Alkaline Lysis (activity)
DNA miniprep by Alkaline Lysis (activity) Contents 1 Alkaline Lysis 2 Exercise 1: Plasmid DNA Mini-Prep by Alkaline Lysis 3 Identification of Plasmid DNA 4 Exercise 2: Restriction Digestion Identification
More informationCHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7
CHAPTER 4 Cloning, expression, purification and preparation of site-directed mutants of NDUFS3 and NDUFS7 subunits of human mitochondrial Complex-I Q module N DUFS2, 3, 7 and 8 form the core subunits of
More informationHigh Pure RNA Isolation Kit for isolation of total RNA from 50 samples Cat. No
for isolation of total RNA from 50 samples Cat. No. 1 88 665 Principle A single reagent lyses the sample lysis and inactivates RNase. In the presence of a chaotropic salt (guanidine HCl), the released
More informationGlutathione Resin. (Cat. # , , , ) think proteins! think G-Biosciences
191PR 05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Glutathione Resin (Cat. # 786 280, 786 310, 786 311, 786 312) think proteins! think
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationJan 25, 05 His Bind Kit (Novagen)
Jan 25, 05 His Bind Kit (Novagen) (1) Prepare 5ml of 1X Charge buffer (stock is 8X= 400mM NiSO4): 0.625ml of the stock + 4.375ml DH2O. (2) Prepare 13ml of 1X Binding buffer (stock is 8X = 40mM imidazole,
More informationZYMOLYASE PROTOCOLS. 7. Spin 2 minutes in microfuge, pour super into a fresh tube and repeat spin. Remove 500 ul to a fresh tube.
1 ZYMOLYASE PROTOCOLS Smash and Grab Zymolyase PROVIDED BY: DAVID AMBERG 1. Grow cells in 3mls selective media o/n 2. Pellet cells by 2 quick spins in a microfuge 3. Re-suspend cells in 200 u1 of the following
More informationRen Lab ENCODE in situ HiC Protocol for Tissue
Ren Lab ENCODE in situ HiC Protocol for Tissue Pulverization, Crosslinking of Tissue Note: Ensure the samples are kept frozen on dry ice throughout pulverization. 1. Pour liquid nitrogen into a mortar
More informationBREEDING, GENETICS, AND PHYSIOLOGY. OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System
BREEDING, GENETICS, AND PHYSIOLOGY OsLti6a Protein-Protein Interaction Is Not Detected by the GAL4 Yeast Two-Hybrid System M.R. Morsy and J.McD. Stewart ABSTRACT Low-temperature stress is a major limiting
More informationSupporting Information
Supporting Information Copper and zinc ions specifically promote non-amyloid aggregation of the highly stable human γ-d crystallin Liliana Quintanar, 1,* José A. Domínguez-Calva, 1 Eugene Serebryany, 2
More informationMitochondria/Cytosol Fractionation Kit
Mitochondria/Cytosol Fractionation Kit Sufficient for analysis of 50 samples Cat. No. MIT1000 FOR RESEARCH USE ONLY Not for use in diagnostic procedures. USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951)
More informationAdenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X
Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects
More informationGST Elution Buffer. (Cat. # ) think proteins! think G-Biosciences
191PR-05 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name GST Elution Buffer (Cat. #786-541) think proteins! think G-Biosciences www.gbiosciences.com
More informationCHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION. Recombinant DNA technology has revolutionized molecular biology and
204 CHAPTER 5 PTP-1B CLONING AND RECOMBINANT PROTEIN EXPRESSION SUMMARY Recombinant DNA technology has revolutionized molecular biology and genetics. Today, virtually any segment of DNA, the genetic material
More informationMolecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
More informationTransIT-TKO Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2150 INTRODUCTION TransIT-TKO is a broad spectrum sirna transfection reagent that enables high efficiency sirna delivery
More informationBACTERIAL PRODUCTION EXPRESSION METHOD OVERVIEW: PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT kda (full-length) 34.
BACTERIAL PRODUCTION PEF # GENE NAME EXPRESSION VECTOR MOLECULAR WEIGHT 2015-XXXX XXXX pet-32a 50.9 kda (full-length) 34.0 kda (cleaved) EXPRESSION METHOD OVERVIEW: Plasmid DNA was transformed into BL21
More informationPlasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions
Plasmid DNA Isolation Column Kit Instruction Manual Catalog No. SA-40012: 50 reactions SA-40011: 100 reactions Maxim Biotech, Inc. 780 Dubuque Avenue, So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296
More informationIgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only
IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective
More informationApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry of cytochrome c and mitochondria.
PROTOCOL ApoTrack Cytochrome c Apoptosis ICC Antibody Kit 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MSA07 Rev.1 DESCRIPTION ApoTrack Cytochrome c Apoptosis ICC Antibody Kit: 2 color immunocytochemistry
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationGenomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011
INSTRUCTION MANUAL Genomic DNA Clean & Concentrator -10 Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC),
More informationYeast Two-Hybrid Assay to Identify Interacting Proteins
Yeast Two-Hybrid Assay to Identify Interacting Proteins Aurora Paiano, 1 Azzurra Margiotta, 1,2 Maria De Luca, 1 and Cecilia Bucci 1,3 1 Department of Biological and Environmental Sciences and Technologies
More informationProtein A Agarose Immunoprecipitation Kit
Protein A Agarose Immunoprecipitation Kit Catalog Number KA0568 20 Reactions Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationpgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
More informationSupplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on
Supplementary Figure S1. Growth patterns of WT and siz1-2 plants and the effect of different nitrogen sources on their growth. After germination on MS media, seedlings were transferred to soil and treated
More informationHurricane Miniprep Kit PROTOCOL
Hurricane Miniprep Kit PROTOCOL Description: The Hurricane Miniprep Kit is designed for purification of up to 25 ug of high purity plasmid DNA from a starting volume of 2-5 ml of bacterial culture. The
More informationDNA Ligation Kit Ver. 1 Manual
Table of content Description... 2 Procedures and Examples A. Insertion of DNA into plasmid vectors... 3 B. Insertion of DNA into λ phage vectors... 4 C. Self-circulization of linear DNA... 4 D. Linker
More informationGel/PCR Extraction Kit
Gel/PCR Extraction Kit Item No: EX-GP200 (200rxns) Content Content Binding Buffer BD Wash Buffer PE Elution Buffer (10 mm Tris-HCl, ph 8.5) Spin Columns EX-GP200 80 ml 20 mlx3 10 ml 200 each Description
More informationAmplification Products for PCR and RT-PCR
Selection guide Polymerase Hot start Comment UptiTherm DNA pol. no Most economic. Lower error rate than Taq polymerase Available in several formats, master mix including or not dntp, Mg 2+..., in gel format
More informationSolutions to 7.02 Quiz II 10/27/05
Solutions to 7.02 Quiz II 10/27/05 Class Average = 83 Standard Deviation = 9 Range Grade % 87-100 A 43 74-86 B 39 55-73 C 17 > 54 D 1 Question 1 (56 points) While studying deep sea bacteria, you discover
More informationPRODUCT INFORMATION. Composition of SOC medium supplied :
Product Name : Competent Cell BL21(DE3)pLysS Code No. : DS260 Size : 100 μl 10 Competency : > 5 10 7 cfu/μg (puc19) Supplied product : SOC medium, 1 ml 10 This product is for research use only Description
More informationShirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria
Shirihai Lab Protocol for the study of oxygen consumption in isolated mitochondria This protocol was written Dr. Marc Liesa. You may contact Dr. Liesa at Liesa@bu.edu This protocol has been established
More informationEPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity
More informationFig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of
Supplementary data Fig. S1. CrgA intracellular levels in M. tuberculosis. Ten and twenty micrograms of cell free protein lysates from WT M. tuberculosis (Rv) together with various known concentrations
More informationRNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013)
RNA Blue REAGENT FOR RAPID ISOLATION OF PURE AND INTACT RNA (Cat. No. R011, R012, R013) WARNING: RNA Blue contains phenol and some other toxic components. After contact with skin, wash immediately with
More informationMarathon TM cdna Amplification Kit Protocol-at-a-Glance
(PT1115-2) Marathon cdna amplification is a fairly complex, multiday procedure. Please read the User Manual before using this abbreviated protocol, and refer to it often for interpretation of results during
More informationBuffers & Gel Stain Chemicals
Buffers & Gel Stain Chemicals 01 Buffers & Gel Stain Buffers 3 Gel Stain SilverStar Staining Kit 6 Buffers Overview Bioneer provides over 40 types of buffer and chemical essential for life science research.
More informationCHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM
CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM 4.1 Introduction The aim of the present study was to generate an unbiased data of interactions among N, P, M and G proteins
More informationFor the rapid isolation of Mitochondrial DNA in various cell and tissue samples.
ab65321 Mitochondrial DNA Isolation Kit Instructions for Use For the rapid isolation of Mitochondrial DNA in various cell and tissue samples. This product is for research use only and is not intended for
More informationMagExtactor -His-tag-
Instruction manual MagExtractor-His-tag-0905 F0987K MagExtactor -His-tag- Contents NPK-701 100 preparations Store at Store at 4 C [1] Introduction [2] Components [3] Materials required [4] Protocol3 1.
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationM X 500 µl. M X 1000 µl
GeneGlide TM sirna Transfection Reagent (Catalog # M1081-300, -500, -1000; Store at 4 C) I. Introduction: BioVision s GeneGlide TM sirna Transfection reagent is a cationic proprietary polymer/lipid formulation,
More informationBL21(DE3) expression competent cell pack DS265. Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube)
Product Name : Code No. : Kit Component : BL21(DE3) expression competent cell pack DS265 Component Code No. Contents Competent cell BL21(DE3) DS250 5 tubes (100 μl/tube) transfromation efficiency: 5 10
More informationVDL101.3 CLONING TRANSGENE INTO pad5f35
Purpose 1.1. The purpose of this protocol is to transfer a transgene from the pshuttlex plasmid to pad5/f35. 1.2. The starting material is 10 μg plasmid DNA. 1.3. This procedure is routinely performed
More information