CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM

Transcription

1 CHAPTER-4 IDENTIFICATION OF CHPV INTRAVIRAL INTERACTIONS BY YEAST TWO-HYBRID SYSTEM

2 4.1 Introduction The aim of the present study was to generate an unbiased data of interactions among N, P, M and G proteins of CHPV. Studying protein-protein interactions of virus can facilitate the understanding of the vital biological functions performed by the virus. The functional analysis of VSV protein interactions has generated details about its life cycle and the various steps in viral pathogenesis. The knowledge of CHPV life cycle and the functions of its proteins have been contemplated from VSV. Although, VSV and CHPV are phylogenetically related but they are markedly different in their host range (VSV is zoonotic virus, CHPV infects humans) and pathogenesis which necessitates the need to generate precise and detailed interaction information of the virus. The functional significance of the interplay of viral proteins in CHPV life cycle speculated from comparative studies are detailed as: The Nucleocapsid protein enwraps the genomic RNA and protects it from degradation by RNases. It is maintained in soluble and active form by its association with P protein which prevents the formation of N protein aggregates. This association also confers specificity to N protein for its RNA-binding activity. N protein also interacts with M protein and this association is important for encapsulating ribonucleoprotein (RNP) cores. D agostino and co-workers have proved that disrupting this interaction can impair the viral assembly [82]. P protein is another important regulatory protein that plays an indispensable role in viral transcription and replication and it does so by interacting with other viral proteins. It also facilitates the binding of L protein with the N- RNA template to form a tripartite complex required for genome transcription. The M protein is a major structural protein of the virus and is known to connect the viral envelope and the RNP core [83, 148] playing an important role in assembly [13, 14] and budding of the virions. Self associations of viral proteins also hold importance in viral life cycle like P protein self association is shown to be essential for transcriptional activity [86]. M protein dimerisation plays role in the long range organization of M molecules which is important for viral budding [85] and G protein self associates to form trimer molecules which acts as viral spikes [87]. The protein interaction studies have been conducted for various viruses and these studies have contributed in understanding the functions of uncharacterized proteins and their role in viral infection [91, 93]. For CHPV, the only reported interactions include selfassociation of N as well as P protein and N interaction with P protein [17, 18, 19, 20]. The lack of information about the interactions of other proteins and as such lesser known biology 57

3 of the virus create the requirement for interaction analysis. In the present study, work has been carried out to identify all the possible interactions among CHPV N, P, M and G proteins by using yeast two-hybrid assay. The four proteins accounting for ten unique interaction pairs were analyzed in sixteen combinations involving both BD and AD fusions for the prey. Y2H analysis of these interacting pairs identified several interactions for Chandipura virus. Some of the interactions have been identified for the first time for CHPV in this study. 58

4 4.2 Materials and methods Host strains MATCHMAKER GAL4 Two-Hybrid System 3 includes the yeast strains, AH109 and Y187. Strain AH109 (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4, gal80, LYS2::GAL1 UAS -GAL1 TATA -HIS3, MEL1, GAL2 UAS -GAL2 TATA -ADE2, URA3::MEL1 UAS - MEL1 TATA -lacz) consists of three reporter genes (ADE2,HIS3 and MEL1) under the control of three distinct GAL4 upstream activating sequences (UASs) and TATA boxes. Strain Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4, met, gal80, URA3::GAL1 UAS -GAL1 TATA -lacz, MEL 1) contains the LacZ reporter gene under the control of GAL1 UAS Yeast Two-Hybrid Vectors The yeast expression vectors, pgbkt7 (BD vector, 7300 bps; Clontech) and pgadt7 (AD vector, 7988 bps; Clontech) were used for cloning bait and prey templates, respectively, for yeast two-hybrid analysis. The pgbkt7 plasmid expresses proteins fused to GAL4 DNA binding domain (BD) with a c-myc epitope and the pgadt7 plasmid expresses proteins fused to a GAL4 activation domain (AD) with a HA (hemagglutinin) epitope (Table 4.1). Following transformation and expression of bait-bd and prey-ad carrying plasmids in yeast cells, both fusion proteins translocate to the nucleus of the yeast cells. The physical interaction among bait and prey proteins brings BD and AD in close proximity to reconstitute a functionally active transcription factor that binds specific activation sequences (UAS). In the present system (which contains a GAL upstream activator sequence in yeast hosts), the DNA-BD and AD when brought into close proximity, bind to UAS and activate the transcription of ADE2 and HIS3 reporter genes that permit the growth of yeast on selective media and MEL1 and LacZ reporter genes which allow blue/white selection. 59

5 Figure 4.1: Plasmid maps of pgbkt7 and pgadt7 vectors of Y2H system Table 4.1: Characteristic features of BD and AD vectors Features pgbkt7 (BD) vector pgadt7 (AD) vector Size 7.3 kb 7.9 kb Origin of replication puc (for E. coli) and 2μ ori (for S. cerevisiae) puc (for E. coli) and 2μ ori (for S. cerevisiae) Promoter ADH1 promoter (PADH1) ADH1 promoter (PADH1) Antibiotic resistance Ampicillin (Amp r ) Kanamycin (Kan r ) Nutritional marker TRP1 LEU2 Tag c-myc HA Control Vectors Control vectors used for the Y2H analysis included the BD vectors pgbkt7-53 and pgbkt7-lam; and AD vector pgadt7-t (Clontech). The plasmids pgbkt7-53 and pgbkt7-lam encodes GAL DNA-BD fusions of murine p53 and human lamin C proteins, respectively, while pgadt7-t encodes the large T-antigen of SV40 fused with GAL4 AD. The known interactors p53 and large T-antigen [103, 149] were taken as positive interaction control and the non interactors lamin C and large T-antigen [150, 151] were taken as negative interaction control. 60

6 4.2.4 PCR amplification of viral genes The open reading frames (ORFs) encoding CHPV N, P, M and G genes cloned in CHPV N-pET33b, P-pET3a, M-pUC19 and G-pUC19 vectors, respectively, were amplified using gene specific primers (Table 4.2). The details of these templates have been listed in Chapter 3 (Section 3.2.2). All PCR reactions were performed in a final volume of 100 µl using 0.5 pmol of each primer, 0.25 mm dntps (Sigma Aldrich), 6 U of Taq DNA polymerase (Sigma Aldrich), 1 U of Pfu DNA polymerase (Promega) and 1 ng of template DNA. The PCR products were purified using Qiagen PCR purification kit (Qiagen) as described in Section Table 4.2: Primers for amplification of CHPV genes for cloning in BD and AD vectors S. No. Construct Oligo name Primer Sequence 1 BD-N N F Nde I (BD) 5 GGAAGTGACATATGAGTTCTCAAGTATTCTGC 3 N R BamH I (BD) 5 GCTAACAGGATCCTCATGCAAAGAGTTTCCTGG 3 2 BD-P P F Nde I (BD) 5 GGAAGTGACATATGGAAGACTCGCAACTGTAT 3 P R Sal I (BD) 5 GGCACAAGTCGACTCAATTGAACTGGGGCTCAAG 3 3 BD-M M F Nde I (BD) 5 GGAAGTGACATATGCAAAGACTGAAGAAGTTTATAG 3 M R Sal I (BD) 5 GCACTATGTCGACTCAATGACTCTTAGAAATCAG 3 4 BD-G G F Nde I (BD) 5 GGAAGTGACATATGTATTTGAGTATAGCATTTCCAG 3 G R Sal I (BD) 5 GCACACTGTCGACTCATACTCTGGCTCTCATGTT 3 5 AD-N N F Nde I (AD) 5 GGAAGTGACATATGAGTTCTCAAGTATTCTGCATTT 3 N R Xho I (AD) 5 GGTGCATCTCGAGTCATGCAAAGAGTTTCCTGG 3 6 AD-P P F Nde I (AD) 5 GGAAGTGACATATGGAAGACTCGCAACTGTATCA 3 P R Xho I (AD) 5 GGTGCATCTCGAGTCAATTGAACTGGGGCTCAAG 3 7 AD-M M F Nde I (AD) 5 GGAAGTGACATATGCAACGTCTGAAGAAGTTTATAG 3 M R EcoR I (AD) 5 GGTGCATGAATTCTCAATGACTCTTAGAAATCAGC 3 8 AD-G G F Nde I (AD) 5 GGAAGTGACATATGTATTTGAGTATAGCATTTCCAG 3 G R EcoR I (AD) 5 GCTAACAGAATTCTCATACTCTGGCTCTCATGTT 3 Gene specific primers used for PCR amplification of Chandipura Virus N, P, M and G genes (F- Forward primer and R- Reverse primer). The names of the restriction enzymes are in italics and their recognition sequences in bold. 61

7 4.2.5 Cloning of N, P, M and G genes in pgbkt7 and pgadt7 vectors Purified PCR products of N, P, M and G genes (inserts) and their respective vectors were digested with corresponding restriction enzymes (mentioned in Table 4.2) required for cloning. Ligation was carried out at 1:5 (vector:insert) molar ratio with 100 ng of digested and purified vector and the ligation mixture was transformed in E.coli DH5α cells. Recombinant plasmid DNA was isolated from the transformed bacterial colonies and was screened by restriction enzyme digestion. The genes were cloned in-frame downstream of BD-c-myc tag of the pgbkt7 vector and AD-HA tag of pgadt7 vector, so as to generate BD-c-myc-bait (BD-N, BD-P, BD-M and BD-G) and AD-HA-prey fusion proteins (AD-N, AD-P, AD-M and AD-G), respectively. The detailed steps of cloning procedure have been discussed in Section Yeast two-hybrid analysis Yeast two-hybrid analysis was performed according to the manufacturer s instructions for MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech) Yeast strain maintenance, recovery from frozen stocks, and routine culturing Glycerol stocks of yeast cultures were prepared by resuspending a loopful of inoculum in 500 µl of YPD (1% yeast extract, 2% peptone and 2% dextrose; for untransformed S. cerevisiae strains AH109 and Y187) or SD (Selectively Deficient or Synthetically Defined) medium (2.6% minimal SD base and 1X appropriate dropout supplement; for transformed AH109 and Y187 cells) taken in a 1 ml cryovial. Sterile 50% glycerol was then added to obtain a final concentration of 25% and the vial was vortexed vigorously to thoroughly disperse the cells before freezing at -80 C. The cultures were revived by streaking a loopful of their glycerol stock on YPD or SD agar plates and incubating them at 30 C until the colonies grew 2-3 mm in diameter (~3-5 days). The revived cultures were maintained by routinely culturing them on appropriate media Preparation of yeast competent cells Frozen stocks of Y187/ AH109 S. cerevisiae yeast cells were streaked on YPDA agar plates (2% peptone, 1% yeast extract, 2% dextrose, 0.2% adenine hemisulphate and 2% agar) and incubated at 30 C for 3-5 days until yeast colonies had reached ~2 mm in diameter. Competent cells were prepared by inoculating several Y187/AH109 colonies (2-3 mm in 62

8 diameter) into 5 ml of YPDA medium. The culture was then vortexed for 5 minutes to disperse any clumps and incubated at 30 C and 230 rpm for hours until absorbance at OD 600 was >1.5. Following overnight incubation the cultures were diluted into fresh 50 ml YPDA medium to obtain an OD 600 value of and were further incubated at 30 C and 230 rpm for ~3 hours until the OD 600 reached The cultures were then centrifuged at 6000 rpm for 5 minutes at room temperature and the cell pellet was resuspended in 25 ml (half the culture volume) of autoclaved distilled water. Following centrifugation at 6000 rpm for 5 minutes at room temperature, the supernatant was discarded and the yeast pellet was resuspended in 225 µl of freshly prepared 1X TE/LiAc (10 mm Tris, 0.1 mm EDTA, 0.1 M LiAc, ph 7.5; for 50 ml culture) to attain competency. These cells were used immediately for transformation PEG/LiAc yeast transformation Competent Y187 (for BD vector fusion constructs)/ah109 (for AD vector fusion constructs) yeast cells (100 µl) were mixed with ~0.1 µg of plasmid DNA to be transformed, 10 μl of 10 mg/ml denatured Herring testes carrier DNA (denatured by heating at 100 C for 10 minutes) and 600 μl of PEG/LiAc (1X TE/LiAc and 40% PEG 3350) in 1.5 ml microcentrifuge tube. Tubes were gently vortexed and then incubated in a slanting position at 30 C and 230 rpm for 30 minutes. Following incubation, 70 μl DMSO was added and gently mixed by inversion. The cells were then given a heat shock at 42 C for 15 minutes and chilled on ice for 2-3 minutes. The mixture was centrifuged at 13,000 rpm for 15 seconds at room temperature. The supernatant was discarded and the pellet was resuspended in 500 μl of 1X TE. The transformation mixture (200 μl) was finally plated on either SD/-Trp (for pgbkt7 transformants) or SD/-Leu (for pgadt7 transformants) agar plates. The plates were incubated at 30 C for 3-4 days until colonies appeared Preparation of yeast cultures for protein extraction Transformed yeast cells were inoculated in 5 ml of appropriate SD selection medium and incubated at 30 C and 220 rpm overnight (primary culture). Corresponding volume of overnight culture was added to 50 ml of YPDA medium such that the initial OD 600 value was (secondary culture). The secondary culture was further incubated at 30 C and 220 rpm until the OD 600 reached The culture was then chilled by pouring into a prechilled falcon and was centrifuged at 4 C and 6000 rpm for 5 minutes. The supernatant was 63

9 discarded and the cell pellet was resuspended in 50 ml of ice-cold autoclaved distilled water. The pellet was recovered by centrifugation at 4 C and 6000 rpm for 5 minutes and immediately chilled and finally stored at -80 ºC. Each and every step during the preparation of the yeast cultures for protein expression was performed at 4 C to avoid proteolysis Yeast protein extraction (Urea/SDS method) The yeast cells were quickly thawed by adding complete cracking buffer [8 M Urea, 5% w/v SDS, 40 mm Tris-HCl ph 6.8, 0.1 mm EDTA, 0.4 mg/ml Bromophenol blue, 0.88% β-mercaptoethanol, protease inhibitor solution (Sigma Aldrich), 5X PMSF] prewarmed at 60 C. The total number of OD 600 units for a given culture was calculated by multiplying the OD 600 value of 1 ml sample with the culture volume. Since 100 μl of complete cracking buffer is to be added per 7.5 OD 600 units of cells, the total number of OD 600 units were divided by 7.5 and the quotient multiplied with 100 to determine the quantity (in μl) of prewarmed complete cracking buffer to be added to the pellet. Each cell pellet was thawed in the prewarmed cracking buffer at 60 C for not more than 2 minutes to avoid proteolysis. Additional aliquots of PMSF (1X) were added every 7 minutes until the samples were ready to be analysed by SDS-PAGE or stored at -80 C, since the initial excess PMSF (5X) in the cracking buffer degrades quickly because of short half life. Each cell suspension was transferred to a 1.5 ml microcentrifuge tube containing 80 μl of glass beads (Sigma Aldrich) per 7.5 OD 600 units of cells. The samples were then heated at 70 C for 10 minutes to free the membrane associated proteins and mixed vigorously by vortexing for 1 minute. Debris and unbroken cells were pelleted by centrifugation at 4 C and 14,000 rpm for 5 minutes and the supernatants were transferred to clean 1.5 ml microcentrifuge tubes placed on ice (first supernatants). These first supernatants were boiled at 100 C in a water bath for 3-5 minutes, vortexed vigorously for 1 minute and subsequently centrifugation at 4 C and 14,000 rpm for 5 minutes. The supernatants obtained for the second time (second supernatants) were combined with the first supernatants. The samples were boiled at 100 C for 10 minutes and loaded on 10% SDS-PAGE or stored at -80 C. 64

10 SDS-PAGE and Western Blot Analysis SDS-PAGE and Western blotting were performed as explained in Section The expression of proteins extracted from the yeast cells were detected with mouse monoclonal anti c-myc (for BD fusion proteins; 1: 2000 dilution, Sigma Aldrich) or mouse monoclonal anti HA (for AD fusion proteins; 1:1000 dilution, Santa Cruz, USA) antibodies Autoactivation Analysis Autoactivation is the independent activation of the HIS3 reporter by either the DNA- BD or AD fusion construct in the absence of the other partner. Autoactivation by BD and AD constructs of CHPV N, P, M and G proteins was tested by independently transforming them into Y187/ AH109 yeast cells and plating on SD/-Trp/-His and SD/-Leu/-His media, respectively. Empty BD and AD vectors were taken as negative controls Screening of protein-protein interactions BD and AD fusion constructs were transformed in yeast cells by two methods i.e., sequential transformation and yeast mating Sequential transformation The DNA-BD/bait plasmid was transformed in competent AH109 yeast cells following the transformation protocol explained in Section The AH109 cells transformed with BD plasmid were then made competent (Section ) and the DNA- AD/prey plasmid was transformed into them. The transformants were plated at first on SD/- Trp/-Leu media and incubated at 30 ºC for 3-5 days to check for successful transformation. The interaction among the bait and prey proteins was identified by screening the transformants on SD/-Trp/-Leu/-His media Yeast Mating A loopful of Y187 and AH109 cells transformed with BD/bait and AD/prey plasmids, respectively, were inoculated in 500 µl of YPDA media taken in a 1.5 ml microcentrifuge tube. The cells were resuspended by vortexing and then incubated at 30 C overnight (16 20 hours) with shaking at 220 rpm. Aliquots of 100 µl of the mated clones were plated on SD/-Trp/-Leu media to ensure successful mating. Finally, the interacting partners were screened on SD/-Trp/-Leu/-His media. The plasmids, pgbkt7-53 and pgadt7-t 65

11 encoding the known interacting tumor suppressor protein p53 and Simian Virus 40 (SV40) large T-antigen fused with BD and AD domains, respectively were used as positive control, whereas pgbkt7-lam and pgadt7-t which encode the non-interacting proteins Lamin and SV40 large T-antigen, served as negative control for interaction studies Alpha-galactosidase assay The interaction among bait and prey proteins results in the activation of GAL4 promoter. Y187 and AH109 cells secrete α-galactosidase enzyme in response to GAL4 activation, which can be detected on medium containing X-α-gal (Clontech). The mated clones were screened for α-galactosidase activity by plating them on X-α-gal indicator plates which were prepared by adding 20 µg/ml of X-α-gal in dimethylformamide (Appendix A) to sterile SD triple dropout media (SD/-Trp/-Leu/-His). The plates were incubated at 30 C and the appearance of blue coloured colonies indicated the secretion of α-galactosidase. BD-p53 and AD-T interacting pair was taken as positive interaction control while BD-Lam and AD-T was taken as non-interaction control. Plasmid pcl 1 which encodes the full length GAL4 protein, transformed in AH109 was taken as positive experimental control for α-galactosidase assay. 66

12 4.3 Results Generation of CHPV fusion constructs Potential interactions among CHPV proteins were identified by cloning N, P, M and G genes in yeast two-hybrid vectors; pgbkt7 (bait) having GAL4 DNA binding domain (BD) and pgadt7 (prey) having GAL4 DNA activation domain (AD). Each ORF encoding CHPV protein was PCR amplified using gene specific primers incorporating appropriate restriction enzyme sites which enabled cloning in pgbkt7 and pgadt7 vectors. Following amplification the products were analyzed on 1.2% agarose gel and were observed at their expected sizes (Figure 4.2) [N (1200 bp), P (800 bp), M (690 bp) and G (1500 bp)]. The PCR products were purified using Qiagen PCR purification kit and digested with corresponding restriction enzymes. Subsequently, the digested amplicons were once again purified and finally cloned in respective vectors (BD or AD) using T4 DNA ligase as discussed in Section The recombinant clones were then transformed in competent E. coli DH5α cells and screened on LB agar plates containing appropriate antibiotics (50 µg/ml kanamycin for BD transformants and 100 µg/ml ampicillin for AD transformants). Cloning was confirmed by isolating the recombinant plasmid DNA from E. coli cells and subjecting them to restriction enzyme digestion. Insert release at 1200 bp on digestion with Nde I and BamH I enzymes confirmed the cloning of construct BD-N (Figure 4.3). Likewise, insert release at 800 bp, 690 bp and 1500 bp on digestion with Nde I and Sal I enzymes confirmed the cloning of P, M and G genes in BD vector, respectively (Figure 4.4 and 4.5). Similarly, the cloning of N and P genes and M and G genes in AD vector was validated by digestion with Nde I/ Xho I and Nde I/ EcoR I enzyme combinations, respectively. The insert release at 1200 bp, 800 bp, 690 bp and 1500 bp corresponded to N, P, M and G genes (Figure 4.6, 4.7 and 4.8). Only BD and AD vectors were also digested with the same enzyme combinations and used as controls. Constructs generated by cloning N, P, M and G genes in BD vector were named as BD-N, BD-P, BD-M and BD-G, respectively and AD- prey fusion constructs were named as AD-N, AD-P, AD-M and AD-G, respectively. 67

13 (a) (b) Figure 4.2: PCR amplification of N, P, M and G genes of CHPV CHPV genes were PCR amplified with gene specific primers for cloning in BD and AD vectors. Panel (a) represents amplification of genes with primers for BD vector. Lane 2, 3, 4 and 5 shows the amplified G, P, M and N genes, respectively. Panel (b) represents the amplification of CHPV genes with primers for AD vector. Lane 1, 2, 3 and 4 shows the amplified G, M, P and N genes, respectively. All the genes were observed at their expected sizes. N gene (1200 bp), P gene (800 bp), M gene (690 bp) and G gene (1500 bp). L1 and L2 is 1 kb DNA ladder (a; L2, Sigma Aldrich, b; L1, Fermentas, Molecular sizes are indicated). Figure 4.3: Restriction digestion of BD-N using Nde I and BamH I Recombinant plasmid DNA isolated from E. coli DH5α cells were digested with Nde I and BamH I enzymes to confirm cloning of N gene in BD vector. Lane 1, 2, 3 represent the positive clones for BD-N showing the released fragment at the size of N gene i.e., 1.2 kb. C (control) is the empty BD vector digested with the same enzyme combination, L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated). 68

14 Figure 4.4: Restriction digestion of BD-P using Nde I and Sal I Cloning of P gene in BD vector was validated by digesting the recombinant plasmid DNA with Nde I and Sal I enzymes. Lane 2-6 represents the different minipreps of BD-P. Released fragment at the size of P gene (0.8 kb) is seen in lanes 2-5. Mini P5 (lane 6) is negative. Lane 7 is the control BD vector. L is 100 bp DNA ladder; L2 is 1 kb DNA ladder (Sigma Aldrich; Molecular sizes are indicated). Figure 4.5: Restriction digestion of BD-M and BD-G using Nde I and Sal I Restriction enzyme digestion was performed for the screening of BD-M and BD-G recombinants using Nde I and Sal I. Lanes 3-7 represent the minipreps tested for BD-G while lanes 8-11 show the minis tested for BD-M. The fragment is released at the size of the genes i.e., 1.5 kb for G gene and 0.7 kb for M gene. L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated). C is the control BD vector 69

15 Figure 4.6: Restriction digestion of AD-N recombinants using Nde I and Xho I The plasmid DNAs were digested with Nde I and Xho I enzymes to screen for positive recombinant clones of AD-N. Lanes 3-7 represent the digested minipreps showing the released fragment at 1.2 kb for N gene. L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated). C is the control AD vector digested with the same enzyme combination. Figure 4.7: Restriction digestion of AD-P using Nde I and Xho I AD-P recombinants were validated by restriction enzyme digestion of plasmid DNAs using Nde I and Xho I enzymes. Lanes 1-10 are the digested minis, the released fragment (0.8 kb) is observed in lanes 4 and 8. Lane 11 is the control AD vector. L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated). 70

16 Figure 4.8: Restriction digestion of AD-M and AD-G using Nde I and EcoR I Screening for recombinants of AD-M and AD-G fusions was carried out by restriction enzyme digestion using Nde I and EcoR I. lanes 1-8 represent the digested minipreps for AD-M showing released fragment at the size of M gene i.e., 0.7 kb while lanes 9-11 show the digested minipreps for AD-G with released fragment at the size of G gene i.e., 1.5 kb. Lane 12 is the empty AD vector digested with the same enzymes. L1 is 1 kb DNA ladder (Fermentas; Molecular sizes are indicated) Interaction analysis using yeast two-hybrid system The Y2H bait (pgbkt7) and prey (pgadt7) vectors encoding the CHPV ORF s (N, P, M and G) were transformed in competent Y187 and AH109 cells and selected on SD/-Trp (Figure 4.9) and SD/-Leu (Figure 4.10) medium, respectively. Plasmids pgbkt7 and pgadt7 without inserts (only vectors) and pgbkt7-53, pgbkt7-lam and pgadt7-t control vectors were also transformed in competent Y187 and AH109 cells. Figure 4.9: Selection of BD fusion transformants on SD/-Trp agar plates CHPV N, P, M and G genes as BD fusions were transformed in Y187 strain of yeast cells by PEG/LiAc method and selected on SD/-Trp agar plates (clockwise from top left; BD-N, BD-P, BD-M and BD-G). 71

17 Figure 4.10: Selection of AD fusion transformants on SD/-Leu agar plates Recombinant AD vectors carrying CHPV N, P, M and G genes were transformed in AH109 strain of yeast cells and selected on SD/-Leu agar plates (clockwise from top left; AD-N, AD-P, AD-M and AD-G). The expression of BD-N, BD-P, BD-M and BD-G proteins in yeast Y187 cells and AD fusion proteins in yeast AH109 cells was confirmed prior to proceeding with interaction studies. Yeast cells harbouring recombinant vectors were lysed and the extracted cellular proteins were analyzed by 10% SDS-PAGE and Western blotting. Western blotting was performed using anti c-myc (BD) and anti HA (AD) mabs and all the proteins were detected at their expected sizes [protein size with additional ~25 kda for BD + c-myc tag and AD + HA tag; N protein: 72 kda, P protein: 58 kda (observed at higher size), M protein: 51 kda, G protein: 94 kda, Figure 4.11 and 4.12 for BD and AD fusions, respectively]. BD-P (Figure 4.11 lane 2) and AD-P (Figure 4.12 lane 3) were observed at a higher size due to the aberrant mobility of P protein as explained previously in Section Figure 4.11: Expression of viral genes with BD fusion in Y187 yeast strain The expression of BD fusion proteins in Y187 yeast cells was checked by Western blotting using anti c-myc mabs. Lane 1: BD-N; ~72 kda, Lane 2: BD-P; ~58 kda, Lane 3: BD-M; ~51 kda, Lane 4: BD-G; ~94 kda. M is prestained protein ladder (Fermentas; molecular sizes are indicated in kda). 72

18 Figure 4.12: Expression of viral genes with AD fusion in AH109 yeast strain The expression of AD fusion proteins in AH109 yeast cells was checked by Western blotting using anti-ha mabs. Lane 2: AD-G; ~94 kda, Lane 3: AD-M; ~51 kda, Lane 4: AD-P; ~58 kda, Lane 5: AD-N; ~72 kda. M is prestained protein ladder (Fermentas; molecular sizes are indicated in kda). Following expression, all fusion constructs (both BD and AD) were checked for autoactivation of the HIS3 reporter gene. The interaction of either the BD construct or the AD construct (in the absence of the other) with transcriptional factors bound to TATA boxes leads to basal transcriptional activity which activates the HIS3 reporter gene, a process termed as autoactivation. In order to rule out this possibility, which otherwise might lead to false positive results, all BD fusion constructs transformed in Y187 cells were plated on SD/-Trp/- His media and all AD fusion constructs transformed in AH109 cells were plated on SD/-Leu/- His media. Except for BD-P, none of the other constructs were found to activate the reporter gene alone as indicated by the absence of growth on corresponding SD plates. Only BD-P was found to directly activate the reporter gene (Figure 4.13) in the absence of any AD fusion partner. However AD-P did not exhibit such property and hence studies involving P protein were completed using AD-P. 73

19 Figure 4.13: Autoactivation exhibited by BD-P fusion protein Y187 yeast cells expressing BD-P fusion protein was observed to grow on SD/-Trp/-His media indicating the activation of the reporter gene HIS3, in the absence of any AD partner. Subsequently, two different Y2H strategies were employed for transformation of BD and AD vectors in yeast cells; sequential transformation and mating. Both these methods were standardized with positive (pgbkt pgadt7-t) and negative (pgbkt7-lam + pgadt7-t) interaction controls to assess the reproducibility of the results. However, due to simplicity, yeast mating method was chosen over sequential transformation. A total of 16 combinations of protein pairs were generated by mating Y187 (transformed with BD constructs of N, P, M and G) and AH109 (transformed with AD constructs of N, P, M and G) [Figure 4.14] yeast cells. In addition to the above 16 combinations, the Y187 (transformed with BD constructs of N, P, M and G) and AH109 (transformed with AD constructs of N, P, M and G) yeast cells were mated with cells harbouring only AD (AH109) and BD (Y187) vectors, respectively (Figure 4.15 (a) and (b), respectively). Besides the test and control matings, the matchmaker system interaction controls [pgbkt7-53 with pgadt7-t and pgbkt7-lam with pgadt7-t; Figure 4.15 (c)] were also considered for interaction analysis. Transformed haploid yeast strains (Y187 & AH109) selected on SD/-Trp and SD/-Leu plates were mated together and the resulting diploids were selected on SD media deficient in tryptophan and leucine (SD/-Trp/-Leu). Growth on this medium indicated the presence of both the plasmids irrespective of any protein interaction. 74

20 (a) (b) (c) (d) Figure 4.14: Mating among Y187 and AH109 cells expressing CHPV N, P, M and G proteins as BD and AD fusions, respectively. CHPV N, P, M and G genes as BD and AD fusions transformed in S. cerevisiae strains Y187 and AH109, respectively, were mated together in all possible combinations and spread on SD/-Trp/-Leu agar plates to screen for the presence of both the plasmids. (a): AD-N with BD-N, BD-P, BD-M and BD-G. (b): AD-P with BD-N, BD-P, BD-M and BD-G. (c): AD-M with BD-N, BD-P, BD-M and BD-G. (d): AD-G with BD-N, BD-P, BD-M and BD-G. 75

21 (a) (b) (c) Figure 4.15: Mating of yeast cells expressing CHPV N, P, M and G proteins with the cells harbouring control vectors CHPV N, P, M and G genes as BD and AD fusions transformed in S. cerevisiae strains Y187 and AH109, respectively, were mated with yeast cells transformed with only AD and BD vectors and spread on SD/-Trp/-Leu plates to screen for the presence of both the plasmids. (a): BD-N, P, M and G with only AD. (b): AD-N, P, M and G with only BD. (c): pgadt7-t with pgbkt7-lam and pgbkt7-53. The diploid clones were screened for interacting proteins by plating on SD/-Trp/-Leu/- His media. Growth was monitored for 2 weeks and the protein pair expressed in the diploid clone growing on histidine deficient plates was considered as a positive interacting pair. Isolated colonies of mated diploids were further amplified on histidine deficient media. Each interaction was considered from both directions (as both bait and prey fusion), accounting for 10 unique protein pairs. Diploid clones carrying protein pairs which included BD-P grew on triple dropout medium because of the autoactivation shown by BD-P (Figure 4.16 sectors 1, 17, 18, 19 and 20). The studies involving P protein interaction with N, M and G proteins were thus considered wherein the interacting partner was AD-P. In order to attain further stringency and also to eliminate potential false positives, two reporter genes under the control of different promoters were employed i.e., HIS3 and MEL1. While HIS3 provided nutritional selection on 76

22 histidine deficient medium (Figure 4.16), MEL1 was used for blue/white screening by α - galactosidase assay (Figure 4.17). All possible combinations among four viral proteins with controls were streaked in patches on SD/-Trp/-Leu/-His/α-gal plate and the plate was incubated at 30 C. Interaction among pgbkt7-53 and pgadt7-t was taken as positive control while pgbkt7- Lamin and pgadt7-t served as negative interaction control (Figure 4.17; sectors 25 and 26). A total of 6 interactions were observed to be positive by yeast twohybrid system (Table 4.3 and 4.4). These constitute NN, NP, NM, NG, MM and GG interactions, four of these interactions (NM, NG, MM and GG) were novel for CHPV. Although PP interaction was observed in Y2H, due to the autoactivation shown by the BD-P protein this interaction was not conclusively positive. The results of intraviral protein interaction analysis for CHPV have been summarized in Table 4.3 for all possible 16 pairs and in Table 4.4 for 10 unique interacting pairs. The interactions identified by Y2H were further confirmed by other assays which are detailed in Chapter-5. 77

23 Sector Bait Prey Sector Bait Prey Sector Bait Prey 1 P Empty vector 9 N P 17 P P 2 N Empty vector 10 N N 18 P N 3 M Empty vector 11 N M 19 P M 4 G Empty vector 12 N G 20 P G 5 Empty vector P 13 M N 21 G P 6 Empty vector N 14 M M 22 G N 7 Empty vector M 15 M P 23 G M 8 Empty vector G 16 M G 24 G G Figure 4.16: Interaction screening results for CHPV N, P, M and G proteins The yeast strains Y187 and AH109 harbouring recombinant bait and prey vectors encoding CHPV N, P, M and G genes were systematically mated with each other, and the diploid cells were screened for the activation of reporter gene HIS3 on SD/-Trp/-Leu/-His plates. Each protein was tested as both bait and prey fusion for a test interaction. Presence of growth on medium lacking histidine indicated interaction between the proteins while absence indicates no interaction. Sectors with P gene in bait vector (1, 17, 18, 19 and 20) are showing growth due to autoactivation of reporter gene by BD-P. 78

24 Sector Bait Prey Sector Bait Prey Sector Bait Prey 1 N N 10 M P 19 M Empty vector 2 N P 11 M M 20 G Empty vector 3 N M 12 M G 21 Empty vector N 4 N G 13 G N 22 Empty vector P 5 P N 14 G P 23 Empty vector M 6 P P 15 G M 24 Empty vector G 7 P M 16 G G 25 p53 T antigen 8 P G 17 N Empty vector 26 Lamin T antigen 9 M N 18 P Empty vector Figure 4.17: X-alpha galactosidase assay for interaction confirmation All possible interacting pairs among CHPV viral proteins along with controls were plated on X-α gal (SD/-Trp/- Leu/-His/α gal) medium. Formation of blue coloured colonies further confirmed the putative positive interactions observed in Y2H analysis while absence of colour was an indication for non-interacting protein pair. Sectors represent the controls taken for the assay. Sectors with P gene in bait vector (5, 6, 7, 8 and 18) are showing blue colouration due to autoactivation of reporter gene by BD-P. 79

25 Table 4.3: Results of viral-viral protein interaction analysis of CHPV +: represents positive interaction - : represents negative interaction? : represents growth due to autoactivation of BD-P N, P, M and G proteins were taken both as bait and prey fusions in the Y2H analysis. The first protein partner in the pair was bait (BD fusion protein) and the second was prey i.e., AD fusion protein. Y2H assay was performed using two independent reporter genes i.e., HIS3 and MEL1. 80

26 Table 4.4: Summarized results of viral-viral protein interaction analysis of CHPV +: represents positive interaction -: represents negative interaction?: inconclusive 81

27 4.4 Discussion The outcome of most of the biological processes is determined by protein-protein interactions, which occur when two proteins bind to each other in a highly specific manner. Although viruses are very simple entities, it is the systematic orchestration of the interactions among their encoded proteins that they gain access to highly complex eukaryotic cells such as those of humans, replicate within them and cause diseases whilst evading the cellular immune surveillance. The revelation of these protein interactions can thus help in gaining insight into viral architecture and pathogenesis. Different experimental techniques have been developed to unravel the global picture of protein interactions in the cell. Some of them characterize individual protein interactions while others are advanced for screening interactions on a genome-wide scale. Among different interaction analysis methodologies, yeast two-hybrid (Y2H) screening remains the most practical and efficient tool to identify interacting partners because it allows high-throughput screening in addition to being very sensitive for the identification of transient interactions [99, 152, 153]. Comprehensive Y2H studies for the identification of intraviral protein interactions have been carried out for many viruses which include Vaccinia virus [154], SARS Coronavirus [93], Epstein barr virus [92] and Kaposi s sarcoma associated herpesvirus [91] and provided a framework to study potential interactions among viral proteins and their functional roles. In this chapter, Y2H analysis was performed in an unbiased manner, considering all possible combinations of CHPV N, P, M and G proteins in order to identify the interactions among them. A total of six interactions (NN, NP, NM, NG, MM and GG) have been identified among the four viral proteins which included the previously documented interactions among N and P proteins [17, 18, 19, 20]. The reproducibility of the reported associations in the present study validated the approach of interaction analysis by Y2H. Among the four novel interactions identified (NM, NG, MM and GG), NG interaction is being reported for the first time for the family Rhabdoviridae. Although there had been some indirect evidences earlier regarding the possible contact of N and G proteins such as the cross linking experiments performed by Mudd and Swanson in 1978 which suggested the possible association of N and G proteins in VSV [155] and virus structure assembly studies by Barge and co-workers in 1993, which also suggested a possible contact between the ribonucleoprotein complex and cytoplasmic tail of G protein via N protein [156]. Since, the system employed in the present study for PPI analysis dealt with pairwise binary interactions among two proteins, the 82

28 interaction between the core nucleocapsid protein (N) and membrane glycoprotein (G) could be considered relevant in the absence of M protein as observed among the viruses of the family Bunyaviridae (which include matrix protein deficient viruses) [157]. On the basis of the available literature and the outcome of the present study, it was thus hypothesized that the cytoplasmic tail of CHPV G protein could associate with the N protein through the lateral spaces between the subunits of M helix. As NG interaction, the self associations of viral membrane proteins M and G, also identified in this study, could have an important role in virion assembly and/or virion membrane biogenesis since matrix protein dimerisation is required for membrane integrity [85] and the functionally active trimeric form of G protein is required for receptor identification and membrane fusion [91]. Previous studies suggested that the interaction among N and M proteins provides stability and rigidity to the nucleocapsid core and outer matrix of the virion [158]. Together the functional relevance of the six interactions (NN, NP, NM, NG, MM and GG) identified by Y2H have been justified. 83