Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene
|
|
- Maria May
- 6 years ago
- Views:
Transcription
1 Laboratory of Tropical Crop Improvement Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene E. Santos, S. Remy, E. Thiry, S. Windelinckx, R. Swennen and L. Sági KATHOLIEKE UNIVERSITEIT LEUVEN 27 th International Horticultural Congress Aug 13-19, 2006 Seoul, Korea
2 Outline I. Introduction II. III. IV. High-throughput screening for low temperature responsive promoters Isolation and analysis of T-DNA flanking sequences Identification of activated insertion(s) V. Conclusions and perspectives
3 I. Introduction Banana Economy: The 4th most important food crop Diet: Major staple food in tropical countries Characteristics: (Sub)tropical, vegetative propagation, parthenocarpy Genome: Mbp; 11 chromosomes; ploidy: 2x, 3x, 4x; genomic groups (AAA, AAB, ABB ) Molecular tools: Genetic transformation systems, limited sequence data (EST, BAC, SAGE libraries), molecular markers, INIBAP ( Global Musa Genomics Consortium ( Source: INIBAP
4 I. Introduction Promoter usage in transgenic bananas Heterologous Virus Plant Recombinant CaMV35S (derivates), ScBV, TaBV, BSV, BBTV Rice: actin Maize: ubiquitin Arabidopsis: ubiquitin,tubulin Emu, (ocs) 3 mas Homologous Banana: actin, EFE, ACO1, ACC Functionality/stability, less biosafety concerns (cis-genic bananas) Constitutive, tissue specificity, inducible (biotic/abiotic stress)
5 I. Introduction Promoter tagging via Agrobacterium transformation petkul2 T-DNA genomic DNA RB LB luc + -Tnos e35s-neo-t35s P gene Agrobacterium transformation RB LB luc + -Tnos e35s-neo-t35s Screening for different parameters
6 I. Introduction Luciferase reporter gene system luc LUC luciferin + ATP + O 2 oxyluciferin + AMP + PPi + CO 2 + light (562 nm) ultrasensitive digital CCD camera system
7 II. High-throughput screening for low temperature responsive promoters Months after Agrobacterium infection Banana promoter tagging Phase Cell colonies Cell cultures Regenerating cultures Plantlets Culture Screening /Petri Dish 5,600-8,400/image
8 II. High-throughput screening for low temperature responsive promoters Banana - low temperature Low temperature stress chilling / freezing Real-time luciferase screening Cell colonies Plantlets Live Source: 8 C LUC
9 II. High-throughput screening for low temperature responsive promoters Luciferase activation in transgenic cell colonies (~16,000) Screening Treatment Luciferase activity at 26 C No. Frequency (%) Response at 8 C Induced % (No.) Repressed % (No.) 1 RT C 8 C (10) 0.57 (84) LUC Live 26 C 8 C
10 II. High-throughput screening for low temperature responsive promoters Screening during in vitro regeneration Cell colony Live 26 C 8 C Regenerating culture Live 26 C 8 C Plantlet Live 26 C 8 C ET2-17 e35s-luc + (+) (-) Bar = 1cm Low LUC activity High LUC activity
11 III. Isolation and analysis of T-DNA flanking sequences Southern analysis kb MM ET2-lines petkul2 Contr C 5C luc + probe 2.0 Min. No. T-DNA copies: Average: 3.5
12 III. Isolation and analysis of T-DNA flanking sequences TAIL-PCR ET2-17 ET2-34 AD2-1 AD2 AD2-1 AD M bp M bp
13 III. Isolation and analysis of T-DNA flanking sequences Amplification of RB flanking sequences No. of specific PCR amplicons ET2- Line No. T-DNA TAIL-PCR I-PCR copies (Southern) AD2 AD2-1 AD2-5 BsrGI BclI Different sequences NT NT Average NT = Not Tested
14 III. Isolation and analysis of T-DNA flanking sequences Analysis of T-DNA flanking sequences Bioinformatic tools: PlantCARE, PLACE = TATA box = DRE-like = ABRE-like = Transcrition start site (TSSP) 5 -tagged sequence T-DNA 3 -tagged sequence kb kb kb Banana EST 1.17 kb kb 0.86 kb kb kb Direct repeat (306 bp) Direct repeat (681 bp) kb kb
15 IV. Identification of activated insertion(s) RT-PCR RB luc + -Tnos e35s-neo-t35s LB C C Live ET2-17 LUC RB flanking sequence 17-1 M gdna Leaf Leaf Leaf cdna Pseu Corm Root Leaf Pseudostem 17-2 Corm Live ET2-34 LUC C 34 gdna cdna gdna cdna M Leaf Leaf Leaf Leaf Root 34-1
16 V. Conclusions and perspectives Conclusions Different low temperature responses identified Relation low temperature and in vitro regeneration Tagged lines with one to five T-DNA copies Isolation of T-DNA flanking sequences RT-PCR revealed promoter activity Perspectives Back-transformation of selected putative promoter sequences Confirmation of low temperature and developmental regulation
17 Laboratory of Tropical Crop Improvement Acknowledgement VLIR-IUS program cooperation VLIR-ESPOL, Belgium-Ecuador
Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationPLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
More informationThe demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
More informationGene Editing in Cereals. Emma Wallington
Gene Editing in Cereals Emma Wallington emma.wallington@niab.com NIAB Group NIAB established in 1919 by charitable donations for the improvement of crops.. with higher.. genetic quality A charitable company
More informationSbmenu: Blog.nwsource.com
Sbmenu: Blog.nwsource.com phh4@le.ac.uk www.molcyt.com Repetitive DNA and its evolution in the Musa genome Polymorphisms DNA Evolution Breeding Conservation W067: Banana (Musa) Genomics Plant and Animal
More informationRefresher on gene expression - DNA: The stuff of life
Plant Pathology 602 Plant-Microbe Interactions Lecture 2 Molecular methods for studying hostpathogen interactions I Sophien Kamoun kamoun.1@osu.edu The Ohio State University Ohio Agricultural Research
More informationExperimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada
Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationTRANSGENIC TECHNOLOGIES: Gene-targeting
TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis
More informationMatthias Fladung, Fadia El-Sherif. vti, Institute for Forest Genetics Grosshansdorf, Germany
Activation tagging in aspen using an inducible two component Ac/Ds-enhancer element system Matthias Fladung, Fadia El-Sherif vti, Institute for Forest Genetics Grosshansdorf, Germany Poplar genome sequencing
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationCharacterization and isolation of T-DNA tagged banana promoters active during in vitro regeneration and low temperature stress
Katholieke Universiteit Leuven Faculteit Bio-ingenieurswetenschappen Departement Biosystemen Afdeling Plantenbiotechniek DISSERTATIONES DE AGRICULTURA Doctoraatsproefschrift nr. 787 aan de faculteit Bio-ingenieurswetenschappen
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationSupplementary Materials
Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.
More informationLectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
More informationIntroduction Use of quality planting materials - prerequisite for increasing production and productivity of banana
A novel molecular technique for mass indexing of tissue cultured banana plants for Banana Bunchy Top Virus (BBTV) W.A.R.T. Wickramaarachchi, K.T. Ragnaswamy and K.S. Shankaraappa Horticultural Crops Research
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationM Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour
Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries
More informationLecture 15: Functional Genomics II
Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More information13-3 Cell Transformation
Recombinant DNA Host Cell DNA Target gene Modified Host Cell DNA 1 of 21 Transforming Bacteria Transforming Bacteria During transformation, a cell takes in DNA from outside the cell. The external DNA becomes
More information1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3
Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental
More informationGenetic engineering of Banana: the case of an orphan crop. Rony Swennen Catholic University Leuven Belgium
Genetic engineering of Banana: the case of an orphan crop Rony Swennen Catholic University Leuven Belgium There around 800 million people undernourished The state of food insecurity in the world The amount
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationGENE CLONING: overview
TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol
More informationTRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:
Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationSupplemental Data. Wu and Xue (2010). Plant Cell /tpc
Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationAbcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
More informationTesting GM crops. Mitesh Shrestha
Testing GM crops Mitesh Shrestha GMO food/feed testing is based on some fundamental principles of genetic engineering and cellular physiology: DNA: The introduction of foreign DNA into a recipient plant
More informationTransgene stability in forest trees
Transgene stability in forest trees 1996 2001 Matthias Fladung, Hans Hoenicka Johann-Heinrich i h von Thünen Institut t (vti) Institut für Forstgenetik, Sieker Landstr. 2, 22927 Grosshansdorf Aspects of
More informationChapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering
Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death
More informationCONSTRUCTION OF GENOMIC LIBRARY
MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences
More informationLecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA
Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationChap. 6 Principles of Genetic Manipulation of Organisms: Recombinant DNA (rdna) Technology
1 Chap. 6 Principles of Genetic Manipulation of Organisms: Recombinant DNA (rdna) Technology Purpose and expected outcomes 1. Recombinant DNA (rdna) technology allows scientists to transfer genes from
More informationBIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction
BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationChapter 1. from genomics to proteomics Ⅱ
Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationCharacterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA
Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More information- 1 - Supplemental Data
- 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationHybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops
Genetic Engineering Genetic engineering is the alteration of genetic code by means, and is therefore different from traditional selective breeding. Only allowing desired characteristics to reproduce. Scorpion
More informationGENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,
More informationSupporting Information
Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but
More informationAnalysis of gene function
Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or
More informationOsMYC2, an essential factor for JA-inductive sakuranetin production in rice,
Supplementary information OsMYC2, an essential factor for JA-inductive sakuranetin production in rice, interacts with MYC2-like proteins that enhance its transactivation ability Satoshi Ogawa 1, Koji Miyamoto
More informationLecture 21: Association Studies and Signatures of Selection. November 6, 2006
Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection
More informationSupplemental information Precise A T to G C base editing in the rice genome
Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base
More informationINNOVAPI WP3 Activity 3 Health Parameters
Harmonization of methods for measuring viral load and bio-markers of aging Stage1 : Quality check of extracted RNA in Torino A qpcr on 18S gene showed that the extracted samples also contain genomic DNA.
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
More informationBiochemical characteristics and gene expression profiles of two. paralogous luciferases from the Japanese firefly Pyrocoelia
Electronic Supplementary Material (ESI) for Photochemical & Photobiological Sciences. This journal is The Royal Society of Chemistry and Owner Societies 0 Electronic Supplementary Material (ESI) for Photochemical
More informationIntroduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph
Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent
More informationSupplemental Figure 1 A
Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC
More informationPrimePCR Assay Validation Report
Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin
More informationLegal arguments to keep plants. such as cisgenesis outside the GMO regulation
Legal arguments to keep plants from novel breeding techniques such as cisgenesis outside the GMO regulation dr Henk J Schouten Wageningen University and Research Centre & Inova Fruit bv Content Definition
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationGenetic analysis - mutants
Genetic analysis - mutants Forward genetics From mutant phenotype to gene, from gene to protein function Reverse genetics From gene to mutant phenotype, to function Forward genetics 1. Screen for mutants
More informationTheoretical cloning project
Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give
More informationPBG 430/530 Exam
1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups
More informationChapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
More informationCRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava
CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava Dr Patience Chatukuta Post-doctoral Fellow Plant Biotechnology Research Program, Wits University ACGT Forum, Wits Professional
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationBIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
More informationMasao ISHIMOTO and Keito NISHIZAWA. National Agricultural Research Center for Hokkaido Region, Sapporo ABSTRACT
Masao ISHIMOTO and Keito NISHIZAWA National Agricultural Research Center for Hokkaido Region, Sapporo 062-8555 ABSTRACT Soybean [Glycine max (L.) Merrill] is one of the world's most important crops. Elucidation
More informationSupplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.
Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationMolecular Biology: Gene cloning
Molecular Biology: Gene cloning Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. CLONING VECTORS The central component of a gene cloning experiment is the vector or
More informationBarley as a model for cereal engineering and genome editing. Wendy Harwood
Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter
More informationpfb and pfb-neo Retroviral Vectors
pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY
More informationA Flexible Architecture for Plant Functional Genomics in Space Environments
A Flexible Architecture for Plant Functional Genomics in Space Environments Dr. Terri Lomax Department of Botany and Plant Pathology Oregon State University A Flexible Architecture for Plant Functional
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationA Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology
A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate
More informationCRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts. Estefania Elorriaga and Steven H. Strauss Oregon State University
CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts Estefania Elorriaga and Steven H. Strauss Oregon State University Background Outline CRISPR, goals, target genes Mutagenesis
More informationSupplemental Information
Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure
More informationMOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV)
Trans. Natl. Acad.Sci. Tech. Philippines 21: 287-291 (1999). ISSN 0 J J 5-8848 MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV) VERMANDO M. AQUINO I, HUI WANG2, EVELYN MAE
More informationCourse summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.
Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein
More informationCFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1
A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationBiology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library
Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for
More informationPrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
More informationSerial Analysis of Gene Expression
Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE
More informationVIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN BANANA
VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN BANANA R. Selvarajan V. Balasubramanian VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN
More informationNew methodologies for gene. identification and characterization: Concepts and case studies
Corso di Formazione GenHORT New methodologies for gene identification and characterization: Concepts and case studies 24 Marzo 2014 Federica Consiglio Giorgia Batelli Michael Van Oosten Course Outline
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More information