Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene

Size: px
Start display at page:

Download "Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene"

Transcription

1 Laboratory of Tropical Crop Improvement Tagging Low Temperature Responsive Promoters in Banana Using the Luciferase Reporter Gene E. Santos, S. Remy, E. Thiry, S. Windelinckx, R. Swennen and L. Sági KATHOLIEKE UNIVERSITEIT LEUVEN 27 th International Horticultural Congress Aug 13-19, 2006 Seoul, Korea

2 Outline I. Introduction II. III. IV. High-throughput screening for low temperature responsive promoters Isolation and analysis of T-DNA flanking sequences Identification of activated insertion(s) V. Conclusions and perspectives

3 I. Introduction Banana Economy: The 4th most important food crop Diet: Major staple food in tropical countries Characteristics: (Sub)tropical, vegetative propagation, parthenocarpy Genome: Mbp; 11 chromosomes; ploidy: 2x, 3x, 4x; genomic groups (AAA, AAB, ABB ) Molecular tools: Genetic transformation systems, limited sequence data (EST, BAC, SAGE libraries), molecular markers, INIBAP ( Global Musa Genomics Consortium ( Source: INIBAP

4 I. Introduction Promoter usage in transgenic bananas Heterologous Virus Plant Recombinant CaMV35S (derivates), ScBV, TaBV, BSV, BBTV Rice: actin Maize: ubiquitin Arabidopsis: ubiquitin,tubulin Emu, (ocs) 3 mas Homologous Banana: actin, EFE, ACO1, ACC Functionality/stability, less biosafety concerns (cis-genic bananas) Constitutive, tissue specificity, inducible (biotic/abiotic stress)

5 I. Introduction Promoter tagging via Agrobacterium transformation petkul2 T-DNA genomic DNA RB LB luc + -Tnos e35s-neo-t35s P gene Agrobacterium transformation RB LB luc + -Tnos e35s-neo-t35s Screening for different parameters

6 I. Introduction Luciferase reporter gene system luc LUC luciferin + ATP + O 2 oxyluciferin + AMP + PPi + CO 2 + light (562 nm) ultrasensitive digital CCD camera system

7 II. High-throughput screening for low temperature responsive promoters Months after Agrobacterium infection Banana promoter tagging Phase Cell colonies Cell cultures Regenerating cultures Plantlets Culture Screening /Petri Dish 5,600-8,400/image

8 II. High-throughput screening for low temperature responsive promoters Banana - low temperature Low temperature stress chilling / freezing Real-time luciferase screening Cell colonies Plantlets Live Source: 8 C LUC

9 II. High-throughput screening for low temperature responsive promoters Luciferase activation in transgenic cell colonies (~16,000) Screening Treatment Luciferase activity at 26 C No. Frequency (%) Response at 8 C Induced % (No.) Repressed % (No.) 1 RT C 8 C (10) 0.57 (84) LUC Live 26 C 8 C

10 II. High-throughput screening for low temperature responsive promoters Screening during in vitro regeneration Cell colony Live 26 C 8 C Regenerating culture Live 26 C 8 C Plantlet Live 26 C 8 C ET2-17 e35s-luc + (+) (-) Bar = 1cm Low LUC activity High LUC activity

11 III. Isolation and analysis of T-DNA flanking sequences Southern analysis kb MM ET2-lines petkul2 Contr C 5C luc + probe 2.0 Min. No. T-DNA copies: Average: 3.5

12 III. Isolation and analysis of T-DNA flanking sequences TAIL-PCR ET2-17 ET2-34 AD2-1 AD2 AD2-1 AD M bp M bp

13 III. Isolation and analysis of T-DNA flanking sequences Amplification of RB flanking sequences No. of specific PCR amplicons ET2- Line No. T-DNA TAIL-PCR I-PCR copies (Southern) AD2 AD2-1 AD2-5 BsrGI BclI Different sequences NT NT Average NT = Not Tested

14 III. Isolation and analysis of T-DNA flanking sequences Analysis of T-DNA flanking sequences Bioinformatic tools: PlantCARE, PLACE = TATA box = DRE-like = ABRE-like = Transcrition start site (TSSP) 5 -tagged sequence T-DNA 3 -tagged sequence kb kb kb Banana EST 1.17 kb kb 0.86 kb kb kb Direct repeat (306 bp) Direct repeat (681 bp) kb kb

15 IV. Identification of activated insertion(s) RT-PCR RB luc + -Tnos e35s-neo-t35s LB C C Live ET2-17 LUC RB flanking sequence 17-1 M gdna Leaf Leaf Leaf cdna Pseu Corm Root Leaf Pseudostem 17-2 Corm Live ET2-34 LUC C 34 gdna cdna gdna cdna M Leaf Leaf Leaf Leaf Root 34-1

16 V. Conclusions and perspectives Conclusions Different low temperature responses identified Relation low temperature and in vitro regeneration Tagged lines with one to five T-DNA copies Isolation of T-DNA flanking sequences RT-PCR revealed promoter activity Perspectives Back-transformation of selected putative promoter sequences Confirmation of low temperature and developmental regulation

17 Laboratory of Tropical Crop Improvement Acknowledgement VLIR-IUS program cooperation VLIR-ESPOL, Belgium-Ecuador

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might

More information

Gene Editing in Cereals. Emma Wallington

Gene Editing in Cereals. Emma Wallington Gene Editing in Cereals Emma Wallington emma.wallington@niab.com NIAB Group NIAB established in 1919 by charitable donations for the improvement of crops.. with higher.. genetic quality A charitable company

More information

Sbmenu: Blog.nwsource.com

Sbmenu: Blog.nwsource.com Sbmenu: Blog.nwsource.com phh4@le.ac.uk www.molcyt.com Repetitive DNA and its evolution in the Musa genome Polymorphisms DNA Evolution Breeding Conservation W067: Banana (Musa) Genomics Plant and Animal

More information

Refresher on gene expression - DNA: The stuff of life

Refresher on gene expression - DNA: The stuff of life Plant Pathology 602 Plant-Microbe Interactions Lecture 2 Molecular methods for studying hostpathogen interactions I Sophien Kamoun kamoun.1@osu.edu The Ohio State University Ohio Agricultural Research

More information

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada

Experimental Tools and Resources Available in Arabidopsis. Manish Raizada, University of Guelph, Canada Experimental Tools and Resources Available in Arabidopsis Manish Raizada, University of Guelph, Canada Community website: The Arabidopsis Information Resource (TAIR) at http://www.arabidopsis.org Can order

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

TRANSGENIC TECHNOLOGIES: Gene-targeting

TRANSGENIC TECHNOLOGIES: Gene-targeting TRANSGENIC TECHNOLOGIES: Gene-targeting Reverse Genetics Wild-type Bmp7 -/- Forward Genetics Phenotype Gene or Mutations First Molecular Analysis Second Reverse Genetics Gene Phenotype or Molecular Analysis

More information

Matthias Fladung, Fadia El-Sherif. vti, Institute for Forest Genetics Grosshansdorf, Germany

Matthias Fladung, Fadia El-Sherif. vti, Institute for Forest Genetics Grosshansdorf, Germany Activation tagging in aspen using an inducible two component Ac/Ds-enhancer element system Matthias Fladung, Fadia El-Sherif vti, Institute for Forest Genetics Grosshansdorf, Germany Poplar genome sequencing

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Characterization and isolation of T-DNA tagged banana promoters active during in vitro regeneration and low temperature stress

Characterization and isolation of T-DNA tagged banana promoters active during in vitro regeneration and low temperature stress Katholieke Universiteit Leuven Faculteit Bio-ingenieurswetenschappen Departement Biosystemen Afdeling Plantenbiotechniek DISSERTATIONES DE AGRICULTURA Doctoraatsproefschrift nr. 787 aan de faculteit Bio-ingenieurswetenschappen

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Table S1. Oligonucleotide sequences and PCR conditions used to amplify the indicated genes. TA = annealing temperature; gdna = genomic DNA; cdna = complementary DNA; c = concentration.

More information

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in

More information

Introduction Use of quality planting materials - prerequisite for increasing production and productivity of banana

Introduction Use of quality planting materials - prerequisite for increasing production and productivity of banana A novel molecular technique for mass indexing of tissue cultured banana plants for Banana Bunchy Top Virus (BBTV) W.A.R.T. Wickramaarachchi, K.T. Ragnaswamy and K.S. Shankaraappa Horticultural Crops Research

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 78 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT78 Human This gene is a member of the type II keratin gene family

More information

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types

Lecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting

More information

Lecture 22: Molecular techniques DNA cloning and DNA libraries

Lecture 22: Molecular techniques DNA cloning and DNA libraries Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Lecture 15: Functional Genomics II

Lecture 15: Functional Genomics II Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

13-3 Cell Transformation

13-3 Cell Transformation Recombinant DNA Host Cell DNA Target gene Modified Host Cell DNA 1 of 21 Transforming Bacteria Transforming Bacteria During transformation, a cell takes in DNA from outside the cell. The external DNA becomes

More information

1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3

1. Introduction Drought stress and climate change Three strategies of plants in response to water stress 3 Contents 1. Introduction 1 1.1 Drought stress and climate change 3 1.2 Three strategies of plants in response to water stress 3 1.3 Three closely related species of Linderniaceae family are experimental

More information

Genetic engineering of Banana: the case of an orphan crop. Rony Swennen Catholic University Leuven Belgium

Genetic engineering of Banana: the case of an orphan crop. Rony Swennen Catholic University Leuven Belgium Genetic engineering of Banana: the case of an orphan crop Rony Swennen Catholic University Leuven Belgium There around 800 million people undernourished The state of food insecurity in the world The amount

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

GENE CLONING: overview

GENE CLONING: overview TMMO504: Laboratory Molecular Tropical Medicine and Genetics GENE CLONING: overview Instructor: Asst.Prof.Dr. Santi Maneewatchararangsri Department of Molecular Tropical Medicine and Genetics, Mahidol

More information

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. transient. stable. - Two methods to produce transgenic animals: Only for teaching purposes - not for reproduction or sale CELL TRANSFECTION transient stable TRANSGENIC ANIMALS - Two methods to produce transgenic animals: 1- DNA microinjection 2- embryonic stem cell-mediated

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

Supplemental Data. Wu and Xue (2010). Plant Cell /tpc

Supplemental Data. Wu and Xue (2010). Plant Cell /tpc Supplemental Data. Wu and Xue (21). Plant Cell 1.115/tpc.11.75564 A P1-S P1-A P2-S P2-A P3-S P3-A P4-S P4-A B Relative expression Relative expression C 5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5 5. 4.5 4. 3.5 3.

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.

Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September

More information

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying

More information

Testing GM crops. Mitesh Shrestha

Testing GM crops. Mitesh Shrestha Testing GM crops Mitesh Shrestha GMO food/feed testing is based on some fundamental principles of genetic engineering and cellular physiology: DNA: The introduction of foreign DNA into a recipient plant

More information

Transgene stability in forest trees

Transgene stability in forest trees Transgene stability in forest trees 1996 2001 Matthias Fladung, Hans Hoenicka Johann-Heinrich i h von Thünen Institut t (vti) Institut für Forstgenetik, Sieker Landstr. 2, 22927 Grosshansdorf Aspects of

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

CONSTRUCTION OF GENOMIC LIBRARY

CONSTRUCTION OF GENOMIC LIBRARY MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences

More information

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Chap. 6 Principles of Genetic Manipulation of Organisms: Recombinant DNA (rdna) Technology

Chap. 6 Principles of Genetic Manipulation of Organisms: Recombinant DNA (rdna) Technology 1 Chap. 6 Principles of Genetic Manipulation of Organisms: Recombinant DNA (rdna) Technology Purpose and expected outcomes 1. Recombinant DNA (rdna) technology allows scientists to transfer genes from

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Chapter 1. from genomics to proteomics Ⅱ

Chapter 1. from genomics to proteomics Ⅱ Proteomics Chapter 1. from genomics to proteomics Ⅱ 1 Functional genomics Functional genomics: study of relations of genomics to biological functions at systems level However, it cannot explain any more

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

Characterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA

Characterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

- 1 - Supplemental Data

- 1 - Supplemental Data - 1-1 Supplemental Data 2 3 4 5 6 7 8 9 Supplemental Figure S1. Differential expression of AtPIP Genes in DC3000-inoculated plants. Gene expression in leaves was analyzed by real-time RT-PCR and expression

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops

Hybridization - the act or process of mating organisms of varieties or species to create a hybrid. Insecticide crops Genetic Engineering Genetic engineering is the alteration of genetic code by means, and is therefore different from traditional selective breeding. Only allowing desired characteristics to reproduce. Scorpion

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

Get to Know Your DNA. Every Single Fragment.

Get to Know Your DNA. Every Single Fragment. HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID mcf.2 transforming sequence-like Mcf2l Mouse Description Not Available C130040G20Rik,

More information

Supporting Information

Supporting Information Supporting Information Yuan et al. 10.1073/pnas.0906869106 Fig. S1. Heat map showing that Populus ICS is coregulated with orthologs of Arabidopsis genes involved in PhQ biosynthesis and PSI function, but

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

OsMYC2, an essential factor for JA-inductive sakuranetin production in rice,

OsMYC2, an essential factor for JA-inductive sakuranetin production in rice, Supplementary information OsMYC2, an essential factor for JA-inductive sakuranetin production in rice, interacts with MYC2-like proteins that enhance its transactivation ability Satoshi Ogawa 1, Koji Miyamoto

More information

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006

Lecture 21: Association Studies and Signatures of Selection. November 6, 2006 Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection

More information

Supplemental information Precise A T to G C base editing in the rice genome

Supplemental information Precise A T to G C base editing in the rice genome Supplemental information Precise A T to G C base editing in the rice genome Kai Hua, Xiaoping Tao, Fengtong Yuan, Dong Wang, Jian-Kang Zhu Contents Supplemental Figure 1. TA cloning results of two base

More information

INNOVAPI WP3 Activity 3 Health Parameters

INNOVAPI WP3 Activity 3 Health Parameters Harmonization of methods for measuring viral load and bio-markers of aging Stage1 : Quality check of extracted RNA in Torino A qpcr on 18S gene showed that the extracted samples also contain genomic DNA.

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin

More information

Biochemical characteristics and gene expression profiles of two. paralogous luciferases from the Japanese firefly Pyrocoelia

Biochemical characteristics and gene expression profiles of two. paralogous luciferases from the Japanese firefly Pyrocoelia Electronic Supplementary Material (ESI) for Photochemical & Photobiological Sciences. This journal is The Royal Society of Chemistry and Owner Societies 0 Electronic Supplementary Material (ESI) for Photochemical

More information

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph

Introduction to Plant Genomics and Online Resources. Manish Raizada University of Guelph Introduction to Plant Genomics and Online Resources Manish Raizada University of Guelph Genomics Glossary http://www.genomenewsnetwork.org/articles/06_00/sequence_primer.shtml Annotation Adding pertinent

More information

Supplemental Figure 1 A

Supplemental Figure 1 A Supplemental Figure 1 A Supplemental Data. Han et al. (2016). Plant Cell 10.1105/tpc.15.00997 BamHI -1616 bp SINE repeats SalI ATG SacI +1653 bp HindIII LB HYG p35s pfwa LUC Tnos RB pfwa-bamhi-f: CGGGATCCCGCCTTTCTCTTCCTCATCTGC

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name integrin, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID ITGA1 Human This gene encodes the alpha 1 subunit of integrin

More information

Legal arguments to keep plants. such as cisgenesis outside the GMO regulation

Legal arguments to keep plants. such as cisgenesis outside the GMO regulation Legal arguments to keep plants from novel breeding techniques such as cisgenesis outside the GMO regulation dr Henk J Schouten Wageningen University and Research Centre & Inova Fruit bv Content Definition

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Genetic analysis - mutants

Genetic analysis - mutants Genetic analysis - mutants Forward genetics From mutant phenotype to gene, from gene to protein function Reverse genetics From gene to mutant phenotype, to function Forward genetics 1. Screen for mutants

More information

Theoretical cloning project

Theoretical cloning project Theoretical cloning project Needed to get credits Make it up yourself, don't copy Possible to do in groups of 2-4 students If you need help or an idea, ask! If you have no idea what to clone, I can give

More information

PBG 430/530 Exam

PBG 430/530 Exam 1 PBG 430/530 Exam 2 2013 1. In a deoxyribonucleotide, 5 and 3 refer to the a. start site for transcription. b. start site for translation. c. carbons where (respectively) the phosphate and hydroxyl groups

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava

CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava CRISPR and protoplasts: Hand-inhand towards high-throughput gene silencing in cassava Dr Patience Chatukuta Post-doctoral Fellow Plant Biotechnology Research Program, Wits University ACGT Forum, Wits Professional

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

Masao ISHIMOTO and Keito NISHIZAWA. National Agricultural Research Center for Hokkaido Region, Sapporo ABSTRACT

Masao ISHIMOTO and Keito NISHIZAWA. National Agricultural Research Center for Hokkaido Region, Sapporo ABSTRACT Masao ISHIMOTO and Keito NISHIZAWA National Agricultural Research Center for Hokkaido Region, Sapporo 062-8555 ABSTRACT Soybean [Glycine max (L.) Merrill] is one of the world's most important crops. Elucidation

More information

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6.

Supplemental Figure legends Figure S1. (A) (B) (C) (D) Figure S2. Figure S3. (A-E) Figure S4. Figure S5. (A, C, E, G, I) (B, D, F, H, Figure S6. Supplemental Figure legends Figure S1. Map-based cloning and complementation testing for ZOP1. (A) ZOP1 was mapped to a ~273-kb interval on Chromosome 1. In the interval, a single-nucleotide G to A substitution

More information

Pyrosequencing. Alix Groom

Pyrosequencing. Alix Groom Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Molecular Biology: Gene cloning

Molecular Biology: Gene cloning Molecular Biology: Gene cloning Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. CLONING VECTORS The central component of a gene cloning experiment is the vector or

More information

Barley as a model for cereal engineering and genome editing. Wendy Harwood

Barley as a model for cereal engineering and genome editing. Wendy Harwood Barley as a model for cereal engineering and genome editing Wendy Harwood MonoGram 29 th April 2015 www.bract.org BRACT Transformation Platform Over-expression of single genes RNAi based silencing Promoter

More information

pfb and pfb-neo Retroviral Vectors

pfb and pfb-neo Retroviral Vectors pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY

More information

A Flexible Architecture for Plant Functional Genomics in Space Environments

A Flexible Architecture for Plant Functional Genomics in Space Environments A Flexible Architecture for Plant Functional Genomics in Space Environments Dr. Terri Lomax Department of Botany and Plant Pathology Oregon State University A Flexible Architecture for Plant Functional

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology

A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology A Lot of Cutting and Pasting Going on Here Recombinant DNA and Biotechnology How Are Large DNA Molecules Analyzed? Naturally occurring enzymes that cleave and repair DNA are used in the laboratory to manipulate

More information

CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts. Estefania Elorriaga and Steven H. Strauss Oregon State University

CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts. Estefania Elorriaga and Steven H. Strauss Oregon State University CRISPR/Cas9 Efficiency and Biological Impacts in Transgenic Poplars and Eucalypts Estefania Elorriaga and Steven H. Strauss Oregon State University Background Outline CRISPR, goals, target genes Mutagenesis

More information

Supplemental Information

Supplemental Information Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

More information

MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV)

MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV) Trans. Natl. Acad.Sci. Tech. Philippines 21: 287-291 (1999). ISSN 0 J J 5-8848 MOLECULAR CLONING OF THE PHILIPPINE ISOLATE OF BANANA BUNCHY TOP VIRUS (BBTV) VERMANDO M. AQUINO I, HUI WANG2, EVELYN MAE

More information

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects. Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID protein kinase N1 PKN1 Human The protein encoded by this gene belongs to the protein

More information

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1

CFTR-null wt CFTR-null 1.0. Probe: Neo R. Figure S1 A. B. 4.0 3.0 2.0 1.0 4.0 3.0 2.0 1.0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Probe: Neo R CFTR-null wt CFTR-null Figure S1 A. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 10kb 8kb CFTR-null wt B. Probe: CFTR

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha

More information

Serial Analysis of Gene Expression

Serial Analysis of Gene Expression Serial Analysis of Gene Expression Cloning of Tissue-Specific Genes Using SAGE and a Novel Computational Substraction Approach. Genomic (2001) Hung-Jui Shih Outline of Presentation SAGE EST Article TPE

More information

VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN BANANA

VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN BANANA VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN BANANA R. Selvarajan V. Balasubramanian VIRUS INDEXING - A TECHNOLOGY FOR THE PRODUCTION OF QUALITY PLANTING MATERIAL IN

More information

New methodologies for gene. identification and characterization: Concepts and case studies

New methodologies for gene. identification and characterization: Concepts and case studies Corso di Formazione GenHORT New methodologies for gene identification and characterization: Concepts and case studies 24 Marzo 2014 Federica Consiglio Giorgia Batelli Michael Van Oosten Course Outline

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information