A transgenic mouse for in vivo detection of endogenous labeled mrna

Size: px
Start display at page:

Download "A transgenic mouse for in vivo detection of endogenous labeled mrna"

Transcription

1 Artiles A transgeni mouse for in vivo detetion of endogenous laeled mrna Timothée Lionnet,2, Kevin Czaplinski,5, Xavier Darzaq 3, Yaron Shav-Tal 4, Amer L Wells,5, Jeffrey A Chao, Hye Yoon Park,2, Valeria de Turris, Melissa Lopez-Jones & Roert H Singer,2 2 Nature Ameria, In. All rights reserved. Live-ell single mrna imaging is a powerful tool ut has een restrited in higher eukaryotes to artifiial ell lines and reporter genes. We desrie an approah that enales liveell imaging of single endogenous laeled mrna moleules transried in primary mammalian ells and tissue. We generated a knok-in mouse line with an MS2 inding site (MBS) assette targeted to the 3 untranslated region of the essential -atin gene. As -atin MBS was uiquitously expressed, we ould uniquely address endogenous mrna regulation in any tissue or ell type. We simultaneously followed transription from the -atin alleles in real time and oserved transriptional ursting in response to serum stimulation with preise temporal resolution. We traked single endogenous laeled mrna partiles eing transported in primary hippoampal neurons. The MBS assette also enaled high-sensitivity fluoresene in situ hyridization (FISH), allowing detetion and loalization of single -atin mrna moleules in various mouse tissues. The mrna moleule is the first intermediate of gene expression. At every stage of its lifetime it is regulated oth in spae and time: transription at the gene lous 2, export through the nulear pore 3, diffusion and transport through the ytoplasm that in some ases result in loalization of mrna 4 and eventually deay, perhaps in speialized odies 5. These types of regulation are involved in many iologial proesses and diseases 6. To ompletely understand the regulation of gene expression in physiologial onditions as well as in the ontext of disease, ideally one would visualize single mrna moleules in real time and over their lifetime in a living organism. Suh an experiment has een out of reah eause it has not een possile to follow speifi mrnas transried from genes in their endogenous genomi ontext in primary ells or tissues. Therefore, the vast majority of our knowledge aout mrna regulation is derived from ultured ells. In ell ulture, imaging of various stages of the mrna life yle has een possile using fluoresene mirosopy tehniques suh as fluoresene reovery after photoleahing, fluoresene orrelation spetrosopy or widefield mirosopy 7. These are partiularly powerful when oupled with the in vivo mrna imaging approah using the MS2 system 8. In this tehnique, a sequene derived from the ateriophage MS2 genome is inserted into a gene of interest. When transried, the RNA immediately folds into a hairpin that forms the MS2 inding site (MBS) for the ateriophage MS2 apsid protein (MCP). When ells express oth a gene of interest arrying the MBS and a fusion of MCP with a fluoresent protein (MCP- FP), mrnas are fluoresently laeled from the moment they are transried (Fig. a). Insertion of multiple MBS opies (24 opies) inreases the signal-to-noise ratio so that single mrnas an e amplified over the akground of freely diffusing MCP-FPs 8. The MS2 system has een used in various ontexts, suh as ateria 9, yeast 8, amoea, fruit fly and mammalian ells 2 6. These studies have yielded a wealth of information aout transription kinetis (suh as on-off pulsing of gene expression or the dynamis of elongation, inluding pausing), the dynamis of mrna-protein omplexes (mrnps) and their intraellular loalization. So far the MS2 system has only een applied to higher eukaryotes in the ontext of artifiial reporter genes, usually inserted in many opies (, opies) within a random lous 7. Imaging artifiial reporters in live ultured ells onstitutes a useful experimental model ut presents some limitations. In those systems onsisting of many opies of the same gene, it is not possile to extrat events happening at the single-gene level owing to the unsynhronized interations taking plae at the other genes in the lous. A reent improvement of the tehnique makes it possile to speifially insert single gene opies into the genome of a host ell line 8. However, reporter genes might e prone to regulation artifats. Notaly, the use of immortalized ell lines introdues an unknown fator in the analysis of gene expression, in whih regulatory events suh as ell yle ontrols are overshadowed y the transformed phenotype 9. Finally, these systems do not permit the study of mrna expression in primary ells or in tissue. As improvements in mirosopy tehniques Department of Anatomy and Strutural Biology, Alert Einstein College of Mediine, Bronx, New York, USA. 2 Gruss Lipper Biophotonis Center, Alert Einstein College of Mediine, Bronx, New York, USA. 3 Institut de Biologie de l Eole Normale Supérieure, Centre National de la Reherhe Sientifique Unité Mixte de Reherhe 897, Paris, Frane. 4 The Mina and Everard Goodman Faulty of Life Sienes & Institute of Nanotehnology and Advaned Materials, Bar-Ilan University, Ramat Gan, Israel. 5 Present addresses: Department of Biohemistry and Cell Biology, Center for Nervous Systems Disorders, Stony Brook University Stony Brook, New York, USA (K.C.) and Department of Mediine, Alert Einstein College of Mediine, Bronx, New York, USA (A.L.W.). Correspondene should e addressed to R.H.S. (roert.singer@einstein.yu.edu). Reeived 23 Septemer 2; aepted Deemer 2; pulished online 6 January 2; doi:.38/nmeth.55 nature methods VOL.8 NO.2 FEBRUARY 2 65

2 Artiles Figure Shemati of the At-MS2 system for live-ell imaging. (a) As the gene is transried y the RNA polymerase (RNAP), the RNA hairpins form and get ound y the oexpressed MCP-YFP. () In the MBS assette, a unit ontaining two MBS sequenes and the intervening linkers is repeated 2 times, resulting in 24 MBSs. We designed three FISH proes (named Lk5-, Lk2 and Lk5-2) that ind eah unit at the indiated positions. The MBS array is inserted downstream of the zip ode regulatory region (green). () In the onstrut (top), the long homology arm (LA) enompasses the full At gene, inluding a region 4 kp upstream of the transription start site (TSS); the positions of the exons (lue), introns (gray), start and stop odon, and polyadenylation site (poly(a)) are indiated. The short homology arm (SA) extends.3 kp downstream of the Neo assette (yellow) flanked y the two lox sites (purple triangles). The 24 MBS assette (red) is inserted in the 3 UTR in the sixth exon. The resulting genomi lous in the At MBS mouse is shown on the ottom. a DNA mrna β-atin gene RNAP MBS 24 MCP-YFP MCP MCP YFP YFP... MCP YFP MCP YFP TSS LA Start Lk5- Stop 24 MBS Stop Poly(A) Lk2 lox 2 = 24 MBS Neo lox Lk5-2 kp SA Poly(A) 2 Nature Ameria, In. All rights reserved. lead to improvements in the aility to image in living tissue, gene reporters will e neessary to monitor expression, for instane, of disease-related defets. The next step in understanding mrna regulation in its native state is to apply the MS2 approah to a single endogenous gene in a multiellular organism. We generated a mouse that arries MBS repeats in the 3 untranslated region (UTR) of oth β-atin (At) alleles. We show that in addition to its use for live-ell imaging, the repeated MBS stem-loops provide an effiient target for Cereellum Kidney Liver Villus (intestine) p mrna ount ( 3 ) a d e f g j k l m n o At +/+ At +/+ At +/M h At M/M At +/M q mrna onentration..8.6 i At M/M.4 Liver Cereellum.2 Nuleus 5 Distane from nuleus (µm) TSS Start 24 MBS lox Neo kp high-sensitivity fluoresene in situ hyridization (FISH) in any tissue. We present a method to perform live-ell imaging in any ell type, y isolating the desired ells and y also expressing an MCP- FP either y transfeting a plasmid ontaining the MCP-FP gene or y staly integrating the MCP-FP oding sequene in the genome using lentivirus infetion. We demonstrate the utility of this approah using the examples of mouse emryo firolasts (MEFs) and primary neuronal ell lines. This illustrates how single-gene kinetis in native ells an reveal details of the moleular mehanisms harateristi of different ell types. The At-MBS mouse offers a vast potential for imaging the lifeyle of an endogenous gene in its native environment, at the single-moleule level. RESULTS Generation of a homozygous At-MBS mouse We used the At gene to test the feasiility of an MBS mouse. At mrna is an essential, uiquitous, highly expressed 2, long-lived mrna 2. At mrna is known to loalize to the leading edge of firolasts, a proess involved in maintaining ell polarity 22. The understanding of this loalization mehanism is important, as enhaned loalization is orrelated with persistent motility and dereased metastasis 6. At mrna is transried at a asal level in dividing ells, ut its transription an also e indued in response to serum addition 2. Therefore it is a good model to study oth the regulation of a onstitutively expressed gene and the transriptional response to environmental ues. Mouse At onsists of six exons spanning 3.5 kiloase pairs (kp) on hromosome 5 and odes for the 375-amino-aid β-isoform of atin protein. The MBS motif an, in priniple, either e introdued into the 5 UTR or the 3 UTR of the gene. A large numer of MBS repeats inreases the signal to improve detetion Stop Poly(A) Figure 2 RNA FISH in setions from various tissues. (a o) Merge of DAPI signal (lue) and Cy5 fluoresene from three FISH proes targeting the MBS assette (red; andpass data) in the indiated tissues from the indiated strains. Sale ars, µm (a l), 5 µm (m o; magnifiation of oxed areas in j l). (p) Quantifiation of the At-MBS allele expression (numer of spots ounted) in the ereellum after thresholding the FISH signal. (q) Average mrna onentration inside the nuleus (left) and outside the nuleus, displayed as a funtion of the distane from the nulear oundary (right). Both onentrations were normalized to their value at the nuleus oundary. AU, aritrary units. lox 66 VOL.8 NO.2 FEBRUARY 2 nature methods

3 a d Artiles Figure 3 At mrna loalizes to the leading edge of primary firolasts isolated from MBS mie. (a d) Differential interferene ontrast image (a), DAPI-stained image (), FISH with Cy3-laeled proes to the At oding region () and FISH with Cy5-laeled proes to the MBS assette. (d) Sale ar, µm. (e) Time-lapse images of a primary firolast migrating on a fironetin sustrate. Cells were infeted with lentivirus that expresses NLS-MCP-GFP, and stained with memrane-permeant red ytoplasmi dye. Color ar, NLS-MCP-GFP fluoresene normalized y the red ytoplasmi dye intensity to aount for the ell volume. AU, aritrary units. Sale ar, 2 µm. 2 Nature Ameria, In. All rights reserved. e min 3 min 6 min 9 min 2 min 5 min over a akground of free fluoresent protein. We inserted the.2-kp assette ontaining 24 repeats of the MBS motif 44 p downstream of the stop odon and after the zip ode, a isregulatory sequene important for mrna loalization 23 (Fig.,). We linearized a onstrut arrying the modified gene and a loxflanked neomyin resistane (Neo) assette and eletroporated it into emryoni stem ells (ESCs). After sreening y PCR, we transfeted the ESC lones ontaining this insert with a plasmid enoding the MCP-GFP protein to verify the orret expression of the transgene and to ensure that single-gene detetion was feasile (data not shown). We used these ESC lines to generate himeri mie, mated these himeras and sreened them for germline transmission to reate knok-in mie (Ingenious Targeting Laoratory In.). Homozygous knok-in mie were viale and fertile, indiating that the presene of the MBSs was not notaly deleterious. We first verified that the transgene expressed the expeted At- MBS mrna. On a northern lot, the At-MBS mrna was a single and with the expeted shift in migration owing to the insertion of the MBSs (Supplementary Fig. ). RNA isolated from various tissues expressed the omplete mrna ontaining MBSs in all tissues examined (Supplementary Fig. ). FISH imaging of At mrna in tissue In addition to its potential for live-ell imaging, the MBS array provides a target sequene optimized for detetion y FISH. A mixture of three different proes omplementary to the linker regions within the MBS repeats an potentially ind to 36 sites on the mrna, providing strong signal amplifiation for detetion in tissue setions (Fig. ). To test this, we setioned paraffin-emedded tissue and performed RNA FISH using the MBS proes (Fig. 2). In oth heterozygous (At +/M in whih the supersript M refers to the At-MBS allele) and homozygous (At M/M ) tissue, we 2 Fluoresene ratio oserved diffration-limited partiles, ut oserved no suh partiles in the wild-type (At +/+ ) ase (Fig. 2a o), indiating that these signals orrespond to At MBS mrna partiles. To test the potential of the tehnique to quantify expression aross tissue, we ounted single mrna partiles in the ereellum (Fig. 2p). We found as expeted that the heterozygous mie expressed aout 5% less At-MBS mrna than the homozygous mie. Although At mrna loalization to the leading edge of ultured firolasts is well doumented 22 (Fig. 3), what happens in tissue is still unlear. Using the MBS FISH proes, we quantified the spatial variation in At-MBS mrna onentration within the liver and the ereellum (Fig. 2q). The nulear At-MBS mrna onentration was on average lower than that outside of the nuleus, whih proaly reflets the differene etween the time sales of transription and export (few minutes 5 ) and the lifetime of the At mrna (few hours). We oserved that the onentration of mrna dereased with inreasing distane from the nuleus in the ereellum. This was not the ase in liver tissue (Fig. 2,i,q). This demonstrates the potential of our tehnique to quantitatively assess the spatial variations of mrna onentration, an element that is ruially needed to estalish a omplete piture of gene expression in vivo. The proes targeted at the MBS assette provided a muh higher RNA FISH signal-to-noise ratio than a set of proes omplementary to the At oding sequene. This demonstrates that in addition to its live-ell appliations, the MBS sequene onstitutes a unique FISH signal enhaning tag for deteting At transription sites 24 as well as mrnp partiles in mouse tissue, opening avenues for studying At mrna regulation at the organ level. Live-ell imaging in mouse-derived ell lines Any primary ell from the mouse is amenale to live-ell imaging, whih is a major advantage of the present tehnique over ell-line ased methods. Here we present appliations to two ell types: firolasts and primary neurons. The firolast ell line we used has een used to study the export of single mrna partiles through nulear pores with nanometer resolution 25. We prepared emryoni day 4 (E4) MEFs from heterozygous and homozygous knok-in emryos and immortalized them using SV4 T antigen. We used the immortalized MEF lines to staly express MCP-YFP fusion protein with a nulear loalization sequene (NLS) (NLS-MCP-YFP). The presene of the NLS resulted in maintenane of a high NLS-MCP-YFP onentration in the nuleus and depletion of the ytoplasmi akground of unound NLS-MCP-YFP. This ensured the mrna was ound y fluoresent NLS-MCP-YFP as soon as it was transried and that single moleules would e visile in the ytoplasm as there would e no unound NLS-MCP-YFP to derease the ontrast. We isolated several ell lines staly expressing varying amounts of NLS-MCP-YFP nature methods VOL.8 NO.2 FEBRUARY 2 67

4 Artiles 2 Nature Ameria, In. All rights reserved. Figure 4 Live-ell imaging of serum response in MBS immortalized MEFs. (a) Images of immortalized MEFs (tetraploids) during serum response taken at indiated times after serum addition (maximum intensity projetions of z-dimension staks). At min, no transriptional ativity was deteted, and at susequent time points all four transription sites appeared as right nulear spots (arrows). Sale ar, 5 µm. () Quantifiation of the fluoresene intensity at the transription sites marked in a. Blak, average response of the four alleles in a. Gray, average response over ells. ( f) Data from shown separately for eah allele. AU, aritrary units. and expressing MCP-YFP without the NLS. We karyotyped one ell line that we determined to e tetraploid, a ommon onsequene of T-antigen immortalization 26 (Supplementary Fig. 2). Homozygous ell lines expressed similar amounts of At-MBS mrna and β-atin protein regardless of whether they oexpressed the NLS-MCP-YFP fusion protein (Supplementary Fig. ). β-atin protein levels were idential in all ell lines, although the homozygous mrna levels were slightly lower than the wild-type ells (Supplementary Fig. 3). These results onfirmed that neither the MBS assette nor the NLS-MCP-YFP fusion protein prevented At expression. The γ-atin protein levels were also idential in all ell lines, indiating that there was no isoform ompensation 27 (Supplementary Fig. ). Finally, we verified that the atin ytoskeleton had normal morphology in all ell lines y immunostaining MEFs with atin isoform speifi antiodies (Supplementary Fig. d). To determine whether the MBS repeats affet transription of At, we ompared the numers of At mrna nasent hains at the gene loi of the wild-type and MBS-ontaining alleles in the heterozygous ell line. Quantitative RNA FISH showed that oth alleles were transried with similar levels (Supplementary Fig. 4). In live homozygous primary firolasts, we deteted transription sites as two right nulear spots and mrna partiles a d e Rate (µm s ) Position y (µm) f a Fluoresene Position x (µm) Frame numer min 5 min min 2 min 3 min Transription site Transription site 2 Transription site 3 Transription site 4 Cell average Population average Frame numer Frame numer as they moved in the ell (Supplementary Movie ). We onfirmed that At-MBS mrna had the expeted spatial loalization to the leading edge of primary living firolasts 28 (Fig. 3 and Supplementary Fig. 5), demonstrating that the repeats did not interfere with reognition of the zip-ode sequene and hene affet mrna loalization. Transriptional ursting in MEFs after serum stimulation We used the laeled MEFs to analyze serum-indued At mrna transription 2. We ultured homozygous MEFs overnight in low serum. After addition of serum-ontaining medium, we imaged ells over time to follow At transription. At the time of indution, we deteted only fluoresene akground in the nuleus owing to freely diffusing NLS-MCP-YFP (Fig. 4a). A few minutes after indution, four right fluoresent spots orresponding to the At loi appeared in the nulei and inreased in intensity until ~ min efore gradually fading (Fig. 4a). RNA FISH proes targeted to oth the At oding region and the MBS assette o-loalized with the right NLS-MCP-YFP spots oserved in the nuleus (Supplementary Fig. 6). Quantifiation of the intensities at eah gene lous showed that the ells responded to serum y a urst of transription that started after a few minutes and lasted for ~ h (Fig. 4). The four alleles, although sujet to the same regulatory features (idential loi and intraellular ues) had varied responses (Fig. 4 f). Although the alleles displayed a high synhrony in the initial minutes of the response, they quikly started to diverge and had largely unorrelated ehavior after 4 min. Different ells had distint response urves that produed a roader response urve when averaged (Fig. 4). The serum d e f Fluoresene Fluoresene Fluoresene Fluoresene Figure 5 Live-ell imaging of mrnp transport in primary hippoampal neurons. (a d) Images of neurons transfeted with a plasmid enoding MCP-YFP (imaged at 2 frames s ; shown images are s apart) showing an mrnp moving unidiretionally along a neuronal proess. Sale ar, µm. (e) Trajetories of two partiles (irles and squares) oserved suessively along the proess shown in a d. (f) Instantaneous rates for oth mrnps (averages ± s.e.m., 2.95 ±.4 µm s (irles) and 2.9 ±.3 µm s (squares)). 68 VOL.8 NO.2 FEBRUARY 2 nature methods

5 2 Nature Ameria, In. All rights reserved. response kinetis oserved here in the At MBS system were onsistent with a previous RNA FISH analysis 2. However, liveell imaging offers many advantages suh as finer time resolution than FISH and the possiility to follow the fate of eah allele in an individual ell over long periods of time. Expression of the endogenous alleles will allow a rigorous evaluation of the intrinsi and extrinsi fators regulating At expression, a model essential onstitutive gene, in its native state in a variety of tissues. At mrna transport in neurons Owing to their extremely polarized struture, neurons provide an intrinsi hallenge to gene expression: how, when and in what form do mrnas reah the synapses where they undergo loalized translation to strengthen speifi synapses required for the stale interations required for memory? We isolated primary neurons from MBS mouse emryos and expressed the NLS-MCP-YFP. It was then possile to follow the motion of individual partiles in neuronal proesses with high (2 frames s ) spatiotemporal resolution (Fig. 5a d and Supplementary Movies 2 and 3). We oserved several qualitatively different partile ehaviors: unidiretional motion (anterograde and retrograde sometimes on the same proess, Supplementary Movies 4 and 5), idiretional motion (one partile moving in one diretion then ak in the opposite diretion, Supplementary Movie 6), ranhing motion (one partile moving from one ranh of a proess to another; Supplementary Movie 7) or immoile partile (Supplementary Movie 8). Quantitative analysis of the traks (Fig. 5e,f) yielded instantaneous transport rates in the.5 5 µm s range, with averages around 3 µm s. These rates are similar to the ones oserved when traking zip ode inding protein ZBP granules 29, a protein that inds At mrna and is ruial for its loalization. Previous work on granules has used transfeted reporter genes to follow the movements of mrnas in neurons, a proess that inevitaly leads to overexpression artifats. This is the first detetion of an endogenously expressed mrna at its normal level and will allow for a more physiologial analysis of the omposition of the granules (are they single At mrnas or lusters?) as well as details of their movements. DISCUSSION Laeling of endogenous At mrna with the MBS assette makes it possile to investigate how different tissues maintain a homeostasis of this strutural protein. This approah is also a means to develop high-resolution, rapid imaging apailities in tissue as single mrna partiles are visile in fixed tissue. Therefore it should e possile to reord events of mrna expression suh as transport and loalization in differentiating or regenerating tissues. This approah has several advantages over existing tehniques: the gene studied is endogenous, in its native hromosome lous (inluding promoter, terminator and any other regulatory sequenes); it is present at a single opy (hene imaging the ativity at the lous truly reflets the ativity of a single gene versus the average ativity of many opies of the same gene in the ase of a gene array); oth alleles of the gene are amenale to imaging, whih onstitutes a useful system to study transriptional regulation and variaility; it is expressed in the mouse and therefore is amenale to studying gene expression in tissue or in any desired primary ell type. We illustrated the feasiility of the MBS lael on a ruial housekeeping gene, At, Artiles without disrupting the mouse physiology. We antiipate that the approah presented here is appliale to any gene of interest. In addition to the inreased sensitivity, we demonstrated in tissue FISH and live-ell experiments, the At-MBS mouse an e used for other developments. The ovious appliation is intravital mrna imaging. The mouse we desried here ontains only the protein-inding site, ut the omplete system (At-MBS oexpressed with a fusion MCP-FP) an e otained y various means. For example, one ould ross the At-MBS mouse with a mouse expressing an MCP-FP fusion or loally infet the At-MBS mouse with viruses designed to express the MCP-FP. Intravital studies of At mrna loalization ould lead to etter understanding the role of At mrna loalization in aner and metastasis 6. Also of interest is the study of the modes of transription regulation at the level of the organism, a ruial feature, for example, during development 3. Finally, the At MBS mouse also provides a powerful tool for iohemistry. Taking advantage of the 24 high-affinity inding sites, one should e ale to isolate the At mrna with a very high signal-to-noise ratio. This will make it possile to identify the inding partners of At mrna in various tissues. We antiipate that the At-MBS mouse line will e a valuale tool to study the mrna lifeyle using multiple, omplementary approahes (from fixed- and live-ell imaging to iohemistry). In addition, our method an e adapted to study the expression of any gene of interest in its natural ontext. Methods Methods and any assoiated referenes are availale in the online version of the paper at Note: Supplementary information is availale on the Nature Methods wesite. Aknowledgments We thank D. Ron (Skirall Institute of Biomoleular Mediine) for providing the SV4 large T antigen plasmid (pbssvd25) and the MEF immortalization protool, C. Chaponnier (Université de Genève) for the gift of antiodies, C. Montagna for assistane in karyotyping and R.S. Sellers for assistane in tissue examination. The phage-uc RIG vetor for lentiviral expression was a generous gift from G. Mostoslavsky and G. Vainer (Harvard University). Mirosopy equipment for the live-ell imaging experiments was provided y the Gruss Lipper Biophotonis Center. T.L. was supported y a Human Frontier Siene Program long-term fellowship. This work was supported y US National Institutes of Health (GM84364, 8627 and EB26 to R.H.S.), the Jane Stern Leell Family Fellowship of Bar-Ilan University to Y.S.-T., and US-Israel Binational Siene Foundation to Y.S.-T. and R.H.S. H.Y.P. is supported y National Researh Servie awards (F32-GM8722). A.L.W. is supported y a development grant from the Musular Dystrophy Assoiation (MDA6882). AUTHOR CONTRIBUTIONS T.L. performed the iohemistry experiments, the tissue FISH imaging, serum response live-ell imaging, and quantitative mrna FISH, analyzed the data and wrote the paper. K.C. generated ell lines and performed the neuron live-ell imaging. X.D. and Y.S.-T. generated the mouse line. A.L.W. performed FISH mrna loalization experiments. J.A.C. performed the serum response live-ell imaging. H.Y.P. performed the live-ell loalization experiments. V.d.T. generated ell lines. M.L.-J. performed the iohemistry experiments. R.H.S. onsulted on the researh and helped write the paper. COMPETING FINANCIAL INTERESTS The authors delare no ompeting finanial interests. Pulished online at Reprints and permissions information is availale online at om/reprintsandpermissions/. nature methods VOL.8 NO.2 FEBRUARY 2 69

6 Artiles 2 Nature Ameria, In. All rights reserved.. Orphanides, G. & Reinerg, D. A unified theory of gene expression. Cell 8, (22). 2. Sexton, T., Shoer, H., Fraser, P. & Gasser, S.M. Gene regulation through nulear organization. Nat. Strut. Mol. Biol. 4, (27). 3. Terry, L.J., Shows, E.B. & Wente, S.R. Crossing the nulear envelope: hierarhial regulation of nuleoytoplasmi transport. Siene 38, (27). 4. Czaplinski, K. & Singer, R.H. Pathways for mrna loalization in the ytoplasm. Trends Biohem. Si. 3, (26). 5. Garneau, N.L., Wilusz, J. & Wilusz, C.J. The highways and yways of mrna deay. Nat. Rev. Mol. Cell Biol. 8, 3 26 (27). 6. Shestakova, E.A., Wykoff, J., Jones, J., Singer, R.H. & Condeelis, J. Correlation of eta-atin messenger RNA loalization with metastati potential in rat adenoarinoma ell lines. Caner Res. 59, (999). 7. Darzaq, X. et al. Imaging transription in living ells. Annu. Rev. Biophys. 38, (29). 8. Bertrand, E. et al. Loalization of ASH mrna partiles in living yeast. Mol. Cell 2, (998). 9. Golding, I., Paulsson, J., Zawilski, S.M. & Cox, E.C. Real-time kinetis of gene ativity in individual ateria. Cell 23, (25).. Chu, J.R., Trek, T., Shenoy, S.M. & Singer, R.H. Transriptional pulsing of a developmental gene. Curr. Biol. 6, 8 25 (26).. Jaramillo, A.M., Weil, T.T., Goodhouse, J., Gavis, E.R. & Shupah, T. The dynamis of fluoresently laeled endogenous gurken mrna in Drosophila. J. Cell Si. 2, (28). 2. Shav-Tal, Y. et al. Dynamis of single mrnps in nulei of living ells. Siene 34, (24). 3. Janiki, S.M. et al. From silening to gene expression: real-time analysis in single ells. Cell 6, (24). 4. Darzaq, X. et al. In vivo dynamis of RNA polymerase II transription. Nat. Strut. Mol. Biol. 4, (27). 5. Mor, A. et al. Dynamis of single mrnp nuleoytoplasmi transport and export through the nulear pore in living ells. Nat. Cell Biol. 2, (2). 6. Ben-Ari, Y. et al. The life of an mrna in spae and time. J. Cell Si. 23, (2). 7. Darzaq, X., Singer, R.H. & Shav-Tal, Y. Dynamis of transription and mrna export. Curr. Opin. Cell Biol. 7, (25). 8. Yunger, S., Rosenfeld, L., Garini, Y. & Shav-Tal, Y. Single-allele analysis of transription kinetis in living mammalian ells. Nat. Methods 7, (2). 9. Mayr, C. & Bartel, D.P. Widespread shortening of 3 UTRs y alternative leavage and polyadenylation ativates onogenes in aner ells. Cell 38, (29). 2. Femino, A.M., Fay, F.S., Fogarty, K. & Singer, R.H. Visualization of single RNA transripts in situ. Siene 28, (998). 2. Sharova, L.V. et al. Dataase for mrna half-life of genes otained y DNA miroarray analysis of pluripotent and differentiating mouse emryoni stem ells. DNA Res. 6, (29). 22. Shestakova, E.A., Singer, R.H. & Condeelis, J. The physiologial signifiane of eta-atin mrna loalization in determining ell polarity and diretional motility. Pro. Natl. Aad. Si. USA 98, (2). 23. Kislauskis, E.H., Zhu, X. & Singer, R.H. Sequenes responsile for intraellular loalization of eta-atin messenger RNA also affet ell phenotype. J. Cell Biol. 27, (994). 24. Capodiei, P. et al. Gene expression profiling in single ells within tissue. Nat. Methods 2, (25). 25. Grunwald, D. & Singer, R.H. In vivo imaging of laelled endogenous etaatin mrna during nuleoytoplasmi transport. Nature 467, (2). 26. Ray, F.A., Peaody, D.S., Cooper, J.L., Cram, L.S. & Kraemer, P.M. SV4 T antigen alone drives karyotype instaility that preedes neoplasti transformation of human diploid firolasts. J. Cell. Biohem. 42, 3 3 (99). 27. Dugina, V., Zwaenepoel, I., Gaiani, G., Clement, S. & Chaponnier, C. β- and γ-ytoplasmi atins display distint distriution and funtional diversity. J. Cell Si. 22, (29). 28. Lawrene, J.B. & Singer, R.H. Intraellular loalization of messenger RNAs for ytoskeletal proteins. Cell 45, (986). 29. Tiruhinapalli, D.M. et al. Ativity-dependent traffiking and dynami loalization of zipode inding protein and eta-atin mrna in dendrites and spines of hippoampal neurons. J. Neurosi. 23, (23). 3. Boettiger, A.N. & Levine, M. Synhronous and stohasti patterns of gene ativation in the Drosophila emryo. Siene 325, (29). 7 VOL.8 NO.2 FEBRUARY 2 nature methods

7 2 Nature Ameria, In. All rights reserved. ONLINE METHODS Generation of the knok-in mouse. We targeted the MBS assette to the 3 UTR of the mouse At gene, downstream of the zip ode. We identified a suitale region ontaining appropriate restrition sites for integration of the 24 MBS assette. We used a ~9.6-k genomi region to onstrut the targeting vetor that was first suloned from a positively identified aterial artifiial hromosome (BAC) lone ontaining the mouse At gene. We designed the region suh that the long homology arm (LA) inludes the full At gene, extending from ~4 kp upstream of the At transription start site to ~75 p downstream of the end of the last exon. The short homology arm (SA) extends.3 k 3 downstream of the Neo assette (Fig. ). The.3-kp MBS assette is inserted 44 p downstream to the stop odon. The generation of the targeting vetor, the ESCs and the heterozygous mie was performed y Ingenious Targeting Laoratory In. We digested the MBS assette on oth ends using MluI and ligated the produt into the MluI site of a vetor ontaining the loxp-flanked Neo assette. We synthesized a PCR fragment from the genomi DNA using primers ontaining MluI and AsI sites to generate the sequene etween the site of the MBS assette insertion and the site of the Neo assette insertion, respetively. We ligated it into the vetor etween the MBS and the Neo assettes. We exised the region inluding the MBS repeats, the intervening genomi sequene and the Neo assette using BsiWI and ligated it into the targeting onstrut. The exat genomi sequene was restored exept for the insertion of the MS2 repeats and the floxed Neo assette at the loations desried aove (Fig. ). We onfirmed the targeting vetor y restrition analysis and sequening. The targeting vetor was linearized and transfeted y eletroporation into 29SVev ESCs. After seletion in G48, we expanded surviving lones for PCR analysis to identify reominant ESC lones (Supplementary Fig. 7). We otained three stale ESC lones and verified the expression of the At-MBS y RNA FISH and y o-expression of MCP-GFP in oth undifferentiated and differentiated state. We injeted the onfirmed At-MBS (positive) ESC ells into foster mothers and otained a himeri litter (ased on oat olor). Two males showing 9% himerism were mated with female mie, and 7 positive F germline mie (4 males, 3 females) were otained from lone 3C-C3. We verified F mie y genotyping and PCR of the MS2 sequenes, as well as RNA FISH in primary mie ells derived from mouse tissues. Experiments with mie were approved y the Institutional Animal Care and Use Committee of Alert Einstein College of Mediine (protool 298). Plasmids. We reated an NLS-MCP-YFP gene using PCR. The final onstrut adds an NLS and an hemagglutinin (HA) tag to the N terminus of the previously reported onstrut MCP-YFP 3. We loned this expression assette into the phage-u-rig lentiviral vetor 32 from whih the DsRed-IRES-GFP fragment had een exised using NotI and ClaI. We used this plasmid to reate reominant lentiviral partiles generating expression of NLS-MCP-YFP driven from the human uiquitin C promoter in target ells. Isolation of primary hippoampal neurons from mouse emryos. We isolated E8 mie from the pregnant female. We exised the hippoampus from the rain and plaed it into sterile old Hank s alaned salt solution (HBSS, without Mg 2+, without Ca 2+ supplemented with 5 mm HEPES). We then dissoiated tissue using a salpel, resuspended it in 5 ml ie old HBSS and entrifuged it (g for min). We resuspended the supernatant into 2 ml per rain of HBSS supplemented with : of 2.5% trypsin solution (Invitrogen) and inuated for 2 min at 3 C. We added /9 volume of Ovomuid trypsin inhiitor (OMI; mg ml in PBS) and /9 volume of DNase I ( mg; Sigma) resuspended in HBSS without Mg 2+ or Ca 2+ then sterilefiltered) and the tue was left to inuate 5 min at room temperature (22 C). We resuspended the remaining tissue in DMEM with % FBS, further dissoiated using a fire polished Pasteur pipette and allowed it to settle for 3 min (operation was repeated up to 8 times). We ounted and deposited ells on polylysineoated overslips, allowed them to attah ( h at 37 C, 5% CO 2 ), and replaed the ulture medium y fresh Neuroasal medium (Invitrogen) supplemented with B27 (Gio) 2 mm glutamax (Invitrogen), Primoin (Invivogen) and 25 µm glutamate. We then half-hanged the medium every 3 4 d (omitting glutamate), supplementing with µm ytosine arainoside. To express NLS- HA-MCP-YFP in primary neurons, we applied lentiviral partiles generated using the phage vetor to primary neurons y addition to the ulture medium d after plating. We maintained ells under standard neuron ulture onditions and ould see expression as early as 36 h after infetion. Isolation of MEF lines from mie. For the MEF lines, we isolated E4 mie from the pregnant female. We separated the head from the ody and used it to genotype eah emryo. We removed the dark ardia tissue from the ody and digested the ody with trypsin-edta for 2 min. We plated MEFs isolated from eah emryo separately into a -m dish and grew them for d in DMEM with % FBS and with antiiotis. We detahed the ells with trypsin and seeded them into a ulture dish for immortalization or froze them in % DMSO in DMEM with % FBS. To express NLS-MCP-GFP in primary MEFs, we seeded ells on the day of their isolation on a fironetin oated Latek hamer (Thermo Sientifi) and inuated them with lentiviral partiles generated using the phage vetor. To immortalize MEFs, we transfeted the ells with a plasmid expressing SV4 large T antigen (pbssvd25, gift of D. Ron) using Fugene 6 (Rohe). We followed protool: after transfetion ells were grown to onfluene and then serially passaged at high and low densities at least five times to selet transformed ells. To staly express MCP-YFP or MCP-GFP, we reated reominant lentiviral partiles using the phage UC plasmid (desried aove) and used them to infet these ells aording to existing protools. We used infeted ultures after several passages to reate a highly enrihed population of staly expressing ells y flow ytometry of MCP-YFP fluoresent ells. We later seleted individual lones from the MCP-YFP expressing ell lines. Northern lotting. We sraped MEFs grown in DMEM with % FBS and % peniillin-streptomyin (pen-strep) from their dish. For tissue, we snap-froze tissue in liquid nitrogen and grinded it using a pestle and mortar. We then extrated total RNA using the RNeasy mini kit (Qiagen). We diluted 2 µg RNA in 5% formamide, denatured it 5 min at 65 C, hilled it on ie and doi:.38/nmeth.55 nature methods

8 2 Nature Ameria, In. All rights reserved. then loaded it on a nondenaturing % agarose gel in.5 TBE. The RNA was transferred overnight onto an immoilon N+ memrane (Millipore). After UV-light ross-linking, we inuated the memrane h at 37 C in prehyridization solution (6 SSC, 5 mm NaPO 4 (ph 7.), 5 Denhardt solution and 4% SDS). We generated random-primed DNA proes laeled with [γ- 32 P]ATP (Perkin Elmer) using Klenow enzyme (Rohe). We prepared the DNA templates y PCR of MEF DNA for the wild-type At and GAPDH proes, and used a leaved-out MBS insert for the MBS proe. We diluted the DNA proe in ml pre-hyridization solution and inuated it with the memrane for 3 h at 37 C. We washed the memrane twie 2 min at 37 C in 7 SSC, 5 mm NaPO 4 (ph 7.) and % SDS, and exposed it overnight to a storage phosphor sreen efore imaging on a Storm 86 phosphorimager (Moleular Dynamis). RNA FISH. We performed RNA FISH on ultured ells to a protool modified from previously pulished protools 2,33. The proes used were 5-mers of single-stranded DNA earing eah 4 5 fluorophores (proes are listed in Supplementary Note ). We grew MEFs on overslips in DMEM % FBS % pen-strep, then fixed them in 4% paraformaldehyde for 5 min at room temperature efore washing and storing in PBSM (PBS supplemented with 5 mm MgCl 2 ) at 4 C. Before hyridization, we permeailized the ells min in.5% triton X in PBS, then washed them in PBS min, and inuated min in prehyridization solution (5% formamide, 2 SSC, 2 mg ml BSA,.2 mg ml Esherihia oli trna and.2 mg ml sheared salmon sperm DNA). We then hyridized the proes to the ells for 3 h in prehyridization solution supplemented with ng DNA proe per lous per overslip. We washed overslips twie 2 min at 37 C with prehyridization solution, then min at room temperature in 2 SSC, and min at room temperature in PBSM. We ounterstained DNA with DAPI (.5 mg l in PBS). After a final wash in PBS, we mounted overslips mounted on slides using ProLong gold reagent (Invitrogen). When 2-mer proes were used, we replaed the prehyridization solution y % formamide with 2 SSC, 2 mg ml BSA,.2 mg ml E. oli trna,.2 mg ml sheared salmon sperm DNA and % dextran sulfate. We performed RNA FISH in tissue setions following a pulished method 24. Immediately after extration from killed mie, we fixed the tissues in formalin overnight and paraffin-emedded them. We used 5-µm-thik setions for FISH. We inuated the setions at 55 C for 3 min, then sumitted them to a high pressure treatment (3 s at 25 C, then s at 9 C under ~8 pounds per square inh) in deloaker reveal reagent (Bioare medial). After 5 min inuation in H 2 O, we riefly rinsed the slides in H 2 O and PBS. We inuated the setions 2 min at room temperature in.25% NH 4 OH with 7% EtOH, 5 min at 4 C in freshly prepared.5% NaBH 4 in PBS, then rinsed them in water and then PBS. We inuated the slides min at room temperature in PBSM, then 3 times for 5 min in PBS and finally for 3 min in prehyridization solution. After a 2-h hyridization at 37 C in a losed hamer, we washed the slides for 2 min at room temperature in prewarmed (37 C) prehyridization solution, 2 min at room temperature in prewarmed (37 C) 2 SSC, 2 min at room temperature in prewarmed (37 C) SSC, 5 min at room temperature in prewarmed (37 C).5 SSC and 5 min at room temperature in PBSM (all washes were performed on a slow rotary shaker). We ounterstained the slides with.5 mg l DAPI, washed them one in PBSM efore mounting on overslips using Prolong gold reagent (Invitrogen). Immunofluoresene. As primary antiodies we used antiodies to β- and γ-atin isoforms (4C2F9H2/IgG and 2A3G8E2/IgG2, respetively), a gift from C. Chaponnier 27. We used as seondary antiodies, goat anti-mouse IgG-FITC (Southern Bioteh 7-2) and anti-mouse IgG2-TRITC (Southern Bioteh 9-3). We used a ustom protool 27 : we inuated ells in prewarmed L-5 supplemented with % FBS, then fixed them for 2 min at room temperature in % paraformaldehyde in L-5, % FBS. We washed ells twie in PBS, permeailized the ells with methanol ( 2 C, 5 min) and rinsed in PBS. We then inuated the ells h in the primary antiody mix (PBS supplemented with 3%.2-µm-filter-filtered BSA fration V, antiodies diluted : β-atin; :2 γ-atin) at 37 C in a losed hamer. We performed five rinses in PBS and inuated h in the seondary antiody mix (PBS supplemented with 3%.2-µm-filter filtered BSA fration V, :5 Southern Bioteh 7-2 and :5 Southern Bioteh 9-3). After five rinses in PBS, we ounterstained the DNA with.5 mg l DAPI and mounted on slides using Prolong gold reagent (Invitrogen). Western lotting. We used the following primary antiodies: β-atin (Sigma A978), γ-atin (AB3265, Chemion) and β-tuulin (Amersham N357), and seondary antiodies: donkey anti-mouse onjugated to IRDye 8 (Rokland ) and donkey anti-sheep onjugated to Alexa Fluor 68 (Invitrogen A22). We washed ells in ie-old PBS and lysed them at room temperature for 2 min in ml lysis uffer per -m dish (5 mm Tris- HCl (ph 8.), 5 mm NaCl, % NP4, 5 mm DTT, mm PMSF and half a mini talet protease inhiitor). We spun the lysate 5 min at 4,g at 4 C and loaded the supernatant on a Nupage 4 2% is-tris gel using MOPS running uffer (Invitrogen). After transfer on a nitroellulose memrane in Nupage transfer uffer (25 V for.5 h), we loked nonspeifi interations y inuating the lot overnight at 4 C in PBS supplemented with 5% nonfat dry milk. After that, we rinsed the memrane and inuated it for h with the primary antiodies in PBS supplemented with % BSA (dilutions: :2,5 mouse anti At; :5, mouse anti βtuulin). We then washed the lot 5 times min in PBS with.3% Tween-2 efore inuation for 3 min with the seondary antiody (:, in PBS with % BSA). We then washed the memrane 5 times in PBS with.3% Tween-2, efore exposure on an Odyssey infrared imaging system (two-olor detetion). We quantified the ands intensities using ImageJ software (US National Institutes of Health). Imaging. For immortalized ells, we plated homozygous MEFs expressing MCP-YFP on a.7 mm delta T dish (Bioptehs) and inuated 24 h in DMEM % FBS % pen-strep. We left ells to reover for 24 h and then starved them overnight. We replaed the medium y L-5 supplemented with the Oxyfluor oxygen savenging system (Oxyrase) efore the experiment. We plaed the ells on an Olympus IX-7 mirosope equipped with a 5,.45 numerial aperture (NA) ojetive (Olympus) and a Casade II amera (Photometris). We maintained a onstant temperature of 37 C through the experiment using the Delta T hamers, a nature methods doi:.38/nmeth.55

9 2 Nature Ameria, In. All rights reserved. heated lid and ojetive heater (Bioptehs). We imaged ells in three dimensions over time using a 2 nm z-dimension axis step size over a range of 4 µm every 4 min using a 488-nm argon laser for exitation of YFP fluoresene. We onverted the three-dimensional z-dimension staks into two-dimensional movies using a maximum intensity projetion. For primary firolasts, we plated the ells on fironetin-oated MatTek dishes (MatTek), infeted with lentivirus to express NLS-MCP-GFP, and inuated them for 48 h in DMEM % FBS, % pen-strep. We stained the ells with 5 µm CellTraker Orange CMRA (Invitrogen) and replaed the medium with L-5 ontaining % FBS, % pen-strep and % oxyrase efore the experiment. We used an Olympus IX-7 inverted mirosope equipped with a 4,.35 NA oil-immersion ojetive (Olympus) and eletron-multiplying harge-oupled devie (EMCCD) amera (Andor). We maintained the temperature at 37 C using an environmental hamer (Preision Plastis). We exited GFP using a 488 nm line from an argon ion laser (Melles Griot) and CellTraker Orange CMRA using a 56 nm diode laser (Coolt). For RNA FISH, we imaged the slides on an Olympus BX-6 mirosope equipped with an X-ite 2 PC Merury lamp (EXFO), a,.4 NA ojetive (Olympus) and a Coolsnap HQ amera (Photometris). For primary neurons, we hanged neuron medium into Hiernate Low Fluoresene medium (BrainBits LLC) with B27 supplement and 2 mm glutamax. After imaging, we restored ells to neuroasal medium with B27, 2 mm glutamax with primoin. We used the same imaging setup as that used for immortalized ells. Image analysis. We performed spot detetion and quantifiation from FISH and live-ell imaging using ustom-designed interfae desription language (IDL) (ITT Visual Information Solutions) and Matla (Mathworks) programs. We first deteted high intensity pixels y two- or three-dimensional (when using three-dimensional image staks) andpass filtering the image (Supplementary Fig. 8) and then applied a threshold to the andpassed image (we adjusted the threshold value depending on the quality of eah individual image). We defined as spots the loal maxima within a two-pixel radius of the pixels aove threshold. We then automatially quantified the individual spots intensities the original image. To do so, we first orreted the intensity profile in a square region of interest (ROI) surrounding eah spot for the loal akground, alulated as a the linear fit of the intensity versus position in the pixels adjaent to the ROI (we set the ROI size as three times the width of the point spread funtion (PSF)). Then we alulated the position and intensity of eah spot using a two- or three-dimensional Gaussian mask fit of the PSF 34. In the two-dimensional projetions of the tissue FISH image staks, we identified nulei y either automatially thresholding or manually irling the DAPI signal. We then oarse-grained the image using pixels (~2 2 µm) square ins. We ounted the numer of mrna partiles within eah in and omputed the distane from that in to the losest nuleus. We olleted quantitative data over typially 5 ells. 3. Fuso, D. et al. Single mrna moleules demonstrate proailisti movement in living mammalian ells. Curr. Biol. 3, 6 67 (23). 32. Mostoslavsky, G., Faian, A.J., Rooney, S., Alt, F.W. & Mulligan, R.C. Complete orretion of murine Artemis immunodefiieny y lentiviral vetor-mediated gene transfer. Pro. Natl. Aad. Si. USA 3, (26). 33. Raj, A., van den Bogaard, P., Rifkin, S.A., van Oudenaarden, A. & Tyagi, S. Imaging individual mrna moleules using multiple singly laeled proes. Nat. Methods 5, (28). 34. Thompson, R.E., Larson, D.R. & We, W.W. Preise nanometer loalization analysis for individual fluoresent proes. Biophys. J. 82, (22). doi:.38/nmeth.55 nature methods

AT2G02060 AT2G40260 AT2G AT4G04580 AT2G06020 AT2G AT5G06800 AT3G13040 AT2G AT5G AT3G04030

AT2G02060 AT2G40260 AT2G AT4G04580 AT2G06020 AT2G AT5G06800 AT3G13040 AT2G AT5G AT3G04030 AT5G45580 75 AT3G10760 63 AT5G05090 92 AT2G40970 AT3G46640 LUX/PCL1 66 82 AT5G59570 BOA AT4G18020 PRR2 97 AT2G20570 GLK1 55 47 AT5G44190 GLK2 58 AT1G49560 HHO6 AT4G37180 HHO5 AT2G03500 HHO4 98 45 AT1G13300

More information

FL3-H::PI H2O2: %G1=66.3, %S=15.7, %G2=19.6. Cisplatin: %G1=66.9, %S=16.3, %G2=16.8 FL3-H::PI

FL3-H::PI H2O2: %G1=66.3, %S=15.7, %G2=19.6. Cisplatin: %G1=66.9, %S=16.3, %G2=16.8 FL3-H::PI .8 mm HO, 8 h 66C14 4T1 MB468 MB31 ontrol FL4-H::ap annexin V HO ount ount ontrol: %G1=48., %S=3.7, %G=9.5 Dox: %G1=67.9, %S=15.3, %G=19.1 HO: %G1=66.3, %S=15.7, %G=19.6 Cisplatin: %G1=66.9, %S=16.3, %G=16.8

More information

RESEARCH ARTICLE n.s.

RESEARCH ARTICLE n.s. Cellular & Moleular Immunology (214), 12 ß 214 CSI and USTC. All rights reserved 1672-7681/14 $32. www.nature.om/mi a 5 RESEARCH ARTICLE TNF-a (pg/ml) 4 3 2 1 IL-6 (pg/ml) 15 1 5 IL-12p4 (pg/ml) 3 2 1

More information

Supplementary Fig. 1 Lima-Fernandes et al.

Supplementary Fig. 1 Lima-Fernandes et al. 5 emission 4 2 4 3 2 + + emission 6 a lu-- DAI 34 +/- 3.1 % ells transfeted (n=4, 97 ells total) Supplementary Figure 1. Fusion ontext of does not alter raw lu or emissions aw lu (a) and laser exited ()

More information

Supplementary Materials for

Supplementary Materials for advanes.sienemag.org/gi/ontent/full/3/4/e1602629/dc1 Supplementary Materials for Single-layer nanosheets with exeptionally high and anisotropi hydroxyl ion ondutivity Pengzhan Sun, Renzhi Ma, Xueyin Bai,

More information

Supporting Information

Supporting Information Supporting Information Kontos et al. 1.173/pnas.121635311 SI Materials and Methods Peptide Synthesis. The ERY1 (H 2 N-WMVLPWLPGTLDGGSG- CRG-CONH 2 ) and mismath (MIS; H 2 N-PLLTVGMDLWPW- GGSGCRG-CONH 2

More information

Supplemental Figure 1. Damage to worms through multiple exposures to high peak negative pressure ultrasound in the presence of microbubbles.

Supplemental Figure 1. Damage to worms through multiple exposures to high peak negative pressure ultrasound in the presence of microbubbles. Before US After very high US Supplemental Figure. Damage to worms through multiple exposures to high peak negative pressure ultrasound in the presene of miroules. (a) The worm displays a normal urved sinusoidal

More information

Cpf1 proteins excise CRISPR RNAs from mrna transcripts in mammalian cells

Cpf1 proteins excise CRISPR RNAs from mrna transcripts in mammalian cells SUPPLEMENTARY INFORMATION Cpf1 proteins exise CRISPR RNAs from mrna transripts in mammalian ells Guoai Zhong 1, Haimin Wang 1, Yujun Li 1, 2, Mai H. Tran 1, Mihael Farzan 1 1 Department of Immunology and

More information

Supplementary Table 1. Chicken TRPV4-ARD Data Collection and Refinement Statistics a , 48.12, , , 90

Supplementary Table 1. Chicken TRPV4-ARD Data Collection and Refinement Statistics a , 48.12, , , 90 Mutations in TRPV4 ause Charot-Marie-Tooth disease type C Guida Landouré, Anselm A. Zdeik, Tara L. Martinez, Barrington G. Burnett, Horia C. Stanesu, Hitoshi Inada, Yijun Shi, Addis A. Taye, Lingling Kong,

More information

Real-time PCR solutions from sample preparation to data analysis

Real-time PCR solutions from sample preparation to data analysis PRODUCT OVERVIEW Real-time PCR Real-time PCR solutions from sample preparation to data analysis For over a quarter entury, we ve provided you with reliable reagents, instruments and software for all your

More information

UNDERSTANDING WHISKER PHENOMENON - PART II Competitive Mechanisms

UNDERSTANDING WHISKER PHENOMENON - PART II Competitive Mechanisms UNDERSTANDING WHISKER PHENOMENON - PART II Competitive Mehanisms Chen Xu, Chonglun Fan, Anna Vysotskaya, Joseph A. Ays and Yun Zhang Luent Tehnologies, Eletroplating Chemials and Servies 236 Rihmond Valley

More information

Buildup Factors Calculation for a 1-MeV Point Isotropic Source in Iron, Concrete, and. Water. Skyler Butler, Maria Pinilla

Buildup Factors Calculation for a 1-MeV Point Isotropic Source in Iron, Concrete, and. Water. Skyler Butler, Maria Pinilla Buildup Fators Calulation for a 1-MeV Point Isotropi Soure in Iron, Conrete, and Water Skyler Butler, Maria Pinilla Abstrat This experiment alulates the buildup fators for 1-MeV point isotropi soure of

More information

HIF activation by ph-dependent nucleolar sequestration of VHL

HIF activation by ph-dependent nucleolar sequestration of VHL HIF ativation y -dependent nuleolar sequestration of Karim Mekhail 1,Lakshman Gunaratnam 1,Marie-Eve Bonialzi 1 and Stephen Lee 1,2 Hypoxia and aidosis our in a wide variety of physiologial and pathologial

More information

Continuous temperature measurements on the pouring stand for casting moulds

Continuous temperature measurements on the pouring stand for casting moulds ARCHIVES of FOUNDRY ENGINEERING Published quarterly as the organ of the Foundry Commission of the Polish Aademy of Sienes ISSN (897-330) Volume 8 Issue /008 75 80 5/ Continuous temperature measurements

More information

TS110 Visible (exposed) fixing with screws on an aluminum sub-frame

TS110 Visible (exposed) fixing with screws on an aluminum sub-frame TS110 Visile (exposed) fixing with srews on an aluminum su-frame This system offers a ost effetive solution for installing Trespa panels in a large variety of panel dimensions. Trespa Meteon panels with

More information

Single-particle Tracking as a Quantitative Microscopy-based Approach to Unravel Cell Entry Mechanisms of Viruses and Pharmaceutical Nanoparticles

Single-particle Tracking as a Quantitative Microscopy-based Approach to Unravel Cell Entry Mechanisms of Viruses and Pharmaceutical Nanoparticles review Single-partile Traking as a Quantitative Mirosopy-based Approah to Unravel Cell Entry Mehanisms of Viruses and Pharmaeutial Nanopartiles Nadia Ruthardt 1 3, Don C Lamb 1 4 and Christoph Bräuhle

More information

MODELING FLEXIBLE PACKAGE/GRANULAR MATERIAL INTERATION THROUGH COMBINATION OF DISCRETE ELEMENT METHOD (DEM) AND FINITE ELEMENT METHOD (FEM)

MODELING FLEXIBLE PACKAGE/GRANULAR MATERIAL INTERATION THROUGH COMBINATION OF DISCRETE ELEMENT METHOD (DEM) AND FINITE ELEMENT METHOD (FEM) MODELING FLEXIBLE PACKAGE/GRANULAR MATERIAL INTERATION THROUGH COMBINATION OF DISCRETE ELEMENT METHOD (DEM) AND FINITE ELEMENT METHOD (FEM) Wenbo Xu, Pavan Valavala, Mark Mirgon, Sam Crabtree, Lori Kardos,

More information

NOZZLE CONSTRUCTION FOR PARTICLE FORMATION USING SUPER CRITICAL ANTI SOLVENT PRECIPITATION

NOZZLE CONSTRUCTION FOR PARTICLE FORMATION USING SUPER CRITICAL ANTI SOLVENT PRECIPITATION NOZZLE CONSTRUCTION FOR PARTICLE FORMATION USING SUPER CRITICAL ANTI SOLVENT PRECIPITATION Hubert C. Pellikaan 1*, Frank E. Wubbolts 1,2 1 Feyeon Development & Implementation B.V., Rijnkade 17 A, 1382

More information

Microglia remodel synapses by presynaptic trogocytosis and spine head filopodia induction. Weinhard et al.

Microglia remodel synapses by presynaptic trogocytosis and spine head filopodia induction. Weinhard et al. Miroglia remoel synapses y presynapti trogoytosis an spine hea filopoia inution. Weinhar et al. a P8 P15 P28 P4 CD68 Ia1 CD68 intensity in miroglia (a.u) 15 *** *** *** 12 9 6 3 P8 P15 P28 P4 CD68 Cx3r1::tTomato

More information

Nature Medicine doi: /nm.2548

Nature Medicine doi: /nm.2548 Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)

More information

Supplementary Information

Supplementary Information Supplementary Information Super-resolution imaging of fluorescently labeled, endogenous RNA Polymerase II in living cells with CRISPR/Cas9-mediated gene editing Won-Ki Cho 1, Namrata Jayanth 1, Susan Mullen

More information

sh; and c lie in the region between the interchange point and the knob, wx THE ORDER OF THE GENES C, Sh AND Wx IN ZEA MA YS WITH CHROMOSOME

sh; and c lie in the region between the interchange point and the knob, wx THE ORDER OF THE GENES C, Sh AND Wx IN ZEA MA YS WITH CHROMOSOME VOL. 17, 1931 BOTANY: B. MLINTOK 485 THE ORDER OF THE GENES, Sh AND Wx IN ZEA MA YS WITH REFERENE TO A YTOLOGIALLY KNOWN POINT IN THE HROMOSOME By BARBARA MLINTOK BOTANY DEPARTMENT, ORNELL UNIVERSITY ommuniated

More information

GROUND WATER/SURFACE WATER INTERACTIONS AWRA SUMMER SPECULLTP CONF~NCR CZ-I PDG- ANALYSIS OF INFILTRATED STREAM WATER TO A PUMPING WELL

GROUND WATER/SURFACE WATER INTERACTIONS AWRA SUMMER SPECULLTP CONF~NCR CZ-I PDG- ANALYSIS OF INFILTRATED STREAM WATER TO A PUMPING WELL JULY 1-3 GROUND WATER/SURFACE WATER NTERACTONS AWRA SUMMER SPECULLTP CONF~NCR 22 32 CZ- PDG- ANALYSS OF NFLTRATED STREAM WATER TO A PUMPNG WELL Xunhong Chen' and Xi Chen' ABSTRACT: Pumping of groundwater

More information

Y-Screening and Direct Amplification of Sexual Assault Evidence Kit Samples. October 31, 2016 Presented by:

Y-Screening and Direct Amplification of Sexual Assault Evidence Kit Samples. October 31, 2016 Presented by: Y-Sreening and Diret Amplifiation of Sexual Assault Evidene Kit Samples Otober 31, 2016 Presented by: Anupama Gopalakrishnan, PhD Promega Corporation Amy MGukian, MSFS, F-ABC Palm Beah County Sheriff s

More information

ESTIMATION OF FRACTURE TOUGHNESS OF THE OXIDE SCALES. Jozef HRABOVSKÝ, Petr LOŠÁK, Jaroslav HORSKÝ

ESTIMATION OF FRACTURE TOUGHNESS OF THE OXIDE SCALES. Jozef HRABOVSKÝ, Petr LOŠÁK, Jaroslav HORSKÝ ESTIMATION OF FRACTURE TOUGHNESS OF THE OXIDE SCALES Jozef HRABOVSKÝ, Petr LOŠÁK, Jaroslav HORSKÝ Heat Transfer and Fluid Flow Laboratory, Faulty of Mehanial Engineering, VUT Brno, Tehniká 2, 616 69 Brno,

More information

1. Cross-linking and cell harvesting

1. Cross-linking and cell harvesting ChIP is a powerful tool that allows the specific matching of proteins or histone modifications to regions of the genome. Chromatin is isolated and antibodies to the antigen of interest are used to determine

More information

TS Invisible (concealed) sub-frame

TS Invisible (concealed) sub-frame TS210-285 Invisile (onealed) raket-railfix on an aluminum su-frame This system offers large flexiility for installing Trespa Meteon panels, the use of adjustale rakets allow for preise joints and an optimal

More information

PCR Optimization. Table of Contents

PCR Optimization. Table of Contents PCR Optimization Table of Contents Optimizing the Polymerase Chain Reation Introdution.....1 Review of Mathematis........ 3 Solving Problems of Dilution and Conentration: Two Approahes.. 4 Experiment Overview

More information

Integrated optimization and multi-agent technology for combined production and transportation planning

Integrated optimization and multi-agent technology for combined production and transportation planning Integrated optimization and multi-agent tehnology for ombined prodution and transportation planning Jan A. Persson 1 and Paul Davidsson 2 1 Blekinge Institute of Tehnology, Department Systems and Software

More information

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the

RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the Supplementary Methods RT-PCR and real-time PCR analysis RNA was isolated using NucleoSpin RNA II (Macherey-Nagel, Bethlehem, PA) according to the manufacturer s protocol and quantified by measuring the

More information

RNA editing sites in plant mitochondria can share cis-elements

RNA editing sites in plant mitochondria can share cis-elements FEBS Letters 58 (26) 268 272 RNA editing sites in plant mitohondria an share is-elements Johannes A. van der Merwe, Mizuki Takenaka *, Julia Neuwirt, Daniil Verbitskiy, Axel Brennike Molekulare Botanik,

More information

Shear Transfer Strength Evaluation for Ultra-High Performance Fiber Reinforced Concrete

Shear Transfer Strength Evaluation for Ultra-High Performance Fiber Reinforced Concrete Shear Transfer Strength Evaluation for Ultra-High Performane Fiber Reinfored Conrete Ji-hyung Lee, and Sung-gul Hong Abstrat Ultra High Performane Fiber Reinfored Conrete (UHPFRC) is distinguished from

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

Supporting Information

Supporting Information Supporting Information Deng et al. 10.1073/pnas.1515692112 SI Materials and Methods FPLC. All fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20),

More information

Lineage-specific laminar organization of cortical GABAergic interneurons

Lineage-specific laminar organization of cortical GABAergic interneurons Lineage-speifi laminar organization of ortial GABAergi interneurons Gariele Cieri, Nathalie Dehorter, gnasi Sols, Z Josh Huang, Miguel Maravall & Osar Marín npg Nature Ameria, n. All rights reserved. n

More information

Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells

Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells Stellaris RNA FISH Protocol for Simultaneous IF + FISH in Adherent Cells General Protocol & Storage Product Description A set of Stellaris RNA FISH Probes is comprised of up to 48 singly labeled oligonucleotides

More information

Cdc42 Activation Assay Kit

Cdc42 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Cdc42 Activation Assay Kit Catalog Number: 80701 20 assays 1 Table of Content Product Description 3 Assay

More information

Post-Tensioned Two-Way Slab

Post-Tensioned Two-Way Slab The Medial Oie Building Malvern, PA 13 Post-Tensioned Two-Way Slab Introdution The Filigree beam system reates a thin lightweight loor system that leaves plenty o open plenum spae or mehanial and eletrial

More information

TRANSLATION OF MEASURED VEHICULAR WEIGHTS INTO DESIGN LOADS TO BE USED FOR BRIDGE ENGINEERING

TRANSLATION OF MEASURED VEHICULAR WEIGHTS INTO DESIGN LOADS TO BE USED FOR BRIDGE ENGINEERING 7th International Symposium on Heavy Vehile Weights & Dimensions Delft. The Netherlands. June 16-2.22 TRANSLATION OF MEASURED VEHICULAR WEIGHTS INTO DESIGN LOADS TO BE USED FOR BRIDGE ENGINEERING ABSTRACT

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX.

Nature Methods: doi: /nmeth Supplementary Figure 1. Retention of RNA with LabelX. Supplementary Figure 1 Retention of RNA with LabelX. (a) Epi-fluorescence image of single molecule FISH (smfish) against GAPDH on HeLa cells expanded without LabelX treatment. (b) Epi-fluorescence image

More information

Pore-level Influence of Contact Angle on Fluid Displacements In Porous Media

Pore-level Influence of Contact Angle on Fluid Displacements In Porous Media Pore-level Influene of Contat Angle on Fluid Displaements In Porous Media H.A. Akhlaghi Amiri * University of Stavanger (UiS), Department of Petroleum Engineering, 4036 Stavanger, Norway *Corresponding

More information

Supplementary methods

Supplementary methods Supplementary methods Cell culture, infection, transfection, and RNA interference HEK293 cells and its derivatives were grown in DMEM supplemented with 10% FBS. Various constructs were introduced into

More information

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

More information

~ Early Life

~ Early Life Measurements and reporting systems are established Suessful validation of the deployment triggers the launh of Early Life Support (ELS). 6.0 Deploy & Verify - Q)... E Q) t1 Ol Change.r::: t1 0 t1 (jj Ol

More information

Improved tools for the Brainbow toolbox

Improved tools for the Brainbow toolbox Improved tools for the Brainow toolox Dawen Cai 1,, Kimerly B Cohen 1,, Tuanlian Luo 1,, Jeff W Lihtman 1, & Joshua R Sanes 1, In the transgeni multiolor laeling strategy alled Brainow, Cre-loxP reomination

More information

GESTRA Steam Systems. Product Range A1 UNA 23h/v UNA 25h/v UNA 26h/v UNA 26h Stainless Steel

GESTRA Steam Systems. Product Range A1 UNA 23h/v UNA 25h/v UNA 26h/v UNA 26h Stainless Steel Issue Date: 4/09 GETRA team ystems team Traps UNA 23h/v, PN 1, DN 15, 20, 25, 40, 50 UNA 25h/v, PN 40, DN 15, 20, 25, 40, 50 UNA 2h/v, PN 40, DN 15, 20, 25, 40, 50 UNA 2h tainless teel, PN 40, DN 15, 20,

More information

Finite Element Modeling of Pre-Stressed Hollow Core Slabs

Finite Element Modeling of Pre-Stressed Hollow Core Slabs Current Siene International Volume : 04 Issue : 04 Ot.-De. 2015 Pages :596-603 Finite Element Modeling of Pre-Stressed Hollow Core Slabs 1 Ali N. Deeb, 2 M. Abou Zeid Tarkhan and 3 E. M. El-Tehewy 1 Syrian

More information

Nano and microhardness testing of heterogeneous structures

Nano and microhardness testing of heterogeneous structures 85 ISSN 1392 1207. MECANIKA. 2016 Volume 22(2): 85 89 Nano and mirohardness testing of heterogeneous strutures S. Baskutis*, V. Vasauskas**, A. Žunda*** *Kaunas University of Tehnology, Studentų str. 56,

More information

Camber Variability in Prestressed Concrete Bridge Beams

Camber Variability in Prestressed Concrete Bridge Beams CONCRETE BRIDGE TECHNOLOGY Camber Variability in Prestressed Conrete Bridge Beams by Dr. Maher Tadros, econstrut Beams ast with extra amber in storage yard at Conrete Tehnology Corporation; amber shown

More information

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals:

TRANSGENIC ANIMALS. -transient transfection of cells -stable transfection of cells. - Two methods to produce transgenic animals: TRANSGENIC ANIMALS -transient transfection of cells -stable transfection of cells - Two methods to produce transgenic animals: 1- DNA microinjection - random insertion 2- embryonic stem cell-mediated gene

More information

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only

IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only IgG TrueBlot Protocol for Mouse, Rabbit or Goatderived Antibodies - For Research Use Only Introduction The IgG TrueBlot for mouse, rabbit, or goat-derived antibodies represents unique series of respective

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

BIOLOGY. BrightRED Study Guide BIOLOGY. Margaret Cook and Fred Thornhill. BrightRED Study Guides. Curriculum for Excellence. Curriculum for Excellence

BIOLOGY. BrightRED Study Guide BIOLOGY. Margaret Cook and Fred Thornhill. BrightRED Study Guides. Curriculum for Excellence. Curriculum for Excellence Curriulum for Exellene Margaret Cook and Fred Thornhill Contains all of the essential ourse information, arranged in easily digestible topis. Don t forget! pointers offer advie on key fats and on how to

More information

Systems & Services Certification SGS 53,000, 1000

Systems & Services Certification SGS 53,000, 1000 CSR July 28, 2009 SGS Systems & Servies Certifiation SGS SGS SGS 1878 SGS 140 53,000, 1000 - Europe, Middle East & Afria: 24 400 employees - Amerias: 12 100 employees - Asia/Paifi: 16 500 employees SGS,

More information

DENSIFICATION OF SELECTIVE LASER SINTERED METAL PARTS BY HOT ISOSTATIC PRESSING ABSTRACT INTRODUCTION

DENSIFICATION OF SELECTIVE LASER SINTERED METAL PARTS BY HOT ISOSTATIC PRESSING ABSTRACT INTRODUCTION DENSIFICATION OF SELECTIVE LASER SINTERED METAL PARTS BY HOT ISOSTATIC PRESSING Mukesh K. Agarwala, and David L. Bourell, Center for Materials Siene and Engineering, Joseph J. Beaman, Department ofmehanial

More information

WATER WITHIN LIGHTWEIGHT AGGREGATE CONCRETE AND ITS RELATION TO AUTOGENOUS SHRINKAGE

WATER WITHIN LIGHTWEIGHT AGGREGATE CONCRETE AND ITS RELATION TO AUTOGENOUS SHRINKAGE WATER WITHIN LIGHTWEIGHT AGGREGATE CONCRETE AND ITS RELATION TO AUTOGENOUS SHRINKAGE S.A. Kristiawan Department of Civil Eng.Sebelas Maret University, e-mail: sa_kristiawan@uns.a.id Senot Sangadji Department

More information

ProductInformation TECHNICAL BULLETIN MULTIPLE TISSUE NORTHERN BLOT, MOUSE. Product No. BLOT-2 Technical Bulletin No. MB-865 February 2000

ProductInformation TECHNICAL BULLETIN MULTIPLE TISSUE NORTHERN BLOT, MOUSE. Product No. BLOT-2 Technical Bulletin No. MB-865 February 2000 MULTIPLE TISSUE NORTHERN BLOT, MOUSE Product No. BLOT-2 Technical Bulletin No. MB-865 February 2000 ProductInformation TECHNICAL BULLETIN Product Description Sigma s Mouse Multiple Tissue Northern Blot

More information

Yield of spring barley mixtures as a function of varietal and environmental characteristics

Yield of spring barley mixtures as a function of varietal and environmental characteristics Yield of spring barley mitures as a funtion of varietal and environmental harateristis Lars Kiær 1, Ib Skovgaard 2 and Hanne Østergård 1 1 Biosystems Department, Risø National Laboratory DTU, 4000 Roskilde,

More information

In Situ Hybridization

In Situ Hybridization In Situ Hybridization Modified from C. Henry, M. Halpern and Thisse labs April 17, 2013 Table of Contents Reagents... 2 AP Buffer... 2 Developing Solution... 2 Hybridization buffer... 2 PBT... 2 PI Buffer

More information

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells

Supplementary Data. Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Supplementary Data Supplementary Methods Three-step protocol for spontaneous differentiation of mouse induced pluripotent stem (embryonic stem) cells Mouse induced pluripotent stem cells (ipscs) were cultured

More information

Suggested Changes to NZS3101:2006 with Amendments 1 and 2

Suggested Changes to NZS3101:2006 with Amendments 1 and 2 1 Suggested Changes to NZS3101:2006 with Amendments 1 and 2 Rihard Fenwik and Dene Cook Introdution NZS 3101: 2006 Conrete Strutures Standard is a design ode published by Standards New Zealand. Sine the

More information

Fatigue and Creep-Fatigue Testing of Bellows at Elevated Temperature

Fatigue and Creep-Fatigue Testing of Bellows at Elevated Temperature S. Yamamoto K. Isobe S. Ohte Mehanial Engineering Laboratory, Researh and Development Center. N. Tanaka S. Ozaki Nulear Engineering Laboratory, Nulear Energy Group. K. Kimura Advaned Reator Engineering

More information

The Effect of Texture on the Serrated Flow in Peak-Aged 2090 Al-Li Alloy

The Effect of Texture on the Serrated Flow in Peak-Aged 2090 Al-Li Alloy Solid State Phenomena Vol. 105 (2005) pp. 227-232 online at http://www.sientifi.net 2005 Trans Teh Publiations, Switzerland The Effet of Texture on the Serrated Flow in Peak-Aged 2090 Al-Li Alloy Y.Z.

More information

Hippocampal cellular and network activity in freely moving echolocating bats

Hippocampal cellular and network activity in freely moving echolocating bats 27 Nature Pulishing Group http://www.nature.om/natureneurosiene Hippoampal ellular and network ativity in freely moving eholoating ats Nahum Ulanovsky 1,2 & Cynthia F Moss 1 3 The hippoampus is ruial for

More information

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue

DNA isolation from tissue DNA isolation from eukaryotic cells (max. 5 x 106 cells) DNA isolation from paraffin embedded tissue INDEX KIT COMPONENTS 3 STORAGE AND STABILITY 3 BINDING CAPACITY 3 INTRODUCTION 3 IMPORTANT NOTES 4 EUROGOLD TISSUE DNA MINI KIT PROTOCOLS 5 A. DNA isolation from tissue 5 B. DNA isolation from eukaryotic

More information

International Journal of Research (IJR) e-issn: , p- ISSN: X Volume 3, Issue 01, January 2016

International Journal of Research (IJR) e-issn: , p- ISSN: X Volume 3, Issue 01, January 2016 International Journal of Researh (IJR) Available at http://internationaljournalofresearh.org Study of failure probability by deterministi method reliability-strength applied to metal ables intended for

More information

Rab5 Activation Assay Kit

Rab5 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Rab5 Activation Assay Kit Catalog Number: 83701 20 assays 24 Whitewoods Lane 1 Table of Content Product

More information

Oxidation Stability of Colloidal 2D Titanium Carbides (MXenes)

Oxidation Stability of Colloidal 2D Titanium Carbides (MXenes) Supporting information for Oxidation Staility of Colloidal 2D Titanium Carides (MXenes) Chuanfang (John) Zhang, 1,2, Sergio Pinilla, 3,4, Niall MEvoy, 1,2 Conor P. Cullen, 1,2 Baak Anasori, 5 Edmund Long,

More information

Arf6 Activation Assay Kit

Arf6 Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based Arf6 Activation Assay Kit Catalog Number: 82401 20 assays NewEast Biosciences 1 Table of Content Product

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

REVENUE SHARING CONTRACT OR WHOLESALE PRICE CONTRACT? ANALYTICAL RESULTS FROM VARIOUS CHANNEL POWER ARRANGEMENTS IN A TOURISM SUPPLY CHAIN

REVENUE SHARING CONTRACT OR WHOLESALE PRICE CONTRACT? ANALYTICAL RESULTS FROM VARIOUS CHANNEL POWER ARRANGEMENTS IN A TOURISM SUPPLY CHAIN REVENUE SHARING CONTRACT OR WHOLESALE PRICE CONTRACT? ANALYTICAL RESULTS FROM VARIOUS CHANNEL POWER ARRANGEMENTS IN A TOURISM SUPPLY CHAIN n, College of Business, Washington State University, Wilson Road,

More information

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet

A Low salt diet. C Low salt diet + mf4-31c1 3. D High salt diet + mf4-31c1 3. B High salt diet A Low salt diet GV [AU]:. [mmhg]: 0..... 09 9 7 B High salt diet GV [AU]:. [mmhg]: 7 8...0. 7.8 8.. 0 8 7 C Low salt diet + mf-c GV [AU]:. [mmhg]:.0.9 8.7.7. 7 8 0 D High salt diet + mf-c E Lymph capillary

More information

Supplemental material

Supplemental material Supplemental material THE JOURNAL OF CELL BIOLOGY Taylor et al., http://www.jcb.org/cgi/content/full/jcb.201403021/dc1 Figure S1. Representative images of Cav 1a -YFP mutants with and without LMB treatment.

More information

λ N -GFP: an RNA reporter system for live-cell imaging

λ N -GFP: an RNA reporter system for live-cell imaging λ N -GFP: an RNA reporter system for live-cell imaging Nathalie Daigle & Jan Ellenberg Supplementary Figures and Text: Supplementary Figure 1 localization in the cytoplasm. 4 λ N22-3 megfp-m9 serves as

More information

A de novo gain-of-function mutation in SCN11A causes loss of pain perception

A de novo gain-of-function mutation in SCN11A causes loss of pain perception Supplementary Information A e novo gain-of-funtion mutation in SCN11A auses loss of pain pereption Enrio Leipol 1, Lutz Liemann 2, G. Christoph Korenke 3, Theresa Heinrih 2, Seastian Gießelmann 2, Jonathan

More information

RheB Activation Assay Kit

RheB Activation Assay Kit A helping hand for your research Product Manual Configuration-specific Monoclonal Antibody Based RheB Activation Assay Kit Catalog Number: 81201 20 assays NewEast Biosciences 1 FAX: 610-945-2008 Table

More information

A Capillary Pressure Model for Geothermal Reservoirs

A Capillary Pressure Model for Geothermal Reservoirs Geothermal Resoures Counil Transations, Vol. 26, September 2002 A Capillary ressure Model for Geothermal Reservoirs Kewen Li and Roland N. Horne Stanford Geothermal rogram, Stanford University (kewenli@stanford.edu)

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Durability of bitumen mat used for increasing friction between concrete caisson and rock mound

Durability of bitumen mat used for increasing friction between concrete caisson and rock mound Duraility of itumen mat used for inreasing frition etween onrete aisson and rok mound Masakazu Mayama Hokkaido Institute of Tehnology, Sapporo, Japan Tadahiro Imoto Civil Engineering Researh Institute

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. Printed December 13, 2011 Version 1.0 For Research Use Only. Not for use in diagnostic procedures. DDDDK-tagged Protein PURIFICATION GEL with Elution Peptide (MoAb. clone FLA-1) CODE No. 3326 / 3327 PURIFICATION

More information

Plant formin AtFH5 is an evolutionarily conserved actin nucleator involved in cytokinesis

Plant formin AtFH5 is an evolutionarily conserved actin nucleator involved in cytokinesis Plant formin AtFH5 is an evolutionarily onserved atin nuleator involved in ytokinesis Mathieu Ingouff 1,4,8, Jonathan N. Fitz Gerald 1,5,8, Christophe Guérin 2, Hélène Robert 1,6, Mikael Blom Sørensen

More information

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of

Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Supplementary Information Cytotoxicity of Botulinum Neurotoxins Reveals a Direct Role of Syntaxin 1 and SNAP-25 in Neuron Survival Lisheng Peng, Huisheng Liu, Hongyu Ruan, William H. Tepp, William H. Stoothoff,

More information

S2 whole chromatin (input) fragment lenght. S2 H3 ChIP fragment lenght. Digestion fragments

S2 whole chromatin (input) fragment lenght. S2 H3 ChIP fragment lenght. Digestion fragments S whole hromatin (input) 17 Density..1 MNase MNase.5U MNase 5U MNase 1U 1 3 5 fragment lenght 17 S H3 ChIP Density..1 MNase MNase.5U MNase 5U MNase 1U 1 3 5 fragment lenght Digestion fragments 1U pro le

More information

Proceedings of the 2012 Winter Simulation Conference C. Laroque, J. Himmelspach, R. Pasupathy, O. Rose, and A.M. Uhrmacher, eds

Proceedings of the 2012 Winter Simulation Conference C. Laroque, J. Himmelspach, R. Pasupathy, O. Rose, and A.M. Uhrmacher, eds Proeedings of the 2012 Winter Simulation Conferene C. Laroque, J. Himmelspah, R. Pasupathy, O. Rose, and A.M. Uhrmaher, eds INDUSTRIAL IMPLEMENTATION OF A DYNAMIC SAMPLING ALGORITHM IN SEMICONDUCTOR MANUFACTURING:

More information

PIEZO2 is required for mechanotransduction in human stem cell derived touch receptors

PIEZO2 is required for mechanotransduction in human stem cell derived touch receptors a r t i l e s PIEZO2 is required for mehanotransdution in human stem ell derived touh reeptors Katrin Shrenk-Siemens 1, Hagen Wende 1, Vinenzo Prato 1, Kun Song 1, Charlotte Rostok 1, Alexander Loewer

More information

Proposal for a new shear design method

Proposal for a new shear design method Chapter 6 Proposal for a new shear design method The behaviour of beams failing in shear has been studied in the previous hapters, with speial attention paid to high-strength onrete beams. Some aspets

More information

Structure±function correlations derived from faster variants of a RNA ligase deoxyribozyme

Structure±function correlations derived from faster variants of a RNA ligase deoxyribozyme Published online February 11, 2004 Nulei Aids Researh, 2004, Vol. 32, No. 3 1075±1082 DOI: 10.1093/nar/gkh263 Struture±funtion orrelations derived from faster variants of a RNA ligase deoxyribozyme Traey

More information

W. B. Jones, J. A. Van Den Avyle, W. B. Bauster and W. R. Wampler Sandia Laboratories Albuquerque, NM 87185

W. B. Jones, J. A. Van Den Avyle, W. B. Bauster and W. R. Wampler Sandia Laboratories Albuquerque, NM 87185 ASSESSMENT OF POSTRON ANNlliiiATON AS A POTENTAL NON-DESTRUCTVE EXAMNATON TECHNQUE W. B. Jones, J. A. Van Den Avyle, W. B. Bauster and W. R. Wampler Sandia Laboratories Albuquerque, NM 87185 ABSTRACT The

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a 14 12 Densitometry (AU) 1 8 6 4 2 t b 16 NMHC-IIA GAPDH NMHC-IIB Densitometry (AU) 14 12 1 8 6 4 2 1 nm 1 nm 1 nm 1 nm sirna 1 nm 1 nm Figure S1 S4 Quantification of protein levels. (a) The microtubule

More information

Twenty First Century Science. PILOT Examination Questions. GCSE Science Jan 2005 Keeping healthy, Radioactive materials, Life on Earth (Mark Scheme)

Twenty First Century Science. PILOT Examination Questions. GCSE Science Jan 2005 Keeping healthy, Radioactive materials, Life on Earth (Mark Scheme) Twenty First Century Siene PILOT Examination Questions GCSE Siene Jan 005 Keeping healthy, Radioative materials, Life on Earth (Mark Sheme) Please note: These questions are not Sample Assessment Materials

More information

Studies on the Refolding Process of Dissertation_ 全文 )

Studies on the Refolding Process of Dissertation_ 全文 ) Title Studies on the Refolding Proess of Dissertation_ 全文 ) Author(s) Onda, Maki Citation Kyoto University ( 京都大学 ) Issue Date 1999-9-24 URL https://doi.org/1.1151/3157425 Right Type Thesis or Dissertation

More information

Fluorescent heterogeneities in turbid media: limits for detection, characterization, and comparison with absorption

Fluorescent heterogeneities in turbid media: limits for detection, characterization, and comparison with absorption Fluoresent heterogeneities in turbid media: limits for detetion, haraterization, and omparison with absorption Xingde Li, Britton Chane, and Arjun G. Yodh The fundamental limits for detetion and haraterization

More information

LOW FREQUENCY BUCKETS FOR INDUSTRIAL STEAM TURBINES by

LOW FREQUENCY BUCKETS FOR INDUSTRIAL STEAM TURBINES by LOW FREQUENCY BUCKETS FOR INDUSTRIAL STEAM TURBINES by Firm L. Weaver Engineering Consultant Sun City Center, Florida Firm L. Weaver graduated from Roanoke Coll ege, in Salem, Virginia, with a B.S. degree

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Methods Cell synchronization. For synchronized cell growth, thymidine was added to 30% confluent U2OS cells to a final concentration of 2.5mM. Cells were incubated

More information

Stellaris RNA FISH Protocol for Adherent Cells in 96 Well Glass Bottom Plates

Stellaris RNA FISH Protocol for Adherent Cells in 96 Well Glass Bottom Plates Stellaris RNA FISH Protocol for Adherent Cells in 96 Well Glass Bottom Plates This protocol is specifically designed for high throughput applications of Stellaris in 96 well glass bottom plates. General

More information

Author(s) Yoshimi, K; Kaneko, T; Voigt, B; Ma.

Author(s) Yoshimi, K; Kaneko, T; Voigt, B; Ma. Title Allele-speifi genome editing and assoiated phenotypes in rats using Author(s) Yoshimi, K; Kaneko, T; Voigt, B; Ma itation Nature ommuniations (2014), 5 Issue Date 2014-06-26 URL http://hdl.handle.net/2433/188742

More information

Detection of empty grate regions in firing processes using infrared cameras

Detection of empty grate regions in firing processes using infrared cameras 11 th International Conferene on Quantitative InfraRed Thermography Detetion of empty grate regions in firing proesses using infrared ameras by J. Matthes*, P. Waibel* and H.B. Keller* *Institute for Applied

More information

XactEdit Cas9 Nuclease with NLS User Manual

XactEdit Cas9 Nuclease with NLS User Manual XactEdit Cas9 Nuclease with NLS User Manual An RNA-guided recombinant endonuclease for efficient targeted DNA cleavage Catalog Numbers CE1000-50K, CE1000-50, CE1000-250, CE1001-250, CE1001-1000 Table of

More information

Fluorescent In Situ Hybridization with DIG-RNA probes on dissected larval preps

Fluorescent In Situ Hybridization with DIG-RNA probes on dissected larval preps If you use this protocol, please reference: Subhashree Ganesan, Julie Karr, and David E. Featherstone. (2011) Drosophila glutamate receptor mrna expression and mrnp particles. RNA Biology 8(5):1-11 Fluorescent

More information