AT2G02060 AT2G40260 AT2G AT4G04580 AT2G06020 AT2G AT5G06800 AT3G13040 AT2G AT5G AT3G04030

Size: px

Start display at page:

Download "AT2G02060 AT2G40260 AT2G AT4G04580 AT2G06020 AT2G AT5G06800 AT3G13040 AT2G AT5G AT3G04030"

Aron Boyd
6 years ago
Views:

1 AT5G AT3G AT5G AT2G40970 AT3G46640 LUX/PCL AT5G59570 BOA AT4G18020 PRR2 97 AT2G20570 GLK AT5G44190 GLK2 58 AT1G49560 HHO6 AT4G37180 HHO5 AT2G03500 HHO AT1G13300 HRS1 66 AT3G25790 HHO1 76 AT1G25550 HHO3 45 AT1G68670 HHO AT1G AT2G02060 AT2G AT2G AT4G04580 AT5G16560 KAN1 34 AT5G42630 KAN AT1G32240 KAN2 50 AT4G17695 KAN3 AT2G06020 AT2G AT5G06800 AT3G13040 AT2G AT4G28610 PHR1 68 AT3G04450 PHL1 77 AT5G AT3G AT5G18240 MYR1 AT1G69580 AT3G AT3G AT4G13640 MYR2 AT1G79430 APL/WDY 0.5 Supplementary Figure 1. The G2-like family tree. The sequenes of the 40 proteins elonging to the G2-like family were retrieved from the AGRIS dataase. The phylogeni tree was inferred y using the Maximum Likelihood method and the ootstrap values were otained ased on 500 repliates. In red, the tree s ranh orresponding to the su-group of HRS1 and its lose homologs (HHO1-HHO6). The urrent name of the most known proteins of the family is indiated next to the ID numer. The distane sale ar at the ottom indiates the numer of sustitutions per site.

hho1-1 KNO 3 hho1-1 KCl C d Chimeri DNA 1 k T- DNA HHO1 (7197) 7197 7210 7220 7230 7240 7250 7260 7270 7280 7295 Seq 5' (1)

2 SALK!_067074! LB! LB! 1 k hrs1$1!(at1g13300) 5 UTR! 3 UTR! SAIL_28_D03! RB! LB! 1 k hho1$1!(at3g25790) 5 UTR! 3 UTR! hho1-1 KNO 3 hho1-1 KCl C d Chimeri DNA 1 k T- DNA HHO1 (7197) Seq 5' (1) GCGTTTATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGT T-DNA Sail r(7197) CGAATTCAATTCGGCGTTAATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAATATATCCTGCC Consensus(7197) GCGTT ATTCAGTACATTAAAAACGTCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGT (226) AT3G25790/HHO1 (226) TATAAGAGGGAGATATCAGGGACGTCGACGGATAACTTATACGGACAGTCGGAGTGCTCAGAGCAGACCACCGGAGAATGTGGGCGCATCTTGGA LB3 HHO1 DNA (33) TGTGTTATTAAGTTGTCTAAG-CGTCAAT---TTGTTTATACGGACAGTCGGAGTGCTCAGAGCAGACCACCGGAGAATGTGGGCGCATCTTGGA Consensus (226) T T A AG T TC G CGTC A T TTATACGGACAGTCGGAGTGCTCAGAGCAGACCACCGGAGAATGTGGGCGCATCTTGGA Supplementary Figure 2. Charaterization of mutant hrs1-1, hho1-1 and hrs1-1;hho1-1. (a) Shemati representation of HRS1 and HHO1 genomi sequenes: in SALK _067074, the T-DNA is inserted in the last exon; in SAIL_28_D03, the T-DNA is inserted in the seond exon. () The asene of full length transripts for HRS1 and HHO1 was verified y RT-PCR on mrna isolated from roots of hrs1-1, hho1-1 and hrs1-1;hho1-1 mutants grown for 14 days on MS/2 media. Despite the asene of the full-length DNA hho1-1 mutant displays a strong transript aumulation when primers in the 3 - end of the genes are used (Fig. 6). This anormality has een haraterized thereafter () and orresponds to himeras of Sail T-DNA and HHO1 DNA, thus produing no orret CDS and funtional protein. Chimeras amplified on hho1-1 mutant DNA otained from plants treated with KNO 3 or KCl 1mM, using sail-lb primer and HHO1 speifi primers (green) have een sequened (d).

Primary root length (m) 4 3 2 1 0 KNO 3 (mm) 0 2.5 0 2.5 Col 0 hrs1-1 0 mm KH 2 PO 4 0.5 mm KH 2 PO 4 Col 0 hrs1-1 ; hho1-1 - P +P Primary root length (m) 3 Col hrs1-1;hho1-1 2 1 0 *** 0 0.

hrs1-1;hho1-1 mutant is insensitive to phosphate starvation in transfer experiment. (a) Primary root growth measurement of Col and hrs1-1 seedlings grown for 9 days on media ontaining -/+P (0.

3 Primary root length (m) KNO 3 (mm) Col 0 hrs1-1 0 mm KH 2 PO mm KH 2 PO 4 Col 0 hrs1-1 ; hho1-1 - P +P Primary root length (m) 3 Col hrs1-1;hho *** KH 2 PO 4 mm 2.5 mm KNO 3 Supplementary Figure 3. hrs1-1 mutant doesn t display any ovious primary root phenotype in P-starvation onditions. hrs1-1;hho1-1 mutant is insensitive to phosphate starvation in transfer experiment. (a) Primary root growth measurement of Col and hrs1-1 seedlings grown for 9 days on media ontaining -/+P (0.5 mm KH 2 PO 4 ) and -/+N (2.5 mm KNO 3 ); () WT (Col) and doule mutant (hrs1;hho1) seedlings were grown for 8 days on omplete MS/2 media ontaining 2.5 mm KNO 3 and 0.5 mm KH 2 PO 4. They were transferred on media ontaining the same onentration of KNO 3 and + or -P. After 4 days, the WT primary root growth slowed down ut the hrs1;hho1 mutant ontinued to grow. () The primary root zone developed after the transfer on media + or -P was measured; horizontal lak marks indiate the position of the root tip at transfer. Values represent the means ± SEM (n=10). Asterisks indiate signifiant differenes from WT plants (*** P<0.001; Student s t test).

HRS1:GFP P GFP DAPI Ape x Epidermal layer 3D

series showing the expression of HRS1-GFP in

In () PI staining allows the lear identifiation

4 HRS1:GFP P GFP DAPI Ape x Epidermal layer 3D view GFP signal e PI+GFP e d Supplementary Figure 4. HRS1-GFP loalizes in the nuleus of epidermis and ortex ells of roots. (a) GFP fluoresene signals o-loalize with DAPI nulear staining. (,) 3D reonstrution otained from onfoal Z series showing the expression of HRS1-GFP in the external layers of the primary root. In () PI staining allows the lear identifiation of root epidermal (e) and ortex () layers were the HRS1-GFP protein is expressed. (d) The HRS1-GFP expression in root hairs was visile y epifluoresene mirosope imaging. Sale ars orrespond to 85µm, 40µm and 30µm in a, -left panel and -right panel respetively.

sreen of 5 motifs. HRS1-GST reominant protein was produed in E.

arylamide-isarylamide denaturing gel in parallel to 1µg of purified reominant

Immunolot detetion of the HRS1-GST and GST protein at 70 kda and 25 kda expeted

() To test if the shifts otained for the different motifs are speifi to HRS1 and

Motif 5 in presene of 50 ng of GST. No shift was otained.

5 d e Supplementary Figure 5. Prodution of HRS1-GST protein, test of un-speifi inding of the GST tag, EMSA sreen of 5 motifs. HRS1-GST reominant protein was produed in E. oli Rosetta 2(DE3)pLysS (Novagen, Darmstadt, Germany) and purified on glutathion-sepharose eads. (a) Fifteen µl of purified HRS1-GST protein were separated in 12% arylamide-isarylamide denaturing gel in parallel to 1µg of purified reominant GST tag-free protein (Sigma Aldrih, St Louis, USA). Immunolot detetion of the HRS1-GST and GST protein at 70 kda and 25 kda expeted moleular weights using anti GST-HRP (Aam, England) antiody. () To test if the shifts otained for the different motifs are speifi to HRS1 and not to non-speifi inding of the GST tag, an EMSA experiment was performed for Motif 5 in presene of 50 ng of GST. No shift was otained. () Sequenes of the proes used to perform EMSA analysis (proes eing multimers see Supplementary Tale 1); mutation were introdued y hanging G to T and C to T in ACA end AACC ores. (d) EMSA sreen of the 5 seleted motifs. (e) EMSA ompetition assay using inreasing onentrations of unlaeled (mutated or not) proes.

Over-represented GO terms for diret (TARGET) up regulated genes Over-represented GO terms for diret (TARGET) down regulated genes

Coherene in HRS1 targets deteted y ell-ased (TARGET) and in planta transriptomes are revealed y GO term analysis.

sujeted to agrigo 40 Gene Ontology enrihment analysis followed y REVIGO plotting 46.

6 Over-represented GO terms for diret (TARGET) up regulated genes Over-represented GO terms for diret (TARGET) down regulated genes Over-represented GO terms for deregulated genes in plant roots in planta Cell ased system Supplementary Figure 6. Coherene in HRS1 targets deteted y ell-ased (TARGET) and in planta transriptomes are revealed y GO term analysis. Gene lists issued from the TARGET 37 analysis (up and down regulated HRS1 diret targets) and from the whole root transriptome, were sujeted to agrigo 40 Gene Ontology enrihment analysis followed y REVIGO plotting 46. GO terms found to e ontrolled y HRS1 in protoplasts are largely found to e affeted y HRS1 and HHO1 mutations and over-expression in whole root transriptome, demonstrating the preditive power of TARGET approah to deipher the role of a partiular TF de novo 37.

7 KNO h 2h 4h KCl KCl KNO 3 8h 1h 4h 4h 4h +P - P 0 24h 48h 72h 24h 48h 72h Supplementary Figure 7. Western lot and lue stainings in Fig. 4a-, unropped version.

8 CHX +P h 2h 4h 4h DMSO CHX - P h 2h 4h 4h DMSO CHX (min) +P P NRT1.1 anti- NRT1.1 PIP2.1 anti- PIP2.1 Supplementary Figure 8. Western lot and lue stainings in Fig. 5a,, unropped version.

A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Journal of Plant Research A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana Linna Leng 1 Qianqian Liang