λ N -GFP: an RNA reporter system for live-cell imaging
|
|
- Natalie Powers
- 5 years ago
- Views:
Transcription
1 λ N -GFP: an RNA reporter system for live-cell imaging Nathalie Daigle & Jan Ellenberg Supplementary Figures and Text: Supplementary Figure 1 localization in the cytoplasm. 4 λ N22-3 megfp-m9 serves as a reporter of mrna Supplementary Figure 2 Dynamics of SRP RNA assessed by FRAP experiments. Supplementary Methods Note: Supplementary Movies 1 and 2 are available on the Nature Methods website.
2 Supplementary figure 1. a. mrna: mrfp-4 boxb-zipcode Protein: mrfp Ratio mrna/protein 0:00 0:30 1:00 1:30 2:00 b. Relative fluorescence intensity 1,2 1 0,8 0,6 0,4 0,2 Protein mrfp mrna mrfp-4xboxb-zipcode Time (sec) mrna: mrfp-4 boxb-zipcode Protein: mrfp Pre-bleach Bleach 4 s 60 s 4 λn22-3 megfp-m9 serves as a reporter of mrna localization in the cytoplasm. (a) Cells transfected with pmrfp-4 boxb-zipcode were imaged over 2 hours. Selected time points show localization of the mrna (arrowheads) in lamellipodia as the cell moves. Upper panel shows mrna localization, middle panel the encoded mrfp and lower panel shows the pseudocolor ratio images displaying the specific mrna localization. Warm pixels correspond to areas where mrna concentration is high. Images are projections of 3 confocal slices of 2 µm optical thickness (FWHM). See Movie 1 for full video. (b) Dynamics of mrna molecules assessed by FRAP experiments. Plots represent normalized fluorescence displayed over time, n = 6. Images show a single confocal slice of 5 µm optical thickness of mrna (upper panel) and protein (lower panel). Scale bar 10µm.
3 Supplementary figure 2. Relative fluorescence intensity 1, , , , , Time (s) RNA 5xboxB-SRPRNA Protein SRP19-mRFP mrna: 5 boxb-srprna Protein: SRP19-mRFP Bleach 10 s 110 s Dynamics of SRP RNA assessed by FRAP experiments. Plot represent normalized fluorescence displayed over time for 5 box-srprna, the non-coding RNA that forms the structural backbone of the signal recognition particle (SRP), and for SRP19-mRFP, one of the protein components of the particle. Images show a single confocal section of 5 µm optical thickness (FWHM) of SRP RNA (upper panel) and SPR19 protein (lower panel). n = 5. Scale bar 10 µm.
4 Supplementary Methods Cell Culture NRK cells were cultured as described elsewhere 1. All experiments were performed in NRK cells stably expressing 4 λ N22-3 megfp-m9. The stable cell line was selected according to standard protocols and maintained in 0,5mg/ml G418. For imaging, growth medium was replaced by CO 2 -independent phenol red free medium (Invitrogen). Transfection was with FuGene 6 (Roche). To promote movement of 4 λ N22-3 megfp- M9 NRK cells transfected with pmrfp-4 boxb-β-actin-zipcode, 20% FCS was added back after 4 hours of serum (FCS) starvation. DNA constructs An array of four λ N22 (MDAQTRRRERRAEKQAQWKAAN), spaced by 21 amino acid linkers (PPLDGAGAGAGAGAGAGGLAT), was fused to a tandem of three megfp 2 to increase the signal 3, and followed by an M9 nuclear localization signal 4. psrprb-mrfp- 4 boxb and psrprb-mrfp-16 boxb were made the following way: mrfp 5 has been subcloned in place of CFP into psrprb-cfp 3. An oligonucleotide containing four boxb (GCCCTGAAAAAGGGC) spaced by four nucleotides and flanked by restriction sites was synthesized (Sigma) and subcloned downstream of mrfp stop codon. The total length of the stem loop tag was thus 80 nucleotides. Restriction sites 5 and 3 of this oligonucleotide were designed to subclone multiples of this array of four boxb motifs and used to generate a tag containing 16 boxb motifs, with a total length of 310 nucleotides. pmrfp-4/16 boxb-β-actin-zipcode were generated using the same oligonucleotide containing 4 boxb and the same strategy as for the previous construct. Chicken β-actin-zipcode was designed as construct G in 6. The plasmid p5 boxb- SRPRNA was constructed using the forty one nucleotides of the human SRP RNA promoter followed by 5 boxb, the SRP RNA sequence and PolIII terminator 7. EGFP was replaced by mrfp in psrp19-egfp 8 to generate psrp19-mrfp.
5 Imaging Imaging was performed on a customized ZEISS LSM510 Axiovert confocal microscope as described previously 9,10 using a 63x Plan-Apochromat 1.4 NA oil immersion objective lens (Carl Zeiss, Jena). Images were analyzed in the LSM software (Carl Zeiss, Jena) and ImageJ ( Figures were assembled in Adobe Photoshop and Adobe Illustrator (Adobe Systems, Inc.). Image ratios were calculated by dividing background subtracted mrna intensities by the corresponding background subtracted protein intensities. For display purposes, cell contours were defined by automated segmentation in the mrfp channel and applied to the ratio images. Ratio values at each pixel are displayed as warm colors for higher ratio and cold colors for lower ratio. For correlating post-mitotic mrna export and encoded protein translation, quantitation during the first wave of cytoplasmic mrna localization is displayed. Fluorescence intensities were background subtracted and normalized between 0 and 1 in the following manner. For mrna, average cytoplasmic background of untransfected cells and highest values in the first wave where normalized to 0 and 1. For protein, average cytoplasmic background of untransfected cells and highest values were set to 0 and 1. Data from n = 6 cells have been registered in time to the highest mrna value of the wave. Photobleaching was done on mrna and protein molecules using the 488 nm line of the argon laser and the 561 nm diode laser simultaneously. Images were taken with wide open pinhole, fluorescence in the bleached region of the cytoplasm was background subtracted and corrected for bleaching due to acquisition and loss of total fluorescence due to the photobleach pulse and normalized to 1 for the prebleach intensity.
6 References 1. Ellenberg, J. et al. Nuclear membrane dynamics and reassembly in living cells: targeting of an inner nuclear membrane protein in interphase and mitosis. J Cell Biol 138, (1997). 2. Snapp, E.L. et al. Formation of stacked ER cisternae by low affinity protein interactions. J Cell Biol 163, (2003). 3. Daigle, N. et al. Nuclear pore complexes form immobile networks and have a very low turnover in live mammalian cells. J Cell Biol 154, (2001). 4. Siomi, H. & Dreyfuss, G. A nuclear localization domain in the hnrnp A1 protein. J Cell Biol 129, (1995). 5. Campbell, R.E. et al. A monomeric red fluorescent protein. Proc Natl Acad Sci U S A 99, (2002). 6. Kislauskis, E.H., Zhu, X. & Singer, R.H. Sequences responsible for intracellular localization of beta-actin messenger RNA also affect cell phenotype. J Cell Biol 127, (1994). 7. Ullu, E. & Weiner, A.M. Human genes and pseudogenes for the 7SL RNA component of signal recognition particle. Embo J 3, (1984). 8. Politz, J.C. et al. Signal recognition particle components in the nucleolus. Proc Natl Acad Sci U S A 97, (2000). 9. Lenart, P. et al. A contractile nuclear actin network drives chromosome congression in oocytes. Nature 436, (2005). 10. Rabut, G. & Ellenberg, J. Automatic real-time three-dimensional cell tracking by fluorescence microscopy. J Microsc 216, (2004).
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 1 SUPPLEMENTARY INFORMATION 2 WWW.NATURE.COM/NATURECELLBIOLOGY SUPPLEMENTARY INFORMATION WWW.NATURE.COM/NATURECELLBIOLOGY 3 SUPPLEMENTARY INFORMATION
More informationChapter One. Construction of a Fluorescent α5 Subunit. Elucidation of the unique contribution of the α5 subunit is complicated by several factors
4 Chapter One Construction of a Fluorescent α5 Subunit The significance of the α5 containing nachr receptor (α5* receptor) has been a challenging question for researchers since its characterization by
More informationFluorescence Light Microscopy for Cell Biology
Fluorescence Light Microscopy for Cell Biology Why use light microscopy? Traditional questions that light microscopy has addressed: Structure within a cell Locations of specific molecules within a cell
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Feng et al., http://www.jcb.org/cgi/content/full/jcb.201408079/dc1 Figure S1. A modest elevation of disulfide-bonded K14 in primary mouse
More informationNo wash 2 Washes 2 Days ** ** IgG-bead phagocytosis (%)
Supplementary Figures Supplementary Figure 1. No wash 2 Washes 2 Days Tat Control ** ** 2 4 6 8 IgG-bead phagocytosis (%) Supplementary Figure 1. Reversibility of phagocytosis inhibition by Tat. Human
More informationSpectral Separation of Multifluorescence Labels with the LSM 510 META
Microscopy from Carl Zeiss Spectral Separation of Multifluorescence Labels with the LSM 510 META Indians living in the South American rain forest can distinguish between almost 200 hues of green in their
More informationChapter 3.5. Protein Synthesis
Chapter 3.5 Protein Synthesis Summary of Protein Synthesis How chemical Information is transfer during protein synthesis DNA mrna protein transcription the step from DNA to mrna occurs in the nucleus where
More informationSUPPLEMENTARY INFORMATION
a 14 12 Densitometry (AU) 1 8 6 4 2 t b 16 NMHC-IIA GAPDH NMHC-IIB Densitometry (AU) 14 12 1 8 6 4 2 1 nm 1 nm 1 nm 1 nm sirna 1 nm 1 nm Figure S1 S4 Quantification of protein levels. (a) The microtubule
More informationSupplementary Figure S1. Np95 interacts with de novo methyltransferases Dnmt3a and 3b. (A) Co-immunoprecipitation of endogenous Dnmt3a2 (left and
Supplementary Figure S1. Np95 interacts with de novo methyltransferases Dnmt3a and 3b. (A) Co-immunoprecipitation of endogenous Dnmt3a2 (left and right), Dnmt3b isoforms (left) and Dnmt1 (right) with GFP-Np95
More informationSynonymous Modification Results in High Fidelity Gene Expression of Repetitive Protein and Nucleotide Sequences
Synonymous Modification Results in High Fidelity Gene Expression of Repetitive Protein and Nucleotide Sequences Bin Wu *,1,2, Veronika Miskolci *,1, Hanae Sato 1, Evelina Tutucci 1, Charles A. Kenworthy
More informationSingle-Molecule Imaging Reveals Dynamics of CREB Transcription Factor Bound to Its Target Sequence
Supplementary Information Single-Molecule Imaging Reveals Dynamics of CREB Transcription Factor Bound to Its Target Sequence Noriyuki Sugo, Masatoshi Morimatsu, Yoshiyuki Arai, Yoshinori Kousoku, Aya Ohkuni,
More informationThe Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
More informationSupplementary Information. A superfolding Spinach2 reveals the dynamic nature of. trinucleotide repeat RNA
Supplementary Information A superfolding Spinach2 reveals the dynamic nature of trinucleotide repeat RNA Rita L. Strack 1, Matthew D. Disney 2 & Samie R. Jaffrey 1 1 Department of Pharmacology, Weill Medical
More informationDNA is the MASTER PLAN. RNA is the BLUEPRINT of the Master Plan
Sec. 12-3 RNA and Protein Synthesis Roles of DNA and RNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 1 RNA uses the information from DNA to make proteins Differs from DNA: 1. Ribose
More informationJCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,
Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained
More informationNOTES Gene Expression ACP Biology, NNHS
Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does
More informationMOLECULAR DETERMINANTS OF SELECTIVE CLEARANCE OF PROTEIN INCLUSIONS BY AUTOPHAGY
Nature Communications Supporting Information MOLECULAR DETERMINANTS OF SELECTIVE CLEARANCE OF PROTEIN INCLUSIONS BY AUTOPHAGY Esther Wong, Eloy Bejarano, Moumita Rakshit, Karen Lee, Hugo H. Hanson, Nava
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More information-RT RT RT -RT XBMPRII
Base pairs 2000 1650 1000 850 600 500 400 Marker Primer set 1 Primer set 2 -RT RT RT -RT XBMPRII kda 100 75 50 37 25 20 XAC p-xac A 300 B Supplemental figure 1. PCR analysis of BMPRII expression and western
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationCHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein
CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to
More informationConfocal Microscopy Analyzes Cells
Choosing Filters for Fluorescence A Laurin Publication Photonic Solutions for Biotechnology and Medicine November 2002 Confocal Microscopy Analyzes Cells Reprinted from the November 2002 issue of Biophotonics
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationNodes of regulation in cellular systems
Nodes of regulation in cellular systems cell membrane signal transduction ligands receptors oligomerization transport signal transduction modified protein Golgi transcription factor transport ER transport
More informationFig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationRNA does not adopt the classic B-DNA helix conformation when it forms a self-complementary double helix
Reason: RNA has ribose sugar ring, with a hydroxyl group (OH) If RNA in B-from conformation there would be unfavorable steric contact between the hydroxyl group, base, and phosphate backbone. RNA structure
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationChapter 4. the biological community to assay for protein-protein interactions. FRET describes the
31 Chapter 4 Determination of nachr stoichiometry using Normalized Försters Resonance Energy Transfer (NFRET) Försters resonance energy transfer (FRET) has become a technique widely used in the biological
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationFluorescent labeling of the nuclear envelope by localizing GFP on the inner nuclear membrane
Supporting Information Fluorescent labeling of the nuclear envelope by localizing GFP on the inner nuclear membrane Toshiyuki Taniyama 1, Natsumi Tsuda 1, and Shinji Sueda 1,2,* 1 Department of Bioscience
More informationSelf-labelling enzymes as universal tags for fluorescence microscopy, superresolution microscopy and electron microscopy
Supplementary Materials Self-labelling enzymes as universal tags for fluorescence microscopy, superresolution microscopy and electron microscopy Viktoria Liss, Britta Barlag, Monika Nietschke and Michael
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationIn Vivo Dynamics of Polymerase II Transcription Darzacq, et al
In Vivo Dynamics of Polymerase II Transcription Darzacq, et al Supplementary Information Page Supplementary Figure... 2 Supplementary Discussion... 3 Supplementary Methods... 5 Supplementary References...
More informationDNA AND PROTEIN SYSNTHESIS
DNA AND PROTEIN SYSNTHESIS DNA AND PROTEIN SYSNTHESIS DNA PROTEIN What structures are found in the nucleus? What is a gene? Gene: a portion of DNA that contains the codes (instructions) for one protein.
More information6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA
6.C: Students will explain the purpose and process of transcription and translation using models of DNA and RNA DNA mrna Protein DNA is found in the nucleus, but making a protein occurs at the ribosome
More informationSupplement Figure S1:
Supplement Figure S1: A, Sequence of Xcadherin-11 Morpholino 1 (Xcad-11MO) and 2 (Xcad-11 MO2) and control morpholino in comparison to the Xcadherin-11 sequence. The Xcad-11MO binding sequence spans the
More informationRer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein 22 mutant that causes type 1A Charcot-Marie-Tooth disease
Rer1 and calnexin regulate endoplasmic reticulum retention of a peripheral myelin protein mutant that causes type 1A Charcot-Marie-Tooth disease Taichi Hara, Yukiko Hashimoto, Tomoko Akuzawa, Rika Hirai,
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rainero et al., http://www.jcb.org/cgi/content/full/jcb.201109112/dc1 Figure S1. The expression of DGK- is reduced upon transfection
More informationTranscription factor dynamics in the nucleus
Transcription factor dynamics in the nucleus March 21, 2018 Luca Giorgetti txnlecture2018@fmi.ch Transcription factors bind to enhancer and promoter regions Adapted from Streubel & Bracken EMBO J 2015
More informationSupplementary Figures
Supplementary Figures Supplementary Figure S1. Inhibition kinetics of p53/hdm2 binding induced by Nutlin 3 on live cells. Reproducibility of the p53/hdm2 binding disruption kinetics induced by Nutlin 3
More informationTranscription Translation Of Hereditary
Transcription Translation Of Hereditary Instructions Into Specific Proteins Nucleus of the cell is the location of its hereditary instructions (DNA). Define the terms transcription and translation and
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationWhere Are The Protein-synthesizing Instructions Stored On A Dna Molecule
Where Are The Protein-synthesizing Instructions Stored On A Dna Molecule DNA contains all the information a cell needs in order to make certain proteins. Where are the protein-synthesizing instructions
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationOrthogonal Ribosome Biofirewall
1 2 3 4 5 Supporting Information Orthogonal Ribosome Biofirewall Bin Jia,, Hao Qi,, Bing-Zhi Li,, Shuo pan,, Duo Liu,, Hong Liu,, Yizhi Cai, and Ying-Jin Yuan*, 6 7 8 9 10 11 12 Key Laboratory of Systems
More informationSection 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein?
Section 10.3 Outline 10.3 How Is the Base Sequence of a Messenger RNA Molecule Translated into Protein? Messenger RNA Carries Information for Protein Synthesis from the DNA to Ribosomes Ribosomes Consist
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More information1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below.
1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below. A-G-T-A-C-C-G-A-T A-G-T-G-A-T This type of alteration of the genetic information is an
More informationSupplementary Figure S1. N-terminal fragments of LRRK1 bind to Grb2.
Myc- HA-Grb2 Mr(K) 105 IP HA 75 25 105 1-1163 1-595 - + - + - + 1164-1989 Blot Myc HA total lysate 75 25 Myc HA Supplementary Figure S1. N-terminal fragments of bind to Grb2. COS7 cells were cotransfected
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationColor-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationCHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
More informationControl of Eukaryotic Gene Expression (Learning Objectives)
Control of Eukaryotic Gene Expression (Learning Objectives) 1. Compare and contrast chromatin and chromosome: composition, proteins involved and level of packing. Explain the structure and function of
More informationIn vitro EGFP-CALI comprehensive analysis. Liang CAI. David Humphrey. Jessica Wilson. Ken Jacobson. Dept. of Cell and Developmental Biology
In vitro EGFP-CALI comprehensive analysis Liang CAI David Humphrey Jessica Wilson Ken Jacobson Dept. of Cell and Developmental Biology 1/15 Liang s Rotation in Ken s Lab, Sep-Nov, 2003 1. CALI background
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationCell cycle: Cell growth and division (when the replication and segregation of chromosomes occurs). Interphase: Interphase Chromosomes
Chromosomes exist in different states throughout the life of a cell Cell cycle: Cell growth and division (when the replication and segregation of chromosomes occurs). Interphase: Interphase Chromosomes
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature11172 a Aluminum ZMW Aluminum ZMW No fmet-(cy3)trna fmet fmet-(cy3)trna fmet 3S mrna 3S-Alexa488 mrna Biotin-PEG Biotin-PEG Glass Substrate Glass Substrate fmet-(cy3)trna fmet Alexa488-3S
More informationGrb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction
Journal of Alzheimer s Disease 20 (2010) 1 9 1 IOS Press Supplementary Material Grb2-Mediated Alteration in the Trafficking of AβPP: Insights from Grb2-AICD Interaction Mithu Raychaudhuri and Debashis
More informationCELL BIOLOGY: DNA. Generalized nucleotide structure: NUCLEOTIDES: Each nucleotide monomer is made up of three linked molecules:
BIOLOGY 12 CELL BIOLOGY: DNA NAME: IMPORTANT FACTS: Nucleic acids are organic compounds found in all living cells and viruses. Two classes of nucleic acids: 1. DNA = ; found in the nucleus only. 2. RNA
More informationConfocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationAssembling Protein Molecules
How Does Dna Provide Instructions For Assembling Protein Molecules What does the information in DNA molecules provide instructions for? A. Assembling B. Assembling protein molecules into amino acids. C.
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationVocab Word 1: Interphase
Vocab Word 1: Interphase Interphase is the phase of the cell cycle in which a typical cell spends most of its life. During this phase, the cell copies its DNA in preparation for mitosis. Interphase is
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Rodríguez-Fraticelli et al., http://www.jcb.org/cgi/content/full/jcb.201203075/dc1 Figure S1. Cell spreading and lumen formation in confined
More informationProteins and Protein Synthesis body structures, hormones, enzymes & antibodies amino acids sequence number DNA chemical code codon 'initiator'
Proteins and Protein Synthesis - Proteins : large complex molecules that make up body structures, hormones, enzymes & antibodies : are composed of subunits called amino acids : there are 20 different amino
More informationThe Chemistry of Genes
The Chemistry of Genes Adapted from Success in Science: Basic Biology Key Words Codon: Group of three bases on a strand of DNA Gene: Portion of DNA that contains the information needed to make a specific
More informationModule 6 Microbial Genetics. Chapter 8
Module 6 Microbial Genetics Chapter 8 Structure and function of the genetic material Genetics science of o Study of what genes are, how they determine the characteristics of an organism, how they carry
More informationSupplementary Figure 1, Wiel et al
Supplementary Figure 1, Wiel et al Supplementary Figure 1 ITPR2 increases in benign tumors and decreases in aggressive ones (a-b) According to the Oncomine database, expression of ITPR2 increases in renal
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More informationBIOLOGY 111. CHAPTER 6: DNA: The Molecule of Life
BIOLOGY 111 CHAPTER 6: DNA: The Molecule of Life Chromosomes and Inheritance Learning Outcomes 6.1 Describe the structure of the DNA molecule and how this structure allows for the storage of information,
More informationTranscription and Translation. DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences
Transcription and Translation DANILO V. ROGAYAN JR. Faculty, Department of Natural Sciences Protein Structure Made up of amino acids Polypeptide- string of amino acids 20 amino acids are arranged in different
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationMichal Reichman-Fried
Zebrafish Development and Genetics course 2013 Cell labeling and migration Imaging primordial germ cell migration Instructors: Erez Raz (erez.raz@uni-muenster.de) Michal Reichman-Fried (mreichm@uni-muenster.de)
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationQuantitative comparison of different fluorescent protein couples for fast FRET-FLIM acquisition
Biophysical Journal, Volume 97 Supporting Material Quantitative comparison of different fluorescent protein couples for fast FRET-FLIM acquisition Sergi Padilla, Nicolas Audugé, Hervé Lalucque, Jean Claude
More informationHowever, only a fraction of these genes are transcribed in an individual cell at any given time.
All cells in an organism contain the same set of genes. However, only a fraction of these genes are transcribed in an individual cell at any given time. It is the pattern of gene expression that determines
More informationGENES AND CHROMOSOMES V. Lecture 7. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 GENES AND CHROMOSOMES V Lecture 7 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University 2 CELL NUCLEUS AND THE CONTROL OF GENE EXPRESSION An Overview of Gene Regulation in Eukaryotes
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationGene disruption and construction of C-terminally tagged strains
Supplementary information Supplementary Methods Gene disruption and construction of C-terminally tagged strains A PCR-based gene targeting method (Bähler et al., 1998; Sato et al., 2005) was used for constructing
More informationMIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.
MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?
More informationStathmin-Tubulin Interaction Gradients in Motile and Mitotic Cells
Science Supporting Online Material Niethammer, p. 1 Stathmin-Tubulin Interaction Gradients in Motile and Mitotic Cells Contents Materials and Methods SOM Text Fig. S1 References Movie S1 Philipp Niethammer,
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationFigure legends for supplement
Figure legends for supplement Supplemental Figure 1 Characterization of purified and recombinant proteins Relevant fractions related the final stage of the purification protocol(bingham et al., 1998; Toba
More informationVocabulary: DNA (Deoxyribonucleic Acid) RNA (Ribonucleic Acid) Gene Mutation
STUDENTS WILL: Identify the parts of a DNA molecule and its structure. Explain how DNA copies itself. Describe the structure and function of each kind of RNA. Vocabulary: DNA (Deoxyribonucleic Acid) RNA
More informationSupplementary Protocol. sirna transfection methodology and performance
Supplementary Protocol sirna transfection methodology and performance sirna oligonucleotides, DNA construct and cell line. Chemically synthesized 21 nt RNA duplexes were obtained from Ambion Europe, Ltd.
More informationD e c N o. 2 8
D e c. 2 0 0 7 N o. 2 8 CONFOCAL APPLICATION LETTER resolution FRET Acceptor Photobleaching LAS AF Application Wizard FRET with Leica TCS SP5 LAS AF Version 1.7.0 Introduction Fluorescence Resonance Energy
More informationHuman Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only)
Human Anatomy & Physiology I Dr. Sullivan Unit IV Cellular Function Chapter 4, Chapter 27 (meiosis only) I. Protein Synthesis: creation of new proteins a. Much of the cellular machinery is devoted to synthesizing
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Prashar et al., http://www.jcb.org/cgi/content/full/jcb.201304095/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. FBT phagocytosis in cells expressing PM-GFP. (A) T-PC
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06147 SUPPLEMENTARY INFORMATION Figure S1 The genomic and domain structure of Dscam. The Dscam gene comprises 24 exons, encoding a signal peptide (SP), 10 IgSF domains, 6 fibronectin
More informationCell Nucleus. Chen Li. Department of Cellular and Genetic Medicine
Cell Nucleus Chen Li Department of Cellular and Genetic Medicine 13 223 chenli2008@fudan.edu.cn Outline A. Historical background B. Structure of the nucleus: nuclear pore complex (NPC), lamina, nucleolus,
More informationGenomes DNA Genes to Proteins. The human genome is a multi-volume instruction manual
Dr. Kathleen Hill Assistant Professor Department of Biology The University of Western Ontario khill22@uwo.ca Office Hours: Monday 1 to 5pm Room 333 Western Science Centre Research Website: http://www.uwo.ca/biology/faculty/hill/index.htm
More information