What does a protein need to work?

Transcription

1 Department of Physics, MIT What does a protein need to work? Leonid Mirny leonid@mit.edu

2 What does a protein need to work? 1. Stable structure 2. Specific active/binding sites.

3 What does a protein need to work? 1. Stable structure 2. Specific active/binding sites. 3. Somewhat unstable structure 4. Non-specific binding site

4 A simple DNA-binding protein Function 1. Find its site on DNA 2. Bind it tightly 3. IF [ligand]>0 leave the site ELSE goto step 1. END

5 A simple DNA-binding protein Function 1. Find its site on DNA 2. Bind it tightly 3. IF [ligand]>0 leave the site ELSE goto step 1. END

6 Problem 1: find cognate site among non-cognate sites

7 Experiment: Riggs et al 1970 WATER k on M 1 s 1 CELL t a ~ 1 10 sec Diffusion-limited association Theory: 1D diffusion ( sliding ) + 3D Richter and Eigen 1974, Berg, Winter, von Hippel 1981 t a ~ sec

8 Model: 1D+3D..CATGTTCAGGCACGTAGC... n τ 1d τ 3d t s search time M genome size

9 Model: 1D+3D..CATGTTCAGGCACGTAGC... n τ 3d τ 1d

10 Our model: 1D+3D..CATGTTCAGGCACGTAGC... Energy landscape of 1D sliding σ

11 Protein-DNA interaction energy l i=1 E = e(i,b i ) DNA DNA-binding domain Energy is strongly sequence dependent Energy landscape CATGTTTTATATCAGGCACATGCGGCAGTCA NO ENERGY GAP between cognate and random sites σ

12 Results Fast sliding requires smooth landscape σ D 1d ~ e 7 4 (σ /k B T)2 smooth rugged Roughness of the energy landscape

13 Results Specific recognition requires rough landscape FRACTION OF TIME SPENT ON THE COGNATE SITE σ smooth rugged Roughness of the energy landscape

14 Speed-stability paradox FRACTION OF TIME SPENT ON THE COGNATE SITE STABILITY: σ>5kt SPEED σ<2kt Either speed or stability but not both! Slutsky.M, Mirny,LA, Biophys J (2004)

15 Proposed Mechanism

16 Proposed Mechanism T SEARCH MODE RECOGNITION MODE

17 Experiments Experiment Kalodimos et.al Science.2004

18 Structure and animation by Babis Kalodimos et al

19 Landscape model ATCATGCATGCCAGTCAGCTCAG Reaction coordinate Reaction coordinate

20 Meso-scale dynamics of landscape model Log(t(x,z))

21 Macroscale dynamics 10 3 Total search time (sec) 10 2 Experimental folding rate Correlated landscapes 10 1 flat landscape model Folding time (sec)

22 Summary 1. 1D+3D search is fast if the protein-dna complex is FLEXIBLE. 2. Conformational transition in the DNA-binding protein controls the search time.

23 Function Somewhat unstable structure 1. Find its site on DNA 2. Bind it tightly 3. IF [ligand]>0 leave the site ELSE goto step 1. END is needed for

24 What does a protein need to work? 1. Stable structure 2. Specific active/binding sites. 3. Somewhat unstable structure 4. Non-specific binding site

25 What does a protein need to work? 1. Stable structure 2. Specific active/binding sites. 3. Somewhat unstable structure 4. Non-specific binding site

26 Model: 1D+3D..CATGTTCAGGCACGTAGC... τ 1d τ 3d

27 Model: 1D+3D..CATGTTCAGGCACGTAGC... Ε ns Energy landscape of 1D sliding σ

28 Results Fast sliding requires optimal non-specific binding Ε ns σ more jumping more sliding Free energy of non-specific binding

29 Non-specific binding is needed for Function 1. Find its site on DNA 2. Bind it tightly 3. IF [ligand]>0 leave the site ELSE goto step 1. END

30 Equilibrium M~ non-specific sites m~10 - number of LacI proteins per cell P = 1 1+ M m Fraction of time the site is bound K d s K d ns K d ns 10 6 M K d s,no LIGAND M K d s,ligand 10 9 M 1 P NO LIGAND = = P LIGAND = = 0.01

31 Non-specific binding is needed for Function 1. Find its site on DNA 2. Bind it tightly 3. IF [ligand]>0 leave the site ELSE goto step 1. END

32 Summary 1. 1D+3D search is fast if the protein-dna complex is FLEXIBLE. 2. Conformational transition in the DNA-binding protein controls the search time. 3. Non-specific binding is essential for protein function.

33 What does a protein need to work? 1. Stable structure 2. Specific active/binding sites. 3. Somewhat unstable structure 4. Non-specific binding site

34 Testable predictions 1. Diffusion of a protein on DNA is sequencedependent. 2. DNA sequences can influence - folded/unfolded equilibrium - rate of conf.transition in the protein (nucleate folding on the target site) 3. Mutations that change the stability and rate can have affect on the total search time and timing of gene expression.

35 Department of Physics, MIT Acknowledgements Michael Slutsky, MIT Physics