Fibrinogen and Factor XIII Prof. John W. Weisel
|
|
- Cory Francis
- 6 years ago
- Views:
Transcription
1 Fibrinogen and Factor XIII John W. Weisel Dept. of Cell & Developmental Biology University of Pennsylvania School of Medicine Philadelphia, PA USA The screen versions of these slides have full details of copyright and acknowledgements 1
2 4 5 6 The screen versions of these slides have full details of copyright and acknowledgements 2
3 Biosynthesis of fibrinogen Three fibrinogen genes located on chromosome 4 Aα chain - 5 exons; 1-2% αe extended chain Bβ chain - 8 exons; Transcribed opposite direction γ chain - 10 exons; 10-15% γ alternately spliced g liver synthesis/day; 3-5 day half life Single chain to two chain to three chain half molecules that dimerize Post-translational modifications The screen versions of these slides have full details of copyright and acknowledgements 3
4 10 Schematic model of complementary binding sites 11 Litvinov et al. Blood (2005) 106, Activation of factor XIII 12 The screen versions of these slides have full details of copyright and acknowledgements 4
5 13 Factor XIIIa stabilizes fibrin The carboxyl terminal ends of fibrin s γ chains are crosslinked more rapidly Multiple sites in the carboxyl terminal end of the α chains are crosslinked The screen versions of these slides have full details of copyright and acknowledgements 5
6 16 17 Weisel et al., PNAS 84, 8991, The screen versions of these slides have full details of copyright and acknowledgements 6
7 Weisel, Biophys. Chem. 112, 267, Weisel, Biophys. Chem. 112, 267, Weisel, Biophys. Chem. 112, 267, The screen versions of these slides have full details of copyright and acknowledgements 7
8 Fraction of each structure shown 22 Fibrin is a viscoelastic polymer Elastic material (e.g., superball): strain (deformation) proportional to stress (force/area) (Hooke s law) Viscous material (e.g., clay): stress proportional to the rate of strain (Newton s law) 23 The unique mechanical properties of fibrin arise even though the protein in a typical plasma clot (2.5 g/l fibrinogen) constitutes only 0.25% of the mass; 99.75% is liquid 24 The screen versions of these slides have full details of copyright and acknowledgements 8
9 Fibrin clot formation: turbidity curves 25 (Based on Roberts, et al., Biorheol. 10, 29, 1973) 26 (Roberts, et al., Biorheol. 10, 29, ) The screen versions of these slides have full details of copyright and acknowledgements 9
10 Binding of other proteins to fibrin(ogen) Albumin Fibronectin Thrombospondin Von Willebrand factor Fibulin Growth factors 28 Weisel, Biophys. Chem. 112, 267, Weisel, Adv. Prot. Chem. 70, 247, The screen versions of these slides have full details of copyright and acknowledgements 10
11 t-pa catalyzed plasminogen activation & fibrin clot lysis 31 Fragments from plasmin digestion of fibrin The screen versions of these slides have full details of copyright and acknowledgements 11
12 The screen versions of these slides have full details of copyright and acknowledgements 12
13 37 Transmission electron microscope images of rotary shadowed α IIb β 3 A B C D 38 Electron microscope images of fibrinogen-integrin complexes 39 The screen versions of these slides have full details of copyright and acknowledgements 13
14 40 Dysfibrinogenemias Single base mutation - single amino acid substitution, addition, deletion, or stop codon May be thrombotic, hemorrhagic or asymptomatic Some mutations may give rise to congenital hypo or afibrinogenemia Important for the insights that they give into fibrinogen functions 41 Fibrinogen variants More than a million non-identical forms in an individual AαThr312Ala; BβArg448Lys Carbohydrate Splice variants Serine phosphorylation Proline hydroxylation Tyrosine sulfation or nitration Asparagine or glutamine deamidation Glutamine cyclization Methionine oxidation Lysine glycation Proteolytic degradation 42 The screen versions of these slides have full details of copyright and acknowledgements 14
15 Evolution of fibrinogen Present in all vertebrates Three chains homologous, indicating that they evolved from a common ancestor Sequence comparisons imply that fibrinogen evolved before the divergence of vertebrates and invertebrates Fibrinogen-like sequences have been identified in invertebrates and in some other proteins The existence of these fibrinogen-like domains suggests that these specific and tightly controlled interactions may be used in other aspects of cell and developmental biology The screen versions of these slides have full details of copyright and acknowledgements 15
CHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
More informationBIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationThese handouts are only meant as a guide while you follow the presentation on the screen. Sometimes the speaker will change some of the slides.
These handouts are only meant as a guide while you follow the presentation on the screen. Sometimes the speaker will change some of the slides. If you would like the 1 slide per page handouts, please ask
More informationDNA is the genetic material. DNA structure. Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test
DNA is the genetic material Chapter 7: DNA Replication, Transcription & Translation; Mutations & Ames test Dr. Amy Rogers Bio 139 General Microbiology Hereditary information is carried by DNA Griffith/Avery
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationWhat is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed
RNA Section 3.1 What is RNA? Another type of nucleic acid A working copy of DNA Does not matter if it is damaged or destroyed Used to direct the production of proteins that determines an organisms characteristics
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationProtein Synthesis: Transcription and Translation
Review Protein Synthesis: Transcription and Translation Central Dogma of Molecular Biology Protein synthesis requires two steps: transcription and translation. DNA contains codes Three bases in DNA code
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationChapter 10: Gene Expression and Regulation
Chapter 10: Gene Expression and Regulation Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are the workhorses but contain no information THUS Information in DNA must
More informationBIOLOGY. Chapter 15 Genes & Proteins
BIOLOGY Chapter 15 Genes & Proteins CMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 17 Protein Synthesis 2014 Pearson Education, Inc. Fig. 17-1 Figure 17.1a n albino racoon Condition
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationYear III Pharm.D Dr. V. Chitra
Year III Pharm.D Dr. V. Chitra 1 Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Only one strand of DNA serves
More informationCreate a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function.
HASPI Medical Biology Lab 0 Purpose Create a model to simulate the process by which a protein is produced, and how a mutation can impact a protein s function. Background http://mssdbio.weebly.com/uploads/1//7/6/17618/970_orig.jpg
More informationEffect of Fibrinogen and Ca2+ on the Thrombin-Catalyzed Proteolytic Event That Triggers Activation of Factor XI11
Effect of Fibrinogen and Ca2+ on the Thrombin-Catalyzed Proteolytic Event That Triggers Activation of Factor XI11 JULES A. SHAFER,' SIDNEY D. LEWIS," TODD J. JAN US,^ AND LASZLO LOR AND^ 'Department of
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationDNA RNA PROTEIN SYNTHESIS -NOTES-
DNA RNA PROTEIN SYNTHESIS -NOTES- THE COMPONENTS AND STRUCTURE OF DNA DNA is made up of units called nucleotides. Nucleotides are made up of three basic components:, called deoxyribose in DNA In DNA, there
More informationChapter 8: DNA and RNA
Chapter 8: DNA and RNA Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 1 8-1 DNA and the Importance of Proteins Proteins play
More informationRNA and Protein Synthesis
Harriet Wilson, Lecture Notes Bio. Sci. 4 - Microbiology Sierra College RNA and Protein Synthesis Considerable evidence suggests that RNA molecules evolved prior to DNA molecules and proteins, and that
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationHigher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
More informationThe Transition to Life!
The Transition to Life The Transition to Life Chemical Evolution Biological Evolution? Interacting Chemical Reproduction of Organisms Natural Selection Based on Simplest Life Now: Need: 1. Nucleic Acids
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationThe common structure of a DNA nucleotide. Hewitt
GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided
More informationDNA and RNA. Chapter 12
DNA and RNA Chapter 12 Warm Up Exercise Test Corrections Make sure to indicate your new answer and provide an explanation for why this is the correct answer. Do this with a red pen in the margins of your
More informationProtein Synthesis. Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy
Protein Synthesis Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy STRUCTURE OF RNA RNA, adenine forms a base pair with
More informationNOTES Gene Expression ACP Biology, NNHS
Name Date Block NOTES Gene Expression ACP Biology, NNHS Model 1: Transcription the process of genes in DNA being copied into a messenger RNA 1. Where in the cell is DNA found? 2. Where in the cell does
More informationCS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS
1 CS 4491/CS 7990 SPECIAL TOPICS IN BIOINFORMATICS * Some contents are adapted from Dr. Jean Gao at UT Arlington Mingon Kang, PhD Computer Science, Kennesaw State University 2 Genetics The discovery of
More informationProtein Synthesis
HEBISD Student Expectations: Identify that RNA Is a nucleic acid with a single strand of nucleotides Contains the 5-carbon sugar ribose Contains the nitrogen bases A, G, C and U instead of T. The U is
More informationName: Class: Date: ID: A
Class: _ Date: _ CH 12 Review Multiple Choice Identify the choice that best completes the statement or answers the question. 1. How many codons are needed to specify three amino acids? a. 6 c. 3 b. 12
More informationDivision Ave. High School AP Biology
Control of Eukaryotic Genes 2007-2008 The BIG Questions n How are genes turned on & off in eukaryotes? n How do cells with the same genes differentiate to perform completely different, specialized functions?
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationBIOLOGY. Chapter 16 GenesExpression
BIOLOGY Chapter 16 GenesExpression CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 18 Gene Expression 2014 Pearson Education, Inc. Figure 16.1 Differential Gene Expression results
More informationSTRUCTURAL BIOLOGY. α/β structures Closed barrels Open twisted sheets Horseshoe folds
STRUCTURAL BIOLOGY α/β structures Closed barrels Open twisted sheets Horseshoe folds The α/β domains Most frequent domain structures are α/β domains: A central parallel or mixed β sheet Surrounded by α
More informationComparing RNA and DNA
RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. 1 st step in decoding these genetic instructions = copy part of the base sequence from DNA into RNA. 2 nd
More informationTranscription and Translation
Biology Name: Morales Date: Period: Transcription and Translation Directions: Read the following and answer the questions in complete sentences. DNA is the molecule of heredity it determines an organism
More informationKey Concept Translation converts an mrna message into a polypeptide, or protein.
8.5 Translation VOBLRY translation codon stop codon start codon anticodon Key oncept Translation converts an mrn message into a polypeptide, or protein. MIN IDES mino acids are coded by mrn base sequences.
More informationStudent Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13
http://www.explorelearning.com Name: Period : Student Exploration: RNA and Protein Synthesis Due Wednesday 11/27/13 Vocabulary: Define these terms in complete sentences on a separate piece of paper: amino
More informationDNA & PROTEIN SYNTHESIS REVIEW
Name: Block: DNA & PROTEIN SYNTHESIS REVIEW 1. Give the purpose of each of the following steps in the process of protein synthesis. a) Ribosome moving along a mrna: (1 mark) b) Adenine bonding to thymine:
More informationNeurospora mutants. Beadle & Tatum: Neurospora molds. Mutant A: Mutant B: HOW? Neurospora mutants
Chapter 10: Central Dogma Gene Expression and Regulation Mutant A: Neurospora mutants Mutant B: Not made Not made Fact 1: DNA contains information but is unable to carry out actions Fact 2: Proteins are
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationTHE GENETIC CODE Figure 1: The genetic code showing the codons and their respective amino acids
THE GENETIC CODE As DNA is a genetic material, it carries genetic information from cell to cell and from generation to generation. There are only four bases in DNA and twenty amino acids in protein, so
More informationChapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics
Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationEnzymes Part III: regulation I. Dr. Mamoun Ahram Summer, 2017
Enzymes Part III: regulation I Dr. Mamoun Ahram Summer, 2017 Mechanisms of regulation Expression of isoenzymes Regulation of enzymatic activity Inhibitors Conformational changes Allostery Modulators Reversible
More informationBio11 Announcements. Ch 21: DNA Biology and Technology. DNA Functions. DNA and RNA Structure. How do DNA and RNA differ? What are genes?
Bio11 Announcements TODAY Genetics (review) and quiz (CP #4) Structure and function of DNA Extra credit due today Next week in lab: Case study presentations Following week: Lab Quiz 2 Ch 21: DNA Biology
More informationGENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s
GENE REGULATION slide shows by Kim Foglia modified Slides with blue edges are Kim s 2007-2008 Bacterial metabolism Bacteria need to respond quickly to changes in their environment STOP GO if they have
More informationBio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More information36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L-
36. The double bonds in naturally-occuring fatty acids are usually isomers. A. cis B. trans C. both cis and trans D. D- E. L- 37. The essential fatty acids are A. palmitic acid B. linoleic acid C. linolenic
More informationProtein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationDNA Begins the Process
Biology I D N A DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used to build cells and do much of the work inside cells DNA Begins the Process
More informationdisaccharides = two mono-s linked together e.g. lactose = glucose + galactose sucrose = glucose + fructose
involved in the degradation of molecules found in animal cells membrane limited varies in shape and size contains acid hydrolases (phosphatase, nucleases, proteases, etc.), enzymes that work only at acid
More informationJust one nucleotide! Exploring the effects of random single nucleotide mutations
Dr. Beatriz Gonzalez In-Class Worksheet Name: Learning Objectives: Just one nucleotide! Exploring the effects of random single nucleotide mutations Given a coding DNA sequence, determine the mrna Based
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationNot all mutations result in a change to the amino acid sequence of the encoded polypeptide
Q1.(a) (i) A mutation of a tumour suppressor gene can result in the formation of a tumour. Explain how. (2) (ii) Not all mutations result in a change to the amino acid sequence of the encoded polypeptide.
More informationAP2013-DNAPacket-II. Use the list of choices below for the following questions:
Class: Date: AP2013-DNAPacket-II Multiple Choice Identify the choice that best completes the statement or answers the question. Use the list of choices below for the following questions: I. helicase II.
More informationMolecular Genetics. Before You Read. Read to Learn
12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase
More informationHelps DNA put genetic code into action RNA Structure
13.1 RNA Helps DNA put genetic code into action RNA Structure Single Stranded Nucleotides building blocks to RNA Ribose (5C sugar) Phosphate Group Nitrogenous base: Adenine, Uracil Guanine, Cytosine Disposable
More informationReview? - What are the four macromolecules?
Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands
More informationChapter 18: Regulation of Gene Expression. 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer
Chapter 18: Regulation of Gene Expression 1. Gene Regulation in Bacteria 2. Gene Regulation in Eukaryotes 3. Gene Regulation & Cancer Gene Regulation Gene regulation refers to all aspects of controlling
More informationNucleic acids and protein synthesis
THE FUNCTIONS OF DNA Nucleic acids and protein synthesis The full name of DNA is deoxyribonucleic acid. Every nucleotide has the same sugar molecule and phosphate group, but each nucleotide contains one
More informationSolutions to Quiz II
MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1
More information11 questions for a total of 120 points
Your Name: BYS 201, Final Exam, May 3, 2010 11 questions for a total of 120 points 1. 25 points Take a close look at these tables of amino acids. Some of them are hydrophilic, some hydrophobic, some positive
More informationInformation Readout: Transcription and Post-transcriptional Processing Translation
Information Readout: Transcription and Post-transcriptional Processing Translation Copyright 2013 Pearson Canada Inc. 27-1 DNA as the Template for RNA Synthesis Enzymology of RNA Synthesis: RNA Polymerase
More informationChapter 13. The Nucleus. The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus".
Chapter 13 The Nucleus The nucleus is the hallmark of eukaryotic cells; the very term eukaryotic means having a "true nucleus". Fig.13.1. The EM of the Nucleus of a Eukaryotic Cell 13.1. The Nuclear Envelope
More informationBasic coagulation applications and case studies
Basic coagulation applications and case studies Jing Jin Clinical laboratory Scientist (MLS, ASCP) - Coagulation/Hematology Stanford University Hospital and Clinics 1 Agenda Overview about 3 major phases
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationNucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationBLOOD COAGULATION. 1. The initial phase of the process is vascular constriction. This limits the flow of blood to the area of injury.
BLOOD COAGULATION The ability of the body to control the flow of blood following vascular injury is paramount to continued survival. The process of blood clotting and then the subsequent dissolution of
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationSite Directed Mutagenesis and Protein Engineering:
Site Directed Mutagenesis and Protein Engineering: Mutants are essential prerequisite for any genetic study in relation to study of gene structure and function Classically, mutants are generated by treating
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More information13.1 RNA. Lesson Objectives. Lesson Summary
13.1 RNA Lesson Objectives Contrast RNA and DNA. Explain the process of transcription. Lesson Summary The Role of RNA RNA (ribonucleic acid) is a nucleic acid like DNA. It consists of a long chain of nucleotides.
More informationMCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
More informationFrom Gene to Protein. Chapter 17. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationPauling/Itano Experiment
Chapter 12 Pauling/Itano Experiment Linus Pauling and Harvey Itano knew that hemoglobin, a molecule in red blood cells, contained an electrical charge. They wanted to see if the hemoglobin in normal RBC
More informationName 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication.
Name 10 Molecular Biology of the Gene Test Date Study Guide You must know: The structure of DNA. The major steps to replication. The difference between replication, transcription, and translation. How
More informationWhat happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!
What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as
More informationHASPI Medical Biology Lab 02 Background/Introduction
HASPI Medical Biology Lab 02 Background/Introduction Before humans even knew of the existence of DNA, they recognized that certain traits were inherited. Through observation they saw that plants and animals
More informationDifferential Gene Expression
Biology 4361 Developmental Biology Differential Gene Expression June 19, 2008 Differential Gene Expression Overview Chromatin structure Gene anatomy RNA processing and protein production Initiating transcription:
More informationProtein Synthesis. Application Based Questions
Protein Synthesis Application Based Questions MRNA Triplet Codons Note: Logic behind the single letter abbreviations can be found at: http://www.biology.arizona.edu/biochemistry/problem_sets/aa/dayhoff.html
More informationChapter 3 Nucleic Acids, Proteins, and Enzymes
3 Nucleic Acids, Proteins, and Enzymes Chapter 3 Nucleic Acids, Proteins, and Enzymes Key Concepts 3.1 Nucleic Acids Are Informational Macromolecules 3.2 Proteins Are Polymers with Important Structural
More informationT and B cell gene rearrangement October 17, Ram Savan
T and B cell gene rearrangement October 17, 2016 Ram Savan savanram@uw.edu 441 Lecture #9 Slide 1 of 28 Three lectures on antigen receptors Part 1 (Last Friday): Structural features of the BCR and TCR
More informationChromosomes. Chromosomes. Genes. Strands of DNA that contain all of the genes an organism needs to survive and reproduce
Chromosomes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Genes Segments of DNA that specify how to build a protein genes may specify more than one
More informationSelf-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype)
Self-test Quiz for Chapter 12 (From DNA to Protein: Genotype to Phenotype) Question#1: One-Gene, One-Polypeptide The figure below shows the results of feeding trials with one auxotroph strain of Neurospora
More informationBiology: The substrate of bioinformatics
Bi01_1 Unit 01: Biology: The substrate of bioinformatics What is Bioinformatics? Bi01_2 handling of information related to living organisms understood on the basis of molecular biology Nature does it.
More informationRNA and PROTEIN SYNTHESIS. Chapter 13
RNA and PROTEIN SYNTHESIS Chapter 13 DNA Double stranded Thymine Sugar is RNA Single stranded Uracil Sugar is Ribose Deoxyribose Types of RNA 1. Messenger RNA (mrna) Carries copies of instructions from
More informationRapid Learning Center Presents. Teach Yourself AP Biology in 24 Hours
Rapid Learning Center Chemistry :: Biology :: Physics :: Math Rapid Learning Center Presents Teach Yourself AP Biology in 24 Hours 1/35 *AP is a registered trademark of the College Board, which does not
More informationCHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES
CHAPTER 18 LECTURE NOTES: CONTROL OF GENE EXPRESSION PART B: CONTROL IN EUKARYOTES I. Introduction A. No operon structures in eukaryotes B. Regulation of gene expression is frequently tissue specific.
More informationAdv Biology: DNA and RNA Study Guide
Adv Biology: DNA and RNA Study Guide Chapter 12 Vocabulary -Notes What experiments led up to the discovery of DNA being the hereditary material? o The discovery that DNA is the genetic code involved many
More information