Tissue Culture 1 Cell/ Microplates 2 HTS- 3 Immunology/ HLA 4 Microbiology/ Bacteriology Purpose Beakers 5 Tubes/Multi-

Size: px
Start display at page:

Download "Tissue Culture 1 Cell/ Microplates 2 HTS- 3 Immunology/ HLA 4 Microbiology/ Bacteriology Purpose Beakers 5 Tubes/Multi-"

Transcription

1 3 Reaction Tubes/ 2 Lids/Sealers/ Cryo- 0 Biochips/ 4 Accessories Cell/

2 0 Biochips / Biochips Technical Information 0 I 2 HTA TM Platforms 0 I 4 HTA TM Slides 0 I 4 HTA TM Plate 0 I 6 HTA TM Buffer Systems 0 I 7 CheckScanner TM 0 I 8 CheckReport TM Software 0 I 8 Diagnostic Kits 0 I 9 PapilloCheck 0 I 9 PelvoCheck 0 l 9 ParoCheck 0 I 0 CarnoCheck 0 I 0 Mycoplasma Detection Kit 0 I CytoCheck 0 I Customised Microfluidic Platforms 0 I 2 3 Reaction Tubes/ 2 Lids/Sealers/ Cryo- Cell/ 0 Biochips/ 4 Accessories

3 HTA TM High-Throughput microarraying Introduction The complete deciphering of the human genome and the rapidly growing number of completely sequenced animal, plant and microbial genomes open up new investigative possibilities and techniques. Complex functional analyses, mutation detection or genotyping can be performed within a few hours with the aid of microarrays or biochips. Greiner Bio-One develops and produces high-quality biochips for human diagnostics, consumer protection and quality control in the pharmaceutical industry. Our expertise encompasses the development and production of our own innovative biochip platforms for the parallel analysis of samples, the selection of probes, the validation and production of biochips as well as their certification as In-Vitro Diagnostic Devices according to the European Guideline 98/79/EC. Cell/ The following low-autofluorescence HTA TM Platforms are available: HTA TM Slide: slide with even surface 0 Biochips/ Cryo- 2 Lids/Sealers/ 3 Reaction Tubes/ HTA TM Platforms In academic research with high-density microarrays, some samples are investigated for thousands of parameters whilst compared to diagnostics thousands of samples are analysed for a few expressive markers. Therefore parallel comparison and automation play a decisive role. In order to take this into account, Greiner Bio-One has developed new HTS platforms made from especially for use in biochip technology the HTA TM Platforms (High-Throughput microarraying).! All HTA TM Platforms are barcode-labelled on request. HTA TM Slide2: slide with 2 wells HTA TM Plate: plate with 96 wells 4 Accessories 0 2

4 Cell/ HTA TM Surfaces up to 0 nm 0 High stability of the function-defining layer: Long shelf life High chemical / mechanical robustness Beside the multifunctional surface, Greiner Bio-One offers a proprietary 3-D chemistry, which achieves an excellent binding of molecules to the surface via ionic and covalent reaction pathways. The contact angle is about 4. The advantages of the 3-D matrix include high sensitivity and a chemical and mechanical robustness that permits using contact as well as contact-free printing systems. A large variety of user-specific applications can be covered with the help of the surfaces offered by Greiner Bio-One. The overview below can serve as an orientation aid for different microarray applications. Reactive, specific functionality Unreactive moiety results in very low non-specific binding Spacer Substrate Exact material design through fine tuning of: Substrate Morphology Chemical functions Porous, swellable 3-dimensional functional matrix The high quality of the HTA TM 3-D technology ensures an outstandingly uniform spot morphology and avoids variable background fluorescence which can arise due to unspecific binding. The reproducibility and reliability of the analysis results within an array and between arrays represent an important feature of the HTA TM technology, which saves sample material, time and money. In addition, Greiner Bio-One can fulfil customer wishes for 3-D surfaces with different contact angles, thanks to the flexible production procedure (minimum order size required). Surface Application multifunctional (MF) 3-D Amino (AM) 3-D Aldehyde (AL) 3-D Epoxy (EP) ++ most suitable + suitable o not recommended oligonucleotides PCR fragments modified oligonucleotides + o proteins peptides Reaction Tubes/ 2 Lids/Sealers/ Cryo- 0 Biochips/ 4 Accessories 0 3

5 Cell/ HTA TM Platforms HTA TM Platforms HTA TM Slides 446 8XX 44 8XX HTA TM Slides Multifunctional 3-D Amino 3-D Aldehyde 3-D Epoxy HTA TM Slide2: 36 mm 2 printable area/well HTA TM Slide2: Low well rim of only 0. mm Low autofluorescence Barcode-labelling on request HTA TM Slide The slide HTA TM Slide has the dimensions of a standard 2 x 7 mm glass slide and can be used for the processing of one sample (Fig. ). HTA TM Slide2 The HTA TM Slide2 is also a slide and has the same dimensions as the HTA TM Slide but is partitioned into 2 flat compartments, each with a printable surface of 6 x 6 mm and a low well rim of only 0. mm (Fig. 2). 2 samples can be processed simultaneously. Therefore the HTA TM Slide2 is able to combine the advantages of the universal microplate platform with microarrays for diagnostic applications due to an identical well geometry compared with a standard 96 well microplate. Figure : Slide geometry of HTA TM Slide A = 7 +/- 0.2 mm B = 2 +/- 0. mm C =.0 +/- 0.0 mm D = 8. mm H = Flatness < 0.0 mm A = 7 +/- 0.2 mm B = 2 +/- 0. mm C =.0 +/- 0.0 mm D = 0. mm E/F = 9 +/ mm G = 3.0 mm H = Flatness < 0.0 mm 0 Biochips/ Free of detectable DNase, RNase Figure 2: Slide geometry of HTA TM Slide2 Cryo HTA TM Slide HTA TM Slide2 HTA TM Slide HTA TM Slide HTA TM Slide2 2 Lids/Sealers/ Surface functionalisation Tests per slide Slide material multifunctional multifunctional 2 3-D Amino 3-D Amino 3-D Amino 2 3 Reaction Tubes/ Slides per case Accessories 0 4

6 HTA TM Platforms Cell/ Surface functionalisation HTA TM Slide 3-D Aldehyde HTA TM Slide 3-D Aldehyde HTA TM Slide2 3-D Aldehyde Tests per slide 2 Slide material Slides per case HTA TM Slide HTA TM Slide HTA TM Slide2 Surface functionalisation Tests per slide 3-D Epoxy 3-D Epoxy 3-D Epoxy 2 Slide material Slides per case 2 3 Reaction Tubes/ 2 Lids/Sealers/ Cryo- 0 Biochips/ Accessories

7 Cell/ HTA TM Platforms HTA TM Plate HTA TM Plate Multifunctional 79 8XX 3-D Amino 3-D Aldehyde 3-D Epoxy With 96 shallow wells and a low well rim of only 0.3 mm, the HTA TM Plate has been optimised for the simultaneous analysis of multiple samples. The low height of the rims facilitates both quick and cost-effective printing of a wide range of analytes into the 96 wells of the plate. Additionally modern robotic spotters and arrayers are already equipped to handle this 96 well format. The partition of the plate into 4 individual strips containing 24 wells each gives the user a high degree of flexibility permitting processing of a variable number of samples each day. For processing, a removable wash collar allows a temporary increase in volume for hybridisation and washing procedures, and is removed prior to detection. The dimensions of the HTA TM Plate are compatible with automated systems. 96 elevated wells/ stages with a printable area of 36 mm 2 each 4 individual strips with 24 wells each 3 Low autofluorescence Low well rim of only 0.3 mm Barcode-labelling on request 2 Figure 3: Schematic structure of the HTA TM Plate: () frame, (2) 24 well strip, (3) 24 well wash collar A = 8. mm B = 26.9 mm C = 6.4 mm D = 9.0 mm 0 Biochips/ Figure 4: Geometry of a HTA TM Plate strip with 24 wells Cryo- Free of detectable DNase, RNase 2 Lids/Sealers/ Surface functionalisation HTA TM Plate multifunctional HTA TM Plate 3-D Amino HTA TM Plate 3-D Aldehyde HTA TM Plate 3-D Epoxy 3 Reaction Tubes/ Tests per plate Material Quantity per bag/case Accessories 0 6

8 HTA TM Platforms Cell/ HTA TM Buffer Systems HTA TM Buffer Systems 44 0 Complete and integrated systems for DNA and protein applications Optimised buffer systems for each HTA surface modification Ultra-pure reagents Purified by sterile filtration Premixed Minimised array-to-array variation Expedited data analysis Greiner Bio-One and SCIENION have developed integrated and complete systems for the production and use of DNA- and protein microarrays on the HTA Platform.! Detailed protocols for each application are available on Buffer systems for DNA-microarrays Optimised buffers for each of the three surface modifications are available guaranteeing optimal conditions for spotting and processing: scispot-mf and sciprocess-mf for spotting on multifunctional surfaces scispot-am and sciprocess-am for spotting on 3-D Amino surfaces scispot-al and sciprocess-al for spotting on 3-D Aldehyde surfaces The hybridisation buffer scihyb creates the most favourable environment for hybridisation, while minimising cross-hybridisation. The washing buffers sciwash I III reduce the background and deliver a high level of reproducibility. Buffer systems for protein microarrays scispot-protein is a unique spotting solution which facilitates a uniform binding of proteins, antibodies and peptides to HTA Slides. sciblock buffer removes unbound proteins after spotting and blocks the HTA surfaces during incubation. scibind buffer creates the most favourable environment for binding reactions. Finally, sciwash-protein buffer is a microarray wash buffer which is formulated to promote specific binding and to reduce background signals scispot-mf scispot-am scispot-al sciprocess-mf sciprocess-am sciprocess-al Concentration Volume [ml] Quantity per case scihyb 44 0 sciwash I sciwash II sciwash III 0 Biochips/ Concentration x x x x Volume [ml] Quantity per case Cryo scispot-protein sciblock scibind 44 0 sciwash-protein 2 Lids/Sealers/ Concentration Volume [ml] Quantity per case 2 x x 00 3 Reaction Tubes/ Accessories

9 CheckScanner TM Cell/ CheckScanner TM and CheckReport TM Software CheckScanner TM CheckReport TM Software CheckScanner and CheckReport Software The CheckScanner is a PC-controlled biochip fluorescence scanner for the laboratory use in combination with the CheckReport Software. It is designed to scan with high performance ready-to-use microarrays in HTA Slides manufactured by Greiner Bio-One. The coordinated parallel development of compatible scanner and software permits the fully automated detection and analysis of up to 4 HTA Slides (Fig. ). Through the use of innovative control systems on the individual diagnostic kits from Greiner Bio-One, which are monitored by the CheckReport Software during the evaluation, false negative or false positive results are virtually excluded. The CheckReport Software is now (from version 4.0) available for two different applications: The established CheckReport Software Basic Version has been developed on the basis of several international standards including DIN EN ISO 348. The new CheckReport Software US Basic Version has been designed to allow FDA compliance in accordance with the terms of the Code of Federal Regulations 2 CFR Part : Electronic Records. Both are composed of three subsystems: CheckReport SampleSheet: This unequivocally links patient data with an individual barcode on each biochip. CheckReport Result: The module is based on the successful GeneSpotter software from MicroDiscovery and contains the actual evaluation. CheckReport Admin: This module controls the user management and prevents the misuse or manipulation of data.! : An integrated software interface allows the integration with different Laboratory-Information- Management-Systems (LIMS). The combination of CheckReport Software with the CheckReport Software Plug-Ins PapilloCheck, PelvoCheck, ParoCheck, CarnoCheck and CytoCheck allows the safe, user-friendly and automatic evaluation of the data. 0 Biochips/ Figure : Fully automated analysis of 4 HTA TM Slides in a CheckScanner TM Cryo CheckScanner CheckReport Software CheckReport Software Basic Version US Basic Version 2 Lids/Sealers/ Quantity per case Reaction Tubes/ Quantity per case CheckReport Software Plug-In PapilloCheck CheckReport Software Plug-In PelvoCheck CheckReport Software Plug-In ParoCheck CheckReport Software Plug-In CarnoCheck CheckReport Software Plug-In CytoCheck 4 Accessories PapilloCheck, PelvoCheck, ParoCheck, CarnoCheck and CytoCheck are part of the ocheck product line from Greiner Bio-One GmbH 0 8

10 Diagnostic Kits Diagnostic Kits Cell/ PapilloCheck PelvoCheck All of the Greiner Bio-One ready-to-use kits consist of complete test systems with all the necessary buffers and solutions. Extensive on-chip controls ensure error-free results. PapilloCheck High-risk types of human papilloma viruses (HPV) are causative agents in the occurrence of cervical cancer. The PapilloCheck CE-IVD diagnostic kit is intended to be used for the qualitative detection and genotyping of 24 types (8 highrisk and 6 low-risk types) of the human papilloma virus in DNA preparations from human cervical smears. The assay is based on the detection of a fragment of the E gene of the human papilloma virus and allows the simultaneous processing of 2 cervical specimens. Prior to the application of the PapilloCheck diagnostic kit, DNA has to be extracted from a cervical smear specimen previously collected from the patient using the PapilloCheck Collection Kit. After the following amplification of a 30 bp fragment of the E gene via polymerase chain reaction (PCR) the fluorescence-labelled amplification products are hybridised to specific DNA probes fixed on the PapilloCheck chip. Due to the fluorescence signal the presence of HPV DNA is visualised by the CheckScanner TM and analysed by the corresponding CheckReport TM Software. Nearly error-free results are guaranteed due to the integration of controls for the quality of the DNA extraction, PCR, spot homogeneity and the hybridisation efficiency. In addition, the integration of dutp in the PapilloCheck MasterMix ensures the elimination of carry-over contaminations from previous PCR reactions. PelvoCheck Pelvic inflammmatory diseases (PID) are mostly associated with sexually transmitted bacteria causing millions of new infections worldwide per year. Unidentified infections may lead to dramatic symptoms including complications during pregnancy, blindness of the newborn and infertility. The newly developed diagnostic kit enables the identification of the six most frequently detected bacteria associated with sexually transmitted diseases (Chlamydia trachomatis, Neisseria gonorrhoeae, Treponema pallidum, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum). Both cervical and pooled urine samples can be analysed. The test is based on the detection of a specific DNA fragment of the 6S rrna Gene using polymerase chain reaction (PCR). The integration of dutp in the PelvoCheck MasterMix ensures the elimination of carry-over contaminations from previous PCR reactions. The scanning procedure, data evaluation and report generation are performed using CheckScanner TM and CheckReport TM Software. 0 Biochips/ s Cryo- Tests per case PapilloCheck (CE-IVD) identification of 24 human papilloma viruses PapilloCheck Collection Kit 0 PapilloCheck and PelvoCheck are part of the ocheck product line from Greiner Bio-One GmbH * ) PelvoCheck (CE-IVD) identification of 6 bacteria associated with sexually transmitted diseases 60 * ) available Lids/Sealers/ 3 Reaction Tubes/ 4 Accessories

11 Cell/ Diagnostic Kits ParoCheck CarnoCheck All of the Greiner Bio-One ready-to-use kits consist of complete test systems with all the necessary buffers and solutions. Extensive on-chip controls ensure error-free results. ParoCheck Inflammation of the gum and the paradontium are among the most frequent human diseases. Certain bacterial species can serve as indicators to detect such changes early and thus successful treatment is possible. ParoCheck is approved as an In-vitro Diagnostic (IVD) which can detect up to 20 different characteristic indicative pathogens. CarnoCheck Consumer protection and quality assurance play an increasing role in public awareness, especially in the production of food. Greiner Bio-One has taken into account this need for transparency with the development of the ready-to-use kit CarnoCheck. With this biochip 8 different animal species (donkey, chicken, horse, turkey, cow, sheep, pig, goat) can be unequivocally identified in food or other products. For further information, please visit our website ParoCheck ParoCheck CarnoCheck (CE-IVD) (CE-IVD) identification of 8 Tests per case identification of 0 periodontal pathogens 0 identification of 20 periodontal pathogens 0 animal species 60 3 Reaction Tubes/ 2 Lids/Sealers/ Cryo- 0 Biochips/ 4 Accessories ParoCheck and CarnoCheck are part of the ocheck product line from Greiner Bio-One GmbH 0 0

12 Mycoplasma Detection Kit Mycoplasma Detection Kit Cell/ CytoCheck CytoCheck In the biopharmaceutical industry, cell cultures are being used increasingly for the manufacture of therapeutic products. Mycoplasma contamination of these cell cultures is a serious problem, as it potentially compromises the safety of the drugs being produced and reduces the final yield. CytoCheck is a premium test kit for the identification of mycoplasma species in cell cultures and other biological materials. It has been validated in accordance with the guidelines of the European Pharmacopoeia (Ph. Eur , 2.6.2). CytoCheck detects mycoplasma species with a universal mycoplasma probe (including Acholeplasma sp., Spiroplasma sp. and Ureaplasma sp.) and identifies 40 individual species using species-specific probes which can then be used to track the source of contamination. DNA is extracted from the sample and then PCR is performed on the extracted material. The PCR primers amplify conserved and species-specific portions of the 6S- 23S rrna intergenic transcribed spacer of mycoplasma DNA. Implementation of dutp prevents carry-over of PCR products, which could become a subsequent source of contamination. The fluorescently labelled amplified DNA fragments are then hybridised to the microarray chip. The chip contains probes for both speciesspecific targets and a universal probe that detects any species of mycoplasma present in the original sample. Finally, detection of any bound PCR products is achieved with a microarray scanner. The CytoCheck DNA-chip has a total of 22 individual measurement points which are used by the CheckScanner TM instrument and subsequently the analysis software, the CheckReport TM Software. The integrated platform allows automatic sample tracking, rapid report generation and digital data management (Fig. 6). The CheckReport TM Software was especially designed for 2 CFR part conformity to allow FDA compliance of the test procedure. The test can be processed within only hours and sensitivity and specificity are comparable to the cell culture and indicator cell culture methods. CytoCheck is offered as a complete ready-to-use kit and includes the CytoCheck DNA-chips, the PCR MasterMix, buffers and a detailed instruction manual. 0 Biochips/ Figure 6: The CheckReport TM Software automatically generates a report showing the result of the 40 species-specific probes as well as the universal probe Cryo- Tests per case CytoCheck identification of mycoplasma species 0 2 Lids/Sealers/ 3 Reaction Tubes/ CytoCheck is part of the ocheck product line from Greiner Bio-One GmbH Accessories

13 The finest structures for the finest ideas Discover the potential of microfluidics Through the use of modern manufacturing techniques it is now possible to produce microstructured components for the diagnostics, drug discovery, and research industry made from innovative polymer materials. They offer substantial economical advantages, a large selection of quite diverse materials and surface treatments are available, and large format components can also be economically structured. The principal application areas are: Analytics/Diagnostics (electrophoresis, lab-on-a-chip) Chemistry (micromixers, reactors, heat exchangers) Drug discovery and liquid handling For the production of microfluidic systems as single-use products, novel and innovative manufacturing techniques are required. A number of manufacturing processes can be utilised and today injection moulding is widely used to produce microstructured parts from s. The choice of material depends on the final application of the components. Common selection criteria are: Transparency Stability Chemical resistance Biocompatibility Surface properties (e.g. hydrophobicity) A large number of different polymers are available (e.g. polystyrene, polymethylmethacrylate, polycarbonate, polypropylene). Additional surface treatments after moulding can further improve the properties of the chosen material, and compared to glass, a larger variety of options for surface modifications are available. 3 Reaction Tubes/ 2 Lids/Sealers/ Cryo- 0 Biochips/ 4 Accessories Cell/ 0 2

14 Figure : Production of microstructured parts by injection moulding. Precise manufacturing of the mould insert is critical for the quality of the component. Different methods are used depending on the structural size, precision and aspect ratio of the structure being moulded. Routinely, mechanical micromachining is used to create the required metal moulding tools. Using high-speed tools, microstructures can be produced even on large areas. For extremely precise mould inserts, galvanic/lithographic techniques are available. 2a) 2b) Figure 2a: Mould insert made of brass, manufactured by micro-milling. Figure 2b: Detail of a mould insert made of nickel, manufactured by UV-LIGA. Standard formats allow for fast and cost-efficient production of customer-specific designs from prototyping to production level. A common format in the life science is the microscope slide with a footprint of 2 mm x 7 mm. Greiner Bio-One can produce microstructured components in a variety of shapes and dimensions and also larger formats, such as the microplate format, can be structured. In many cases, the microstructured surface must be sealed with a lid in order to produce a closed channel system. Different joining methods, such as laser welding, ultrasonic welding, adhesive techniques and diffusion bonding are used. The incorporation of additional components such as electrodes or membranes into the microstructured part is also possible. To combine different materials, we have special welding and adhesive bonding techniques that have been adapted for microstructures. 4a) 4b) Reservoir Figure 4a: Partly sealed structures for capillary electrophoresis. Figure 4b: SEM image of the cross section through a closed microchannel (00 µm x 0 µm).! Our service With our team of biologists, chemists, physicists, and engineers, we work closely with our customers. Built on our experience in s manufacturing, we can supply an innovative solution, custom-tailored to your requirements. A large variety of materials is available to realise your design, in addition to which we offer several modification technologies to tailor the surface properties of your microstructured component to optimise it for your application. We offer our services from the first draft to the product: Prototyping Small series production Mass production Microchannel Intersection 000 µm Cryo- Cell/ 0 Biochips/ Figure 3: Microfluidic Slide. Microchannels and macro-features (reservoirs, through-holes) were produced in one step. 2 Lids/Sealers/ 3 Reaction Tubes/ Accessories

CarnoCheck : Your Power for Health. Simultaneous identification of 8 animal species in food products. Laboratory Information

CarnoCheck : Your Power for Health. Simultaneous identification of 8 animal species in food products. Laboratory Information Your Power for Health Laboratory Information Food DNA-Chip : Simultaneous identification of 8 animal species in food products. is part of the ocheck product line from Greiner Bio-One GmbH www.gbo.com/bioscience

More information

Instruction Manual for DNA-Microarrays

Instruction Manual for DNA-Microarrays Instruction Manual for DNA-Microarrays 3-D Amino Surface Last update: 2004-12 page 1 Table of contents I. Introduction...3 II. Product description...4 A. Greiner Bio-One HTA Slides...4 B: SCIENION Buffer

More information

Multi-well formats. Overview method. Typical applications. 16-well slide. Surveillance chips 96-well SBS microplate

Multi-well formats. Overview method. Typical applications. 16-well slide. Surveillance chips 96-well SBS microplate Multi-well formats Overview Formats Immobilization method Typical applications 16-well slide Various Surveillance chips 96-well SBS microplate Virus or bacterial identification Molecular diagnostics Dose

More information

Food DNA-Chip. CarnoCheck high sensitive. For the highly sensitive detection of 8 animal species in food products.

Food DNA-Chip. CarnoCheck high sensitive. For the highly sensitive detection of 8 animal species in food products. Food DNA-Chip CarnoCheck high sensitive For the highly sensitive detection of 8 animal species in food products www.gbo.com/diagnostics CarnoCheck high sensitive DNA chip for the highly sensitive and simultaneous

More information

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes

Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Expressed genes profiling (Microarrays) Overview Of Gene Expression Control Profiling Of Expressed Genes Genes can be regulated at many levels Usually, gene regulation, are referring to transcriptional

More information

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides

Typical probes. Slides per pack Aminosilane. Long oligo- Slide AStar None D surface. nucleotides Aminosilane coating Nexterion Slide A+ and Slide AStar Overview Type of coating Immobilization method Typical probes Ordering information Nexterion product Barcode option Item number Slides per pack Aminosilane

More information

Sanger Sequencing Portfolio

Sanger Sequencing Portfolio Molecular Cloning Laboratories Sanger Sequencing Portfolio Significant Cost Savings vs ABI Uncompromised Performance Longer Read Length Longer Shelf Life No Recalibrations Necessary PAGE 1 BrightDye Terminator

More information

Microarray Industry Products

Microarray Industry Products Via Nicaragua, 12-14 00040 Pomezia (Roma) Phone: +39 06 91601628 Fax: +39 06 91612477 info@lifelinelab.com www.lifelinelab.com Microarray Industry Products Page 10 NBT / BCPIP Chromogenic phosphatase

More information

Future in your hands.

Future in your hands. Nexterion Future in your hands. 2 SCHOTT is a leading international technology group in the areas of specialty glass and glass-ceramics. With more than 130 years of outstanding development, materials and

More information

Protocol. Nexterion Plate E MTP 96. Protein application

Protocol. Nexterion Plate E MTP 96. Protein application Seite: 1/12 1 Introduction... 2 2 Storage and handling... 2 3 General precautions... 2 4 Reagents required... 3 5 Equipment required... 3 6 Array printing... 3 7 Printing guidelines... 4 8 Protein immobilization...

More information

Agilent Microplates. Creating Solutions to Support Visions and Achieve Scientific Objectives

Agilent Microplates. Creating Solutions to Support Visions and Achieve Scientific Objectives Agilent Microplates Creating Solutions to Support Visions and Achieve Scientific Objectives Agilent Products Include Storage/Assay Microplates, Filter Plates, Reagent Reservoirs Standard features of these

More information

Epoxy Microarray Slides

Epoxy Microarray Slides Introduction Epoxy Slides provide a uniform substrate for the creation of high-quality nucleic acid microarrays leveraging the advantage of a high throughput, parallel, and multiplex format. The substrate

More information

Product# EP Product Description

Product# EP Product Description 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Chlamydia End-Point PCR Kit Product# EP31400 Product Insert Intended

More information

RealLine Chlamydia trachomatis Str-Format

RealLine Chlamydia trachomatis Str-Format Instructions for use ASSAY KIT FOR THE QUALITATIVE DETECTION OF CHLAMYDIA TRACHOMATIS DNA BY REAL-TIME PCR METHOD In vitro Diagnostics 0123 () VBD1998 96 tests valid from: May 2016 Rev31052016_EN Page

More information

innovations 14/15 for life sciences

innovations 14/15 for life sciences innovations 14/15 for life sciences NEW Product Highlights Latest Innovations This is a selection of our new products, which are a result of our on-going research and development programme. Automatic 4

More information

RealLine HPV 31 / 33 Str-Format

RealLine HPV 31 / 33 Str-Format Instructions for use A QUALITATIVE ASSAY KIT FOR THE DIFFERENTIAL DETERMINATION OF HUMAN PAPILLOMAVIRUS TYPE 31 AND 33 DNA BY REAL TIME PCR METHOD In vitro diagnosticum () VBD8471 96 Tests valid from May

More information

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study

MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions

More information

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6

Microarray. Slide Selection Chart... J2. Epoxide-coated Slides... J3. GAPS II-coated Slides... J5. Corning Cover Glass... J6 Slide Selection Chart... J2 Epoxide-coated Slides... J3 UltraGAPS -coated Slides... J4 GAPS II-coated Slides... J5 Corning Cover Glass... J6 384-well Printing Plates... J6 Slide Mailers/Storage Boxes...

More information

PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use. Explore more at

PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use. Explore more at PAXgene Blood DNA PAXgene Blood DNA Tube (IVD) for clinical use PAXgene Blood DNA System (RUO) for research use Explore more at www.preanalytix.com Situation The composition, amount, quality and integrity

More information

Technical Instructions for Spotting Microarrays

Technical Instructions for Spotting Microarrays Technical Instructions for Spotting Microarrays PRODUCT is a special low fluorescence glass slide in the standard size of 75.6 mm x 25.0 mm x 1.0 mm. The aldehyde surface coating allows efficient covalent

More information

forum No. 7, Update 2015 Content Advanced High-Throughput Platforms for Protein Crystallisation

forum No. 7, Update 2015 Content Advanced High-Throughput Platforms for Protein Crystallisation T e c h n i c a l N o t e s a n d A p p l i c a t i o n s f o r L a b o r a t o r y W o r k Content 1. 96 Well CrystalQuick TM Plates for High-Throughput Vapour Diffusion Applications - CrystalQuick TM

More information

MicroSEQ TM ID Rapid Microbial Identification System:

MicroSEQ TM ID Rapid Microbial Identification System: MicroSEQ TM ID Rapid Microbial Identification System: the complete solution for reliable genotypic microbial identification 1 The world leader in serving science Rapid molecular methods for pharmaceutical

More information

DNA Microarray Technology

DNA Microarray Technology 2 DNA Microarray Technology 2.1 Overview DNA microarrays are assays for quantifying the types and amounts of mrna transcripts present in a collection of cells. The number of mrna molecules derived from

More information

Innovative. Intelligent. Intuitive.

Innovative. Intelligent. Intuitive. Innovative. Intelligent. Intuitive. The 3500 and 3500xL Genetic Analyzers Built on a legacy of proven excellence and innovation Built on a legacy of innovation Proven excellence takes a whole new form

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

BR-9516B. SNP genotyping analysis for medium to ultra-high throughput. GENOMELAB TM SNPSTREAM GENOTYPING SERIES

BR-9516B. SNP genotyping analysis for medium to ultra-high throughput. GENOMELAB TM SNPSTREAM GENOTYPING SERIES BR-9516B SNP genotyping analysis for medium to ultra-high throughput. GENOMELAB TM SNPSTREAM GENOTYPING SERIES Where power meets flexibility. The GenomeLab SNPstream Genotyping System provides an automated,

More information

DIANA assay for in vitro diagnostics Overview and collaboration proposal

DIANA assay for in vitro diagnostics Overview and collaboration proposal DIANA assay for in vitro diagnostics Overview and collaboration proposal Institute of Organic Chemistry and Biochemistry AS CR, Prague, Czech Republic DNA-linked Inhibitor ANtibody Assay What is DIANA

More information

Corning ELISA Microplates for Biochemical and Cell-based Applications. Quality, Support, and Service Every Step of the Way

Corning ELISA Microplates for Biochemical and Cell-based Applications. Quality, Support, and Service Every Step of the Way Corning ELISA Microplates for Biochemical and Cell-based Applications Quality, Support, and Service Every Step of the Way Corning ELISA Microplates ELISA assays are accurate, highly sensitive, and specific

More information

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes

7/24/2012. DNA Probes. Hybridization and Probes. CLS 420 Immunology & Molecular Diagnostics. Target Sequences. Target Sequences. Nucleic Acid Probes Hybridization and Probes CLS 420 Immunology & Molecular Diagnostics Molecular Diagnostics Techniques: Hybridization and Probes Nucleic acid probes: A short, known sequence of DNA or RNA Used to detect

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Protein Microarrays?

Protein Microarrays? Protein Microarrays? Protein Chemistry/Proteomics Unit and the Neuroscience Program,Biomedicum Helsinki E-Mail: marc.baumann@helsinki.fi (http://research.med.helsinki.fi/corefacilities/proteinchem) What

More information

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT.

DNA/RNA MICROARRAYS NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. DNA/RNA MICROARRAYS This protocol is based on the EDVOTEK protocol DNA/RNA Microarrays. 10 groups of students NOTE: USE THIS KIT WITHIN 6 MONTHS OF RECEIPT. 1. EXPERIMENT OBJECTIVE The objective of this

More information

Future in your hands.

Future in your hands. Nexterion Future in your hands. 2 SCHOTT is a leading international technology group in the areas of specialty glass and glass-ceramics. With more than 130 years of outstanding development, materials and

More information

AMP-6000 AUTOMATED MICROBIOLOGICAL PLATFORM

AMP-6000 AUTOMATED MICROBIOLOGICAL PLATFORM MICROBIOLOGY AMP-6000 AUTOMATED MICROBIOLOGICAL PLATFORM Microbiological Counting System rapid results simple documentation earlier product release reduced workload simple testing rapid process intervention

More information

You can always get what you want

You can always get what you want You can always get what you want PCR Consumables PCR from Eppendorf Distributed By: 109 Janet Street, Vineland, New Jersey 08360 Phone: 800-220-5732 / 856-825-0523 *Fax 856-327-5168 Email: info@lsdcorp.com

More information

DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate. Dr. Monica Simion, IMT Bucharest

DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate. Dr. Monica Simion, IMT Bucharest DNA and Proteine Microarray Technologies Developed on Porous Silicon Substrate Dr. Monica Simion, IMT Bucharest OmniGrid Micro (Digilab) printhead and wash/dry stations Positioning System with stepper

More information

Changing the world of laboratory developed testing

Changing the world of laboratory developed testing Changing the world of laboratory developed testing Solution overview Explore the solution Experience a convenient and easy workflow FLOW Primary Sample Handling Instrument MagNA Pure 96 Instrument FLOW

More information

Executive Summary. clinical supply services

Executive Summary. clinical supply services clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive

More information

DIAGNOSTICS: COLLECTION TO DETECTION. Results that matter.

DIAGNOSTICS: COLLECTION TO DETECTION. Results that matter. DIAGNOSTICS: COLLECTION TO DETECTION Results that matter. LEADING THE WAY IN DIAGNOSTIC SOLUTIONS Diagnostics is the dynamic, growing industry that relies on faster and more accurate results to improve

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

TreffLab PCR / qpcr Products

TreffLab PCR / qpcr Products TreffLab PCR / qpcr Products TreffLab PCR / qpcr products have been specifically developed for PCR approach requirements such as highest heat transfer, to ensure accurate cycle profiles for best nucleic

More information

Deep Well Plates & Cluster Tubes. Secure Vessels for Storage & Reaction. SSIbio

Deep Well Plates & Cluster Tubes. Secure Vessels for Storage & Reaction. SSIbio TM Deep Well Plates & Cluster Tubes SSIbio Deep-Well Plates Ideal for sample collection, preparation, and long-term storage. HTS-friendly compatible with most liquid-handling robots. Centrifugation to

More information

BIOFOOD Kits Kits for vertebrate species detection and identification in food using genetic markers (Ref )

BIOFOOD Kits Kits for vertebrate species detection and identification in food using genetic markers (Ref ) Manufactured by: BIOTOOLS B&M Labs, S.A. Valle de Tobalina - 52 - Nave 39 28021 Madrid Spain Tel. 91 710 00 74 Fax 91 505 31 18 e-mail: info@biotools.eu www.biotools.eu BIOFOOD Kits Kits for vertebrate

More information

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H)

HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) HELINI Hepatitis B virus [HBV] Real-time PCR Kit (Genotype A to H) Quantitative In vitro diagnostics Instruction manual Cat. No: 8001-25/50/100 tests Compatible with: Agilent, Bio-Rad, Applied Bio systems

More information

Novel Diagnostic Methods of Tuberculosis

Novel Diagnostic Methods of Tuberculosis Novel Diagnostic Methods of Tuberculosis Qimin YOU USTAR Biotechnologies I. The TB Diagnosis Challenge My presentation will focus on the new diagnostic methods of tuberculosis, developed by USTAR Biotechnologies.

More information

Campylobacter fetus genesig Easy Kit for use on the genesig q16

Campylobacter fetus genesig Easy Kit for use on the genesig q16 TM Primerdesign Ltd genesig Easy Kit for use on the genesig q16 50 reaction For general laboratory and research use only 1 genesig Easy: at a glance guide For each DNA test Component Volume Lab-in-a-box

More information

An Introduction to printing spotted microarrays

An Introduction to printing spotted microarrays http://www.flychip.org.uk/printingintroduction.php An Introduction to printing spotted microarrays Overview Microarrays are typically produced by transferring gene or transcript specific PCR amplified

More information

Liquidator 96. CCDB Simplifies Genomic Workflow Liquidator 96 Used in DNA Barcoding

Liquidator 96. CCDB Simplifies Genomic Workflow Liquidator 96 Used in DNA Barcoding CCDB Simplifies Genomic Workflow Liquidator 96 Used in DNA Barcoding The Canadian Centre for DNA Barcoding (CCDB) uses the throughout its barcoding workflow. The CCDB is developing a barcode reference

More information

RealLine Ureaplasma urealyticum / U. parvum Str-Format

RealLine Ureaplasma urealyticum / U. parvum Str-Format RealLine Ureaplasma urealyticum / Urealyticum parvum Instructions for use A QUALITATIVE ASSAY KIT FOR THE DIFFERENTIAL DETECTION OF UREAPLASMA UREALYTICUM DNA AND UREAPLASMA PARVUM DNA BY REAL TIME PCR

More information

Tissue Culture 1 Cell/ Microplates 2 HTS- 3 Immunology/ HLA 4 Microbiology/ Bacteriology Purpose Beakers 5 Tubes/Multi-

Tissue Culture 1 Cell/ Microplates 2 HTS- 3 Immunology/ HLA 4 Microbiology/ Bacteriology Purpose Beakers 5 Tubes/Multi- www.gbo.com/bioscience 11 Cryotechnics Technical Information 11 I 2 11 I 3 1 ml 11 I 3 2 ml 11 I 3 4 ml 11 I 4 5 ml 11 I 4 Support Rack 11 I 5 Cryovial Cap Inserts 11 I 5 www.gbo.com/bioscience Cryotechnics

More information

DNA Arrays Affymetrix GeneChip System

DNA Arrays Affymetrix GeneChip System DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC

More information

ULTRA CLEAN POLYPROPYLENE STORAGE PLATES CATALOGUE

ULTRA CLEAN POLYPROPYLENE STORAGE PLATES CATALOGUE ULTRA CLEAN POLYPROPYLENE STORAGE PLATES CATALOGUE INTRODUCTION Porvair Sciences has developed a number of storage/collection plates to help in the fields of cell biology, molecular biology, drug discovery,

More information

Surface Activated Dynabeads

Surface Activated Dynabeads Surface Activated Surface Activated A variety of ways to bind your ligand Manual or automated handling Protein separation technology Superior reproducibility All-in-one-tube protocols Easy handling and

More information

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU.

Bioinformatics: Microarray Technology. Assc.Prof. Chuchart Areejitranusorn AMS. KKU. Introduction to Bioinformatics: Microarray Technology Assc.Prof. Chuchart Areejitranusorn AMS. KKU. ความจร งเก ยวก บ ความจรงเกยวกบ Cell and DNA Cell Nucleus Chromosome Protein Gene (mrna), single strand

More information

High-throughput profiling, confirmation, and screening in a mid-density format. The QuantStudio 12K Flex Real-Time PCR System

High-throughput profiling, confirmation, and screening in a mid-density format. The QuantStudio 12K Flex Real-Time PCR System PRODUCT BULLETIN OpenArray technology on the QuantStudio 12K Flex system OpenArray technology on the QuantStudio 12K Flex Real-Time PCR System High-throughput profiling, confirmation, and screening in

More information

Chlamydia trachomatis. Easy Kit for use on the q reaction. For general laboratory and research use only

Chlamydia trachomatis. Easy Kit for use on the q reaction. For general laboratory and research use only Chlamydia trachomatis Easy Kit for use on the q16 50 reaction For general laboratory and research use only Easy: at a glance guide For each DNA test Component Volume Lab-in-a-box pipette C.trachomatis

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

NGS Sample QC with the Agilent 2200 TapeStation. Rainer Nitsche Application Engineer Agilent Technologies, Inc.

NGS Sample QC with the Agilent 2200 TapeStation. Rainer Nitsche Application Engineer Agilent Technologies, Inc. NGS Sample QC with the Agilent 2200 TapeStation Rainer Nitsche Application Engineer Agilent Technologies, Inc. The Agilent 2100 Bioanalyzer First commercially available Lab-on-a-Chip product Introduced

More information

PapilloCheck PapilloCheck high-risk

PapilloCheck PapilloCheck high-risk Your Power for Health HPV DNA-Chip PapilloCheck PapilloCheck high-risk Instructions For Use Diagnostic kit for the genotyping of human papillomavirus types 6, 11, 16, 18, 31, 33, 35, 39, 40, 42, 43, 44/55,

More information

PapilloCheck PapilloCheck high-risk

PapilloCheck PapilloCheck high-risk Your Power for Health HPV DNA-Chip PapilloCheck PapilloCheck high-risk Instructions For Use Diagnostic kit for the genotyping of human papillomavirus types 6, 11, 16, 18, 31, 33, 35, 39, 40, 42, 43, 44/55,

More information

BioMEMS for Future Drug Discovery Needs

BioMEMS for Future Drug Discovery Needs BioMEMS for Future Drug Discovery Needs a report by Drs Arjun Selvakumar, 1 Yuh-Min Chiang, 1 Simon Sims 2 and Jamie Wibbenmeyer 2 1. Applied MEMS, Inc. and 2. Xeotron Corporation Introduction Billions

More information

Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000

Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Trichomonas vaginalis SYBR Green PCR Kit Product# SG52000 Product

More information

For in vitro Veterinary Diagnostics only. Kylt Avian Hepatitis E. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Avian Hepatitis E. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Avian Hepatitis E Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Avian Hepatitis E Real-Time RT-PCR Detection A. General Kylt Avian Hepatitis

More information

Genome Analysis. Bacterial genome projects

Genome Analysis. Bacterial genome projects Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Bio MEMS Class -1 st week

Bio MEMS Class -1 st week Bio MEMS Class -1 st week Jang, Jaesung Ref: Bashir ADDR Review paper, 2004. 1 Introduction Bio-MEMS: devices or systems, constructed using techniques inspired from micro/nano-scale fabrication, that are

More information

You Can Always Get What You Want. PCR Consumables from Eppendorf

You Can Always Get What You Want. PCR Consumables from Eppendorf You Can Always Get What You Want PCR Consumables from Eppendorf Only the Best Eppendorf PCR Consumables Every researcher doing PCR always wonders about the best instrument, the best master mix, the best

More information

Human papillomavirus 45 genesig Easy Kit for use on the genesig q16

Human papillomavirus 45 genesig Easy Kit for use on the genesig q16 TM Primerdesign Ltd genesig Easy Kit for use on the genesig q16 50 reaction For general laboratory and research use only 1 genesig Easy: at a glance guide For each DNA test Component Volume Lab-in-a-box

More information

Using the SOLO for PCR Automation Alan H. Katz, PhD Hudson Control Group

Using the SOLO for PCR Automation Alan H. Katz, PhD Hudson Control Group Using the SOLO for PCR Automation Alan H. Katz, PhD Hudson Control Group Introduction The polymerase chain reaction (PCR) is one of the most widely used techniques in the field of molecular biology. PCR

More information

GENOMERA TM MRSA/SA PRODUCTS A NEW ERA IN DIRECT MRSA DNA TESTING. Bringing genetic MRSA results in less than 1 hour!

GENOMERA TM MRSA/SA PRODUCTS A NEW ERA IN DIRECT MRSA DNA TESTING. Bringing genetic MRSA results in less than 1 hour! GENOMERA TM MRSA/SA PRODUCTS A NEW ERA IN DIRECT MRSA DNA TESTING Bringing genetic MRSA results in less than 1 hour! IMPROVING PATIENT CARE THROUGH EARLIER DETECTION OF MRSA AND SA FAST MRSA AND SA DETECTION

More information

Blood direct 2x PCR Mastermix. Data sheet. Order No. BS reactions x 20 µl. (For research and in vitro applications only) Batch No.

Blood direct 2x PCR Mastermix. Data sheet. Order No. BS reactions x 20 µl. (For research and in vitro applications only) Batch No. Data sheet Order No. BS91.222.0250 250 reactions x 20 µl Order No. BS91.222.1250 1250 reactions x 20 µl (For research and in vitro applications only) Batch No.: Best before: Appearance: Colour: 1 Description

More information

MOLECULAR SOLUTIONS FOR BIOTECHNOLOGY

MOLECULAR SOLUTIONS FOR BIOTECHNOLOGY MOLECULAR SOLUTIONS FOR BIOTECHNOLOGY OUR PCR TECHNOLOGY OUR CAPABILITIES Over 20 years of molecular biology research has given Bioline scientists a deep understanding of the profound influence that buffer

More information

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger. High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip

More information

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger.

High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit. Application. Rüdiger Salowsky Anna Henger. High sensitivity quality control of RNA samples using the RNA 6000 Pico LabChip kit Application Rüdiger Salowsky Anna Henger Abstract This Application Note describes the use of the RNA 6000 Pico LabChip

More information

LabChip 90 System with DataViewer Software

LabChip 90 System with DataViewer Software Revolutionizing DNA and Protein Gel Electrophoresis LabChip 90 System with DataViewer Software The Proven Alternative to Slab Gels. The massive flow of information emerging from today s genomic and proteomic

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists

More information

an innovation in high throughput single cell profiling

an innovation in high throughput single cell profiling an innovation in high throughput single cell profiling www.dolomite-bio.com Why use high throughput single cell profiling? Techniques such as high throughput scrna-seq (single cell RNA sequencing) offer

More information

Manual. rapidstripe TBE Assay

Manual. rapidstripe TBE Assay Manual rapidstripe TBE Assay Contents Content 1 Introduction... 3 2 Test description and principle... 3 3 Performance assessment, spectrum of application and specificity... 5 4 Kit components, storage

More information

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description

qpcr Kit, DNA-free Product components 100 rxn 250 rxn Product description qpcr Kit, DNA-free For the PCR detection and identification of bacterial and fungal DNA using custom primers Product code A8514 Product components 100 rxn 250 rxn A 2.5x mastermix (3 mm MgCl 2 final concentration)

More information

Human Papillomavirus 33

Human Papillomavirus 33 PCRmax Ltd Human Papillomavirus 33 E6 gene TM qpcr test 150 tests For general laboratory and research use only 1 Introduction to Human Papillomavirus 33 Papillomaviruses are a diverse group of DNA-based

More information

The Thermo Scientific KingFisher Family

The Thermo Scientific KingFisher Family The Thermo Scientific KingFisher Family Accelerate your genomics and proteomics throughput with the Thermo Scientific KingFisher purification systems Part of Thermo Fisher Scientific The Thermo Scientific

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

COLLABORATIVE PROJECT

COLLABORATIVE PROJECT COLLABORATIVE PROJECT Collaborative pilot project: combination of advanced laser processes for the rapid fabrication of microfluidic devices made of polymer materials Kohler/KIT TABLE OF CONTENTS 1. Introduction...

More information

Marketplace. Essentials Tour The bright side of PCR. molecular biology. thermofisher.com/marketplace

Marketplace. Essentials Tour The bright side of PCR. molecular biology. thermofisher.com/marketplace molecular biology Marketplace The bright side of PCR Special offers on Thermo Scientific products: Agarose powder DNA ladders Electrophoresis dyes Enhanced Taq DNA polymerases High-fidelity DNA polymerases

More information

Rapid Capture System Proven Performance

Rapid Capture System Proven Performance Rapid Capture System Proven Performance Hybrid Capture 2 For automated human papillomavirus (HPV) testing Sample & Assay Technologies Chaptertitle X.XX The Rapid Capture System (RCS) an automated, CE-marked

More information

Thermo Scientific Nunc NucleoLink Product Guide

Thermo Scientific Nunc NucleoLink Product Guide Thermo Scientific Nunc NucleoLink Product Guide 1 Contents: Page Product Information NucleoLink Strips...3 Format...3 Application...3 NucleoLink versus CovaLink...4 Features...5 Binding...5 DIAPOPS...6

More information

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio

GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists

More information

Multiplex Solution for Better Health

Multiplex Solution for Better Health Multiplex Solution for Better Health About Us About Us Core Technology Technology s Precision Image Code () MicroDisc is manufactured by using a photo lithography fabrication process. This semi-conductor

More information

AmpliSens HBV-genotype-FRT PCR kit

AmpliSens HBV-genotype-FRT PCR kit For Professional Use Only AmpliSens HBV-genotype-FRT PCR kit Instruction Manual AmpliSens Federal Budget Institute of Science Central Research Institute for Epidemiology 3A Novogireevskaya Street Moscow

More information

Detection of CFTR(F508) MyBioSource.com. Real-time PCR mutation detection/allelic discrimination kit. For general laboratory and research use only

Detection of CFTR(F508) MyBioSource.com. Real-time PCR mutation detection/allelic discrimination kit. For general laboratory and research use only Detection of CFTR(F508) Real-time PCR mutation detection/allelic discrimination kit For general laboratory and research use only 50 tests Contents Principles of the test 3 Kit Contents 5 Recommended Accompanying

More information

AmpliSens C.trachomatis / Ureaplasma / M.genitalium / M.hominis-MULTIPRIME-FRT PCR kit

AmpliSens C.trachomatis / Ureaplasma / M.genitalium / M.hominis-MULTIPRIME-FRT PCR kit For Professional Use Only AmpliSens C.trachomatis / Ureaplasma / M.genitalium / M.hominis-MULTIPRIME-FRT PCR kit Instruction Manual AmpliSens Ecoli s.r.o., Studenohorska 12 841 03 Bratislava 47 Slovak

More information

Your Power for Health. Greiner Bio-One. Partnering Business through Guided Solutions.

Your Power for Health. Greiner Bio-One. Partnering Business through Guided Solutions. Your Power for Health Greiner Bio-One Partnering Business through Guided Solutions 2 Greiner Bio-One uses its extensive knowledge base and experience to provide solutions for its customers. From the idea,

More information

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE

EPIGENTEK. EpiQuik Tissue Chromatin Immunoprecipitation Kit. Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE EpiQuik Tissue Chromatin Immunoprecipitation Kit Base Catalog # P-2003 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Tissue Chromatin Immunoprecipitation Kit is suitable for combining the specificity

More information

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand

Axygen AxyPrep Magnetic Bead Purification Kits. A Corning Brand Axygen AxyPrep Magnetic Bead Purification Kits A Corning Brand D Sample Prep Solutions for Genomics Obtaining Pure Nucleic Acids from Your Sample is Precious The purification of high quality DNA is the

More information

From Liquid Biopsy and FFPE Samples to Results

From Liquid Biopsy and FFPE Samples to Results From Liquid Biopsy and FFPE Samples to Results Fully automated purification, reliable quantification and bisulfite conversion of cell-free circulating DNA and DNA from FFPE samples Fully automated purification,

More information

DNA Extraction and Real-Time PCR Detection Kit for Mycoplasma gallisepticum live vaccine strain ts-11.

DNA Extraction and Real-Time PCR Detection Kit for Mycoplasma gallisepticum live vaccine strain ts-11. For in vitro Veterinary Diagnostics only. DNA Extraction and Real-Time PCR Detection Kit for Mycoplasma gallisepticum live vaccine strain ts-11 www.kylt.eu DIRECTION FOR USE Art. No. 31410 / 31411 Kylt

More information

Embrace the Future of Electrophoresis

Embrace the Future of Electrophoresis Embrace the Future of Electrophoresis Analysis of 12 samples in as little as 3 minutes Unattended analysis of up to 96 samples Resolution down to 3 5 bp for fragments

More information

For in vitro Veterinary Diagnostics only. Kylt Avian Nephritis Virus. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Avian Nephritis Virus. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Avian Nephritis Virus Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Avian Nephritis Virus Real-Time RT-PCR Detection A. General Kylt Avian

More information

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905)

3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) Fax: (905) 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HPV (High Risk) TaqMan PCR Kit Product# TM32200 Product Insert

More information