RNA-based gene fusion detection: NGS applications and sample workflow improvements
|
|
- Agatha Philippa Edwards
- 6 years ago
- Views:
Transcription
1 RNA-based gene fusion detection: NGS applications and sample workflow improvements Joshua Stahl Chief Scientific Officer and General Manager ArcherDX
2 Cancer is a disease of the genome Genomic rearrangements SNVs/indels Copy number variations RNA abundance
3 Fusions SNVs cdna or DNA fragments End repair, d/a-tailing Adapter ligation P5 Primer Barcode GSP1 Sample GSP2 Sample CNVs RNA abundance
4 Fusions SNVs cdna or DNA fragments End repair, d/a-tailing Adapter ligation P5 Primer Barcode GSP1 Sample GSP2 Sample CNVs RNA abundance
5 Cancer is a disease of the genome Genomic rearrangements
6 Sensitivity: False negatives - AMP vs. opposing primers 100% sensitivity 90% sensitivity?? Opposing PCR methods
7 ALK fusion Tissue: lung Tumor: 80% Fusion detected: SQSTM1 ALK Start sites: 100 Not covered in competitor panels 5 ALK 3 ALK
8 ALK fusion detected by FISH 5 ALK 3 ALK
9 ALK fusion with Crizotinib resistance
10 Cancer is a disease of the genome Genomic rearrangements/isoforms SNVs/indels
11 Exon skipping/deletion detection Wild-type MET GSP2 GSP2 Exon 13 Exon 14 Exon 15 GSP2 GSP2 Exon 13 Exon 14 Exon 15
12 Exon skipping/deletion detection MET variant GSP2 GSP2 Exon 13 Exon 14 X Exon 15 X X X X GSP2 GSP2 Splice site mutation Exon 13 Exon 15
13 MET exon 14 splice site mutation
14 MET exon 14 skipping Exon 14
15 Cancer is a disease of the genome RNA abundance
16 Relative abundance detection Moderate Relative Abundance De-duplicate reads with MBC Map reads to genome MBC depth Count MBCs associated with target regions and house keeping controls Internal controls Target The counts are clustered into two groups Calculate a relative abundance as a ratio of RNA specific reads MBC depth High Relative Abundance Internal controls Target
17 Expression markers within panels help identify tissue of origin Sample Sample Sample Sample Sample Archer FusionPlex Lung Thyroid Panel Sample
18 Expression markers within panels help identify tissue of origin Thyroid Lung and NSCLC Adrenal Principal components extracted from per-exon RNA expression in normal lung, thyroid and adrenal inputs
19 Cancer is a disease of the genome SNVs/indels RNA abundance
20 RNA + DNA variant calling Wild-type DNA Expressed wild-type RNA Wild-type protein DNA mutation Expressed wild-type RNA Mutant protein C Expressed mutant RNA C
21 RNA + DNA variant calling Wild-type DNA Expressed wild-type RNA Wild-type protein DNA mutation Expressed wild-type RNA Mutant protein C Expressed mutant RNA C C C
22 RNA ideal for sensitive detection Nucleic Acids Research (Impact Factor: 9.11). 06/2014; 42(13). DOI: /nar/gku489 Source: PubMed
23 SNV detection in both RNA and DNA NSCLC FFPE sample EGFR L858R (AF = 22%) 1M reads total RNA reads Likely RNA reads 1M reads total Evidence of allelic imbalance despite 22% AF, mutant allele is primarily expressed
24 Cancer is a disease of the genome Copy Number Variations RNA Abundance
25 Orthogonal validation of CNV calls Copy number variation Normal sample CNV sample RNA abundance Sample Sample
26 Gene amplifications are confirmed by mrna over-expression
27 Understanding your sample requires matching sequencer reads to input molecules T :20904:1081 1:N:0:TCCTGAGC+NAGTTCCA AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EEEEEEEEEEEEEEEEEEEEEEE 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEEEE/EEEEE T 1:N:0:TCCTGAGC +GAGTTCCA TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT + AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE
28 Understanding your sample requires matching sequencer reads to input molecules T A T :20904:1081 AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT :20904:1081 1:N:0:TCCTGAGC+NAGTTCCA AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG + + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EAEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEEE<EE/EEEEEEAEEEE/A<EEEEEE/ EEEEEEEEEEEEEEEEEEEEEEE TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA + + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEEEE/EEEEE 1:N:0:TCCTGAGC TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA 1:N:0:TCCTGAGC +GAGTTCCA TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT + + AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE
29 Understanding your sample requires matching sequencer reads to input molecules T 1:N:0:TCCTGAGC+NAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEEE<EE/EEEEEEAEEEE/ 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCTGGAGATTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEE 1:N:0:TCCTGAGC+GAGTTCCA T A TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + T A T :20904:1081 AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT :20904:1081 1:N:0:TCCTGAGC+NAGTTCCA AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG + + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EAEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEEE<EE/EEEEEEAEEEE/A<EEEEEE/ EEEEEEEEEEEEEEEEEEEEEEE TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA + + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEEEE/EEEEE 1:N:0:TCCTGAGC TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA 1:N:0:TCCTGAGC +GAGTTCCA TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT + + AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE
30 Understanding your sample requires matching sequencer reads to input molecules T 1:N:0:TCCTGAGC+NAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEEE<EE/EEEEEEAEEEE/ 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCTGGAGATTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEE 1:N:0:TCCTGAGC+GAGTTCCA T A TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTG ACTATGTGCCGAGCGATCAGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGA AGAGCACA + T A T :20904:1081 AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT :20904:1081 1:N:0:TCCTGAGC+NAGTTCCA AGCCGCAAAACCGCCAAAAGTTGTATAAAATACTTCTCCATTTTGTTGATTCATAAGCACCTGTAATCCAAAAAATTAAAATGTAATTT TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG TTATGTATGTACTCTGTTTACACTGCTAGCTCAGATCGGAAGAGCACACGTCTGAACTCCAG + + AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEAEAAEEEEEEEEEEEEE/EEEEEEE EAEEEEEEEEEEEEEEEEEEEEEEEEAEEAEEEEEEE<EE/EEEEEEAEEEE/A<EEEEEE/ EEEEEEEEEEEEEEEEEEEEEEE TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC 1:N:0:TCCTGAGC+GAGTTCCA TATAGAACAACCGCCAGGAGTTTCTTTTTCTCCCAGCTTCCTGGACAAGATCGACGTGATCAAGCAGGCTGACTATGTGCCGAGCGATC AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA AGGTGTGCAAAACCCCTCCCCACCAGAGGACTCTGAGCCCTCTTTAGATCGGAAGAGCACA + + AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE EEEEEEEEEEE6EEEEEEEEEEEAEEEEEEEEEEE/EEEEEEEEEEEAEEEEEEE/EEEEE 1:N:0:TCCTGAGC TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA 1:N:0:TCCTGAGC +GAGTTCCA TAGTAACAAACCGCCAGGAGTAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAAGTGGGTACCTGA GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT GTTTTATTTTGGCAACTTTGCTCCAACTGCCATGCTTCCCAGATCGGAAGAGCACACGT + + AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE AAAAAEEEEEEEEEEE<EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE EEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEEAEEEE<EEE
31 Archer PreSeq RNA QC Assay
32 PreSeq predicts fragmentation and input
33 RNA integrity vs. age Empirically determined PreSeq cut off of Ct=29 100% sensitivity at Ct=29 p < for linear trend
34 Increased input rescues library quality High-, mediumand low-quality FFPE samples
35 PreSeq is predictive of sensitivity and specificity
36 @NS TAT AGG + AAA EEE What about extraction? Agencourt FormaPure Kit (cat # A33341) QIAGEN AllPrep DNA/RNA FFPE Kit (cat # 80234) Covaris truxtrac FFPE RNA Kit (cat # ) Ambion RecoverAll Total Nucleic Acid Isolation Kit for FFPE (cat # AM1975) Zymo Research Pinpoint Slide RNA Isolation System II (cat # R1007) Promega ReliaPrep FFPE Total RNA Miniprep System (cat # Z1001) Ambion TRIzol Reagent (cat # ) The extraction kits above are for research use only and not for use in diagnostic procedures T A AGC TTA + AAA EAE T TAG GTT + AAA EEE
37 @NS TAT AGG + AAA EEE What about extraction? optimization Crosslinking reversal time Crosslinking temperature Crosslinking ph Divalent cation concentration Inclusion of a commercially available RNA storage reagent C->T T AGC TTA + AAA EAE T TAG GTT + AAA EEE
38 Agencourt FormaPure Buffer Optimization
39 Agencourt FormaPure - Additives
40 Agencourt FormaPure Crosslink reversal time and temperature
41 Covaris Fusion calling and extraction
42 What about extraction? - Conclusion
43 What about extraction? - Conclusion Agencourt FormaPure Kit - proteinase K digestion at 55 C for 1 hour followed by crosslink reversal at 80 C for 1 hour Covaris truxtrac FFPE RNA Kit - crosslink reversal at 80 C for 1 hour QIAGEN AllPrep DNA/RNA FFPE Kit - crosslink reversal at 80 C for 1 hour; mineral oil is interchangeable with the QIAGEN Deparaffinization Solution for sample deparaffinization. Promega ReliaPrep FFPE Total RNA Miniprep System - crosslink reversal at 80 C for 1 hour Zymo Research Pinpoint Slide RNA Isolation System II - proteinase K digestion at 55 C for 1 hour followed by a crosslink reversal at 80 C for 1 hour; elute using 20μL water Ambion RecoverAll not recommended T A C->T T A
44 What about extraction? - Conclusion Agencourt FormaPure Kit - proteinase K digestion at 55 C for 1 hour followed by crosslink reversal at 80 C for 1 hour Covaris truxtrac FFPE RNA Kit - crosslink reversal at 80 C for 1 hour QIAGEN AllPrep DNA/RNA FFPE Kit - crosslink reversal at 80 C for 1 hour; mineral oil is interchangeable with the QIAGEN Deparaffinization Solution for sample deparaffinization. Promega ReliaPrep FFPE Total RNA Miniprep System - crosslink reversal at 80 C for 1 hour Zymo Research Pinpoint Slide RNA Isolation System II - proteinase K digestion at 55 C for 1 hour followed by a crosslink reversal at 80 C for 1 hour; elute using 20μL water Ambion RecoverAll not recommended T A C->T T A
45 What about the Maxwell RSC FFPE Kit? For research use only. Not for use in diagnostic procedures
46 Maxwell Instruments Easy-to-Use Particle Mover Automation Mixing Add Sample LEV Plunger Capture Binding Washing & Elution Elution Tube (30-100µl) Easily process up to 16 samples simultaneously
47 Experimental design Library # Tube Label Extraction RNA PreSeq Sample Type Type CT value PG1207 MF1 Maxwell FFPE 25.5 PG1208 MF2 Maxwell FFPE 26.8 PG1209 MN1 Maxwell negative 26.0 PG1210 MN2 Maxwell negative 24.7 PG1211 MN3 Maxwell negative 25.1 PG1212 MN4 Maxwell negative 25.2 PG1213 MP1 Maxwell positive (SureShot) 25.4 PG1214 MP2 Maxwell positive (SureShot) 24.9 PG1215 MP3 Maxwell positive (SureShot) 25.6 PG1216 MP4 Maxwell positive (SureShot) 25.4 PG1217 RF1 ReliaPrep FFPE 27.2 PG1218 RF2 ReliaPrep FFPE 26.5 PG1219 RN1 ReliaPrep negative 25.6 PG1220 RN2 ReliaPrep negative 26.6 PG1221 RN3 ReliaPrep negative 26.4 PG1222 *RN5 ReliaPrep negative 26.4 PG1223 RP1 ReliaPrep positive (SureShot) 25.9 PG1224 RP2 ReliaPrep positive (SureShot) 25.7 PG1225 RP3 ReliaPrep positive (SureShot) 26.1 PG1226 *RP5 ReliaPrep positive (SureShot) 25.5
48 Relative amount of amplifiable VCP RNA Relative amplifiable VCP RNA (PreSeq) ReliaPrep positive ReliaPrep negative ReliaPrep FFPE Maxwell positive Maxwell negative Maxwell FFPE
49 Relative amount of amplifiable VCP RNA Relative amplifiable VCP RNA (PreSeq) ReliaPrep positive ReliaPrep negative ReliaPrep FFPE 1 ReliaPrep FFPE 2 Maxwell positive Maxwell negative Maxwell FFPE 1 Maxwell FFPE 2
50 Unique start sites Ambig DNA RNA ReliaPrep positive ReliaPrep negative ReliaPrep FFPE Maxwell positive Maxwell negative Maxwell FFPE
51 Unique start sites Ambig DNA RNA ReliaPrep positive ReliaPrep negative ReliaPrep FFPE 1 ReliaPrep FFPE 2 Maxwell positive Maxwell negative Maxwell FFPE 1 Maxwell FFPE 2
52 Conclusion Archer FusionPlex assays offer distinct advantages over FISH and traditional target enrichment methods Archer Analysis software empowers users with multiple methods to support genetic abnormalities RNA quality on prospective FFPE sample higher than archived samples Extraction is an often overlooked but vital piece of any molecular assay Maxwell RSC instrument combined with Maxwell RSC RNA FFPE kit is the best-performing extraction technology on the market for FusionPlex assays
53 Acknowledgements Archer Mol Bio Group Jason Myers Brian Kudlow Brady Culver Josh Haimes Laura Johnson Ryan Walters Katie Moore Paula Roberts Namitha Manoj Ian Hoskins Marc Bessette Megan Wemmer Ian McKittrick Aaron Garnett James Covino Eric Davis Elina Baravik Jens Eberlein Helen Wang External Advisors Long Le John Iafrate Robert Daber Archer Bioinformatics Doug Wendel Abel Licon Jeremy Widmann Aaron Berlin Eric Reckase Mike Banos Jody Stephens Mike Montgomery Ben Van Deusen Johnny Flowers David Finke Karamjeet Khalsa Chris Davies Vince Reuter John Callaway Archer Marketing Jason Amsbaugh Darius Fugere Tyler Newberry Rich Kulesus Jared Snider Collaborators Cheng-Han Lee University of Alberta Valentina Nardi - MGH Milhan Telatar City of Hope Danielle Murphy Ignyta Robert Shoemaker Ignyta Jason Christiansen - Ignyta
Comprehensive Report on FFPE Extraction Methods
Technical Note Comprehensive Report on FFPE Extraction Methods Mutation detection based on DNA or RNA sequencing is becoming increasingly important in both human disease research and clinical settings.
More informationQIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
More informationIsolation of total nucleic acids from FFPE tissues using FormaPure DNA
APPLICATION NOTE Isolation of total nucleic acids from FFPE tissues using FormaPure DNA Jung Hoon Doh, Ph.D. Senior Application Scientist Beckman Coulter Life Sciences, Indianapolis, IN USA Summary Extensive
More informationReliaPrep FFPE gdna Miniprep System
TECHNICAL MANUAL ReliaPrep FFPE gdna Miniprep System Instructions for Use of Products A2351 and A2352 Revised 12/15 TM352 ReliaPrep FFPE gdna Miniprep System All technical literature is available at: www.promega.com/protocols/
More informationArcher ALK, RET, ROS1 Fusion Detection v1 Illumina Platform
Archer ALK, RET, ROS1 Fusion Detection v1 Illumina Platform P/N AK0001-8 Archer ALK, RET, ROS1 Fusion Detection v1 for Illumina Platform IFU-AK0001-8 Rev. A Table of Contents Product Description..3 Workflow
More informationSureSelect XT HS. Target Enrichment
SureSelect XT HS Target Enrichment What Is It? SureSelect XT HS joins the SureSelect library preparation reagent family as Agilent s highest sensitivity hybrid capture-based library prep and target enrichment
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationAlmac Diagnostics. NGS Panels: From Patient Selection to CDx. Dr Katarina Wikstrom Head of US Operations Almac Diagnostics
Almac Diagnostics NGS Panels: From Patient Selection to CDx Dr Katarina Wikstrom Head of US Operations Almac Diagnostics Overview Almac Diagnostics Overview Benefits and Challenges of NGS Panels for Subject
More informationSample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist
Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic
More informationAnalytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System
WHITE PAPER Oncomine Lung cfdna Assay and Ion S5 XL System Analytical verification methods for the Oncomine Lung cfdna Assay using the Ion S5 XL System Key highlights Investigate tumor heterogeneity and
More informationFundamentals of Next-Generation Sequencing: Technologies and Applications
Fundamentals of Next-Generation Sequencing: Technologies and Applications Society for Hematopathology European Association for Haematopathology 2017 Workshop Eric Duncavage, MD Washington University in
More informationNew Frontiers of Genetic Profiling Achieve Higher Sensitivity and Greater Insights with Molecular Barcodes, Long Read Capture and Optimized Exomes
New Frontiers of Genetic Profiling Achieve Higher Sensitivity and Greater Insights with Molecular Barcodes, Long Read Capture and Optimized Exomes Jennifer Jones, PhD Senior Field Application Scientist
More informationDevelopment of quantitative targeted RNA-seq methodology for use in differential gene expression
Development of quantitative targeted RNA-seq methodology for use in differential gene expression Dr. Jens Winter, Market Development Group Biological Biological Research Content EMEA QIAGEN Universal Workflows
More informationFunctional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens
Functional DNA Quality Analysis Improves the Accuracy of Next Generation Sequencing from Clinical Specimens Overview We have developed a novel QC, the SuraSeq DNA Quantitative Functional Index (QFI ).
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationA new paradigm in testing for NSCLC-targeted therapies
A new paradigm in testing for NSCLC-targeted therapies Accelerate results, from sample to report, with the first IVD NGS-based test NEW Oncomine Dx Target Test The Ion Torrent Oncomine Dx Target Test is
More informationccfdna Webinar Series: The Basics and Beyond
ccfdna Webinar Series: The Basics and Beyond Part 2 Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. ccfdna Workflows: Honing in
More informationIntroduction into single-cell RNA-seq. Kersti Jääger 19/02/2014
Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?
More informationDetection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System
Detection of Rare Variants in Degraded FFPE Samples Using the HaloPlex Target Enrichment System Application Note Author Linus Forsmark Henrik Johansson Agilent Technologies Inc. Santa Clara, CA USA Abstract
More informationNGEx. High quality sequential extraction of both DNA and RNA from the same tissue specimen. Fast.
NGEx Next Generation Extraction technology The only TRULY fully automated extraction solution. No manual reagent handling. No split samples: Sequential extraction of both DNA and RNA in a single workflow
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Workflow for multimodal analysis using sc-gem on a programmable microfluidic device (Fluidigm). 1) Cells are captured and lysed, 2) RNA from lysed single cell is reverse-transcribed
More informationSURESELECTXT LOW INPUT TARGET ENRICHMENT
SURESELECTXT LOW INPUT TARGET ENRICHMENT Low Input FFPE Optimized Streamlined Workflow SureSelect XT Low Input What is it? SureSelect XT Low Input is a low-input, FFPE-optimized library preparation kit.
More informationHaloPlex HS. Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D.
HaloPlex HS Get to Know Your DNA. Every Single Fragment. Kevin Poon, Ph.D. Sr. Global Product Manager Diagnostics & Genomics Group Agilent Technologies For Research Use Only. Not for Use in Diagnostic
More informationSureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System
SureSelect Target Enrichment for the Ion Proton TM Next Generation Sequencing System Demonstrated performance you can count on Christina Chiu Product Manager, SureSelect Kyeong Jeong Ph.D. R&D Scientist
More informationTitelstijl van model bewerken
Generate Titelstijl van and verify model your bewerken data Solutions for all your genetic analysis needs Sanger Sequencing Microarray technology QuantStudio real-time and digital PCR Ion Torrent NGS systems
More informationMagMAX FFPE DNA/RNA Ultra Kit
PPLICTION NOTE MagMX FFPE DN/RN Ultra Kit MagMX FFPE DN/RN Ultra Kit Introduction Rapid and accurate cancer genome analysis is in high demand for research into the detection and therapeutic management
More informationImplementation of Automated Sample Quality Control in Whole Exome Sequencing
Journal of Life Sciences 11 (2017) 261-268 doi: 10.17265/1934-7391/2017.06.001 D DAVID PUBLISHING Implementation of Automated Sample Quality Control in Whole Exome Sequencing Elisa Viering 1, Jana Molitor
More informationThe Hows and Whys of Early Steps in RNA Analysis
The Hows and Whys of Early Steps in RNA Analysis Leta Steffen, PhD Sr Research Scientist, Promega Promega Corporation Presentation Outline Optimizing the Early Steps Improves Analysis RNA Analysis Workflow
More informationIntroduction The molacular targets are required rigorous molecular diagnostic methods owing to the fact that the therapy drive at a molecule for examp
K Ras mutation testing of colorectal and lung carcinomas Semmelweis University, 2nd Department of Pathology Budapest, Hungary Introduction The molacular targets are required rigorous molecular diagnostic
More informationIt s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue
It s All in the Details (or Small RNA): Simplified and Improved mirna Purification from Tissue Douglas Horejsh January 2015 Discussion Outline Non-coding RNA General Overview mirna What is it? The Future
More informationDNA. Clinical Trials. Research RNA. Custom. Reports CLIA CAP GCP. Tumor Genomic Profiling Services for Clinical Trials
Tumor Genomic Profiling Services for Clinical Trials Custom Reports DNA RNA Focused Gene Sets Clinical Trials Accuracy and Content Enhanced NGS Sequencing Extended Panel, Exomes, Transcriptomes Research
More informationDNA Workflow. Marine Biological Laboratory. Mark Bratz Applications Scientist, Promega Corporation. August 2016
DNA Workflow Marine Biological Laboratory Mark Bratz Applications Scientist, August 2016 Scientific Applications Support Mission Realize customer driven applications of Promega technologies to enhance
More informationEnterprise Interest I am an employee of ThermoFisher Scientific.
Enterprise Interest I am an employee of ThermoFisher Scientific. Developing a multiplex next-generation sequencing assay to study highly clonal tumor samples Dumitru Brinza, Ph.D Clinical Next-Generation
More informationQuick-DNA. DNA from any Sample
Quick-DNA DNA from any Sample Quick-DNA Overview Zymo Research offers a range of genomic DNA isolation kits that are suitable for extracting high molecular weight DNA from a wide variety of sample types
More informationUltra-Sensitive BRAF Mutation Detection Kit. User Manual
Ultra-Sensitive BRAF Mutation Detection Kit User Manual Catalog Number: BRAF0001-20 BRAF0001-50 Size: 20 tests/kit 50 tests/kit Intended Use: For Research Use Only Doc. No.: Revision: 100-BRAF0001 Rev.
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-DNA FFPE Kit Catalog Nos. D3067 Highlights Streamlined purification of high-quality FFPE tissue DNA that is ideal for PCR, Next-Gen library prep, enzymatic manipulations, etc.
More informationFusion Gene Analysis. ncounter Elements. Molecules That Count WHITE PAPER. v1.0 OCTOBER 2014 NanoString Technologies, Inc.
Fusion Gene Analysis NanoString Technologies, Inc. Fusion Gene Analysis ncounter Elements v1.0 OCTOBER 2014 NanoString Technologies, Inc., Seattle WA 98109 FOR RESEARCH USE ONLY. Not for use in diagnostic
More informationAccelerate your NGS performance through Sample to Insight solutions
Accelerate your NGS performance through Sample to Insight solutions Complete your NGS workflow and save up to 40% Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput
More informationNext Generation Sequencing. Target Enrichment
Next Generation Sequencing Target Enrichment Next Generation Sequencing Your Partner in Every Step from Sample to Data NGS: Revolutionizing Genetic Analysis with Single-Molecule Resolution Next generation
More informationFFPE DNA Extraction kit
FFPE DNA Extraction kit Instruction Manual FFPE DNA Extraction kit Cat. No. C20000030, Format 50 rxns Version 1 / 14.08.13 Content Introduction 4 Overview of FFPE DNA extraction workflow 4 Kit contents
More informationLiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform
LiquidBiopsy LIQUIDBIOPSY Automated Rare Template Isolation Platform Enabling cancer research with highly multiplexed molecular analysis of serially collected blood samples The LiquidBiopsy Platform simplifies
More informationDigital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification
Digital DNA/RNA sequencing enables highly accurate and sensitive biomarker detection and quantification Erwin Chen ( 陳立德 ) Technical Product Specialist QIAGEN Taiwan Precision medicine: Right drug, right
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationFrom Liquid Biopsy and FFPE Samples to Results
From Liquid Biopsy and FFPE Samples to Results Fully automated purification, reliable quantification and bisulfite conversion of cell-free circulating DNA and DNA from FFPE samples Fully automated purification,
More informationExploring new frontiers with next-generation sequencing
Spotlight: NGS Exploring new frontiers with next-generation sequencing Pushing the limits of discovery Next-generation sequencing (NGS) is being utilized for numerous new and exciting applications, such
More informationFrom Liquid Biopsy and FFPE Samples to Results
www.autogen.com 774-233-3000 From Liquid Biopsy and FFPE Samples to Results Fully automated purification, reliable quantification and bisulfite conversion of cell-free circulating DNA and DNA from FFPE
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationFFPE DNA Extraction Protocol
FFPE DNA Extraction Protocol Introduction The number of archival formalin-fixed paraffin embedded (FFPE) samples is in the millions, providing an invaluable repository of information for genetic analysis.
More informationApostle MiniMax TM Technology
Apostle MiniMax TM Technology 1. MiniMax TM High Efficiency cfdna Isolation Kit (Standard Edition) 2. MiniMax TM High Efficiency cfdna Isolation Kit (Type S ) 3. MiniMax TM cfdna Blood Collection Tube
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationQuantStudio 3D Digital PCR System
PRODUCT BULLETIN QuantStudio 3D Digital PCR System QuantStudio 3D Digital PCR System Absolutely attainable digital PCR Simple chip-based workflow no emulsion PCR Affordable low total cost of ownership
More informationFor Research Use Only Ver
INSTRUCTION MANUAL Quick-DNA/RNA FFPE Kit Catalog No. R1009 Highlights High performance sample prep technology for total nucleic acid (DNA & RNA) recovery from the same FFPE tissue sample/section. High
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationAnalysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded. Dione K. Bailey Anniek De Witte October 9, 2007
Analysis of DNA sequence copy number in archival formalin-fixed, paraffinembedded (FFPE) tumor samples by oligo array CGH Dione K. Bailey Anniek De Witte October 9, 2007 Agenda Oligo acgh Review Problems
More informationmirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis
mirna Purification from Plant Tissues: Corn, Soybean and Arabidopsis A Maxwell RSC mirna Tissue Kit Application Note Materials Required: Maxwell RSC mirna Tissue Kit (Cat.# AS1480) QuantiFluor RNA System
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationAgilent NGS Solutions : Addressing Today s Challenges
Agilent NGS Solutions : Addressing Today s Challenges Charmian Cher, Ph.D Director, Global Marketing Programs 1 10 years of Next-Gen Sequencing 2003 Completion of the Human Genome Project 2004 Pyrosequencing
More informationQuality assurance in NGS (diagnostics)
Quality assurance in NGS (diagnostics) Chris Mattocks National Genetics Reference Laboratory (Wessex) Research Diagnostics Quality assurance Any systematic process of checking to see whether a product
More informationAccessible answers. Targeted sequencing: accelerating and amplifying answers for oncology research
Accessible answers Targeted sequencing: accelerating and amplifying answers for oncology research Help advance precision medicine Accelerate results with Ion Torrent NGS Life without cancer. This is our
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationAutomating FFPE Samples from Extraction to NGS Library Preparation. NGS Workflow Solution APPLICATION NOTE. Authors: Guillaume Durin Vanessa Process
APPLICATION NOTE NGS Workflow Solution Authors: Guillaume Durin Vanessa Process Covaris, Inc. Woburn, MA Brian Gerwe Sheryl Duffy Alex Lopez PerkinElmer, Inc. Waltham, MA Partnering in automated NGS extraction
More informationHigh Resolution LabChip XT Fractionation of Illumina Compatible Small RNA Libraries using the DNA 300 Assay Kit
application Note Next Generation Sequencing Authors: Lucy Sun Danh Tran Donna Fong Ryan Swenerton Elaine Wong-Ho Rajendra Singh Josh Molho Caliper Life Sciences a PerkinElmer Company Alameda, California
More informationHigh-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights:
TECH NOTE High-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights: Simple workflow starts directly from 1 1,000 cells or 10 pg 10 ng total RNA to generate
More informationCat. Nos. NT09115, NT091120, NT , NT , and NTBC0950 DISCONTINUED
Nextera DNA Sample Prep Kit (Roche Titanium-compatible) Cat. Nos. NT09115, NT091120, NT0911-50, NT0911-96, and NTBC0950 DISCONTINUED The Nextera DNA Sample Prep Kit is designed to prepare genomic DNA libraries
More informationWalk-away automation 1 16 sample capacity Consistent yield and purity
Walk-away automation 1 16 sample capacity Consistent yield and purity The Maxwell 16 Fast. Simple. Reliable. Purifies samples in 30-45 minutes allowing you to focus on performing downstream applications
More informationTailorMix Stranded mrna Sample Preparation Kit
TailorMix Stranded mrna Sample Preparation Kit Catalog Numbers: TM200-A and TM200-B Introduction The TailorMix Stranded mrna Sample Preparation Kit from SeqMatic is a comprehensive solution for generating
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationOptimized Covaris truxtrac FFPE RNA Protocol for Isolating RNA from Laser-Capture Microdissected (LCM) FFPE Tissue for Next Generation Sequencing
Optimized truxtrac FFPE RNA Protocol for Isolating RNA from Laser-Capture Microdissected (LCM) FFPE Tissue for Next Generation Sequencing Enni Markkanen Institute of Veterinary Pharmacology and Toxicology,
More informationData Sheet Quick PCR Cloning Kit
Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationTo NanoDrop or Not to NanoDrop : Choosing the Most Appropriate Method for Nucleic Acid Quantitation
To NanoDrop or Not to NanoDrop : Choosing the Most Appropriate Method for Nucleic Acid Quantitation Presented by: Doug Wieczorek, Ph.D. Senior Application Scientist Presentation Outline Nucleic acid quantitation
More informationAutomating Genomics Applications with the Agilent Bravo Workstation
Automating Genomics Applications with the Agilent Bravo Workstation Stephen Lappin Field Applications Specialist Agilent Automation Solution Page 0 AAS Tools for sample preparation Today we will present:
More informationPerformance Characteristics drmid Dx for Illumina NGS systems
Performance Characteristics drmid Dx for Illumina NGS systems MANUFACTURER Multiplicom N.V. Galileïlaan 18 2845 Niel BELGIUM Revision date: August, 2017 Page 1 of 7 TABLE OF CONTENTS 1. TEST PRINCIPLE...
More informationNextera DNA Sample Prep Kit (Roche FLX-compatible)
Cat. Nos. FL09115, FL091120, and FLBC0950 The is designed to prepare genomic DNA libraries compatible with the Roche 454 Genome Sequencer FLX System, with standard FLX chemistry. Nextera technology* employs
More informationRapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples
Application Note 17 RNA Sample Preparation Rapid Method for the Purification of Total RNA from Formalin- Fixed Paraffin-Embedded (FFPE) Tissue Samples M. Melmogy 1, V. Misic 1, B. Lam, PhD 1, C. Dobbin,
More informationProtocol for Genome Editing via the RNA-guided Cas9 Nuclease in. Zebrafish Embryos 1
Protocol for Genome Editing via the RNA-guided Cas9 Nuclease in Zebrafish Embryos 1 1. In vitro synthesis of capped Cas9 mrna The full length of humanized Cas9 cdnas with double NLS were cloned into pxt7
More informationSample Flexibility for Gene Expression Analysis with the ncounter Analysis System
Technical Note Sample Flexibility for Gene Expression Analysis with the ncounter Analysis System Sensitive Gene Expression Analysis From Crude Preparations and Fragmented RNA Cell Lysates Tissue Homogenates
More informationINTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
More informationProtocol for DNA and RNA Isolation from the Same FFPE Sample
C19682AA December 2017 FormaPure Total: Protocol for DNA and RNA Isolation from the Same FFPE Sample Refer to www.beckmancoulter.com/ifu for updated protocols. For questions regarding this protocol, call
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1
CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing
More informationImplementation of Ion AmpliSeq in molecular diagnostics
Implementation of Ion AmpliSeq in molecular diagnostics The Rotterdam Experience Ronald van Marion Deelnemersbijeenkomst SKML sectie Pathologie Amersfoort, 26 mei 2016 Molecular Diagnostics in Rotterdam
More informationNGS: Digital RNAseq & Library Prep Seminar. Next-Generation Sequencing Lunch & Learn
NGS: Digital RNAseq & Library Prep Seminar Next-Generation Sequencing Lunch & Learn Samuel Rulli, Ph. D Global Product Manager QIAseq Targeted RNA Panels 1 Targeted sequencing with UMIs QIAseq mirnaseq
More informationNext Generation Oncology Sequencing in your Laboratory. Built by pioneers in cancer genomics and liquid biopsy approaches PROGENEUS
PROGENEUS Next Generation Oncology Sequencing in your Laboratory Built by pioneers in cancer genomics and liquid biopsy approaches For Research Use Only. Not for iagnostic Purposes. personalgenome.com/progeneus
More informationTech Note. Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis. ncounter Gene Expression. Molecules That Count
ncounter Gene Expression Tech Note Using the ncounter Analysis System with FFPE Samples for Gene Expression Analysis Introduction For the past several decades, pathologists have kept samples obtained from
More informationRapid amplification of cdna ends (RACE)
Rapid amplification of cdna ends (RACE) Rapid amplification of cdna ends (RACE) is a technique used in molecular biology to obtain the full length sequence of an RNA transcript found within a cell. RACE
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationCAPTURE-BASED APPROACH FOR COMPREHENSIVE DETECTION OF IMPORTANT ALTERATIONS
CAPTURE-BASE APPROACH FOR COMPREHENSIVE ETECTION OF IMPORTANT ALTERATIONS SEQUENCE MUTATIONS MICROSATELLITE INSTABILITY AMPLIFICATIONS GENOMIC REARRANGEMENTS For Research Use Only. Not for iagnostic Purposes.
More informationQIAGEN GeneRead QIAact Panel Cleanup Kit Handbook
QIAGEN GeneRead QIAact Panel Cleanup Kit Handbook June 2017 For cleanup of DNA during construction of targeted, molecularly bar-coded libraries for digital sequencing with next-generation sequencing (NGS)
More informationtruxtrac FFPE DNA microtube Kit for chemagen Technology (24) For use with the Chemagen Prepito-D Automation Platform
PROTOCOL truxtrac FFPE DNA microtube Kit for chemagen Technology (24) For use with the Chemagen Prepito-D Automation Platform Adaptive Focused Acoustics (AFA) -based DNA extraction and purification from
More information29th January 2018 BRCA Tumour Testing Masterclass - Jerusalem
29th January 2018 BRCA Tumour Testing Masterclass - Jerusalem Review of methodologies for tumor testing; highlighting experience from University Hospital Cologne 29.01.2018 Carina Heydt Agenda How to conduct
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationUse of Minigenes in a Diagnostic Laboratory. Allan Richards. Cambridge
Use of Minigenes in a Diagnostic Laboratory Allan Richards Cambridge Minigene Analysis Minigenes are used to assess the effect of sequence variants on the processing of pre-mrna into the final message
More informationPrecipio, Inc. Instructions for Use. EGFR Exon 18 Mutation Enrichment using ICE COLD-PCR
Precipio, Inc. Instructions for Use EGFR Exon 18 Mutation Enrichment using ICE COLD-PCR Table of Contents Manufacturer 2 Intended Use 2 Reagent Preparation 2 Kit Components and Storage Conditions 2 Optional
More information