Supplemental Information. Commensal Fungi Recapitulate. the Protective Benefits of Intestinal Bacteria
|
|
- Barnard Dorsey
- 6 years ago
- Views:
Transcription
1 Cell Host & Microbe, Volume Supplemental Information Commensal Fungi Recapitulate the Protective enefits of Intestinal acteria Tony T. Jiang, Tzu-Yu Shao, W.X. Gladys Ang, Jeremy M. Kinder, Lucien H. Turner, Giang Pham, Jordan Whitt, Theresa Alenghat, and Sing Sing Way
2 A 1 Villus width (µm) 7 A/PAS Goblet cells (#) 1 1 C Granules (#) 1 1 D Crypt height (µm) 1 A/PAS 1 Goblet cells (#) E 9 Figure S1 (related to Figure 1). C. albicans enteric colonization does not cause intestinal tissue injury (A-C) Representative sections of small intestine stained with hematoxylin and eosin () or alcian blue/periodic acid-schiff (A/PAS), and composite data enumerating villus width (A), goblet cells per villus (), and granules per paneth cell (C), for specific-pathogen free mice administered C. albicans and maintained on antibiotics containing ampicillin, gentamicin, metronidazole, neomycin, vancomycin for 1 days (), compared with antibiotic treated controls without C. albicans inoculation (). (D,E) Representative sections of colon stained with or A/PAS, and composite data enumerating crypt height (D), and number of goblet cells per X field (E) for mice described in panels (A-C). Data are representative of at least two independent experiments. ars, mean ± s.e.m. Original magnification 1X for (A,D), X for (), or X for (C,E).
3 D D17 D D9 Analysis Epithelial ulceration D Total disease score C Edema DSS FITC-dextran (µg/ml) CA 9 Inflammatory cell infiltration Colon length (cm) A Figure S (related to Figure 1). C. albicans intestinal mono-colonization mitigates the severity of DSS induced colitis (A) Analysis after % DSS initiation among specific-pathogen free mice after supplementing the drinking water with an antibiotic cocktail () containing ampicillin, gentamicin, metronidazole, neomycin, vancomycin, or administered C. albicans (CA) three days after initiation (). (-D) Colon length (), serum FITC-dextran concentration four hours after oral gavage (C), representative hematoxylin and eosin () stained colonic sections and composite histological scoring (see Methods) (D) after DSS administration (for six days) for mice described in panel (A). P <.1, P <.1, by unpaired t-test with Welch s correction. Data are representative of at least three independent experiments. ars, mean ± s.e.m. Original magnification 1X for (D).
4 A Fungal CFUs/g (log 1 ) 1 GF GF L.o.D. Survival (%) 1 7 GF (n=1) GF (n=11) DSS 1 1 Days after DSS initiation Figure S (related to Figure 1). Overt susceptibility to DSS induced mortality among germ-free mice is improved following C. albicans intestinal mono-colonization (A) Recoverable fungal CFUs in the feces for germ-free mice 1 days after inoculation with C. albicans (GF), compared to germ-free controls without CA administration (GF). () Percent survival after DSS supplementation in the drinking water (for six days) for mice described in panel (A). P <., by Log-rank (Mantel-Cox) test. ars, mean ± s.e.m. L.o.D., limit of detection.
5 A Intrarectal reconstitution CA Flu A Analysis D D1 D17 Survival (%) 1 7 CA (n=1) Mannan (n=17) PS (n=17) 1 1 Days after Flu A infection K b OVA + CD T cells (#) PS CA Mannan IFN-γ + CD T cells (#) PS CA Mannan Figure S (related to Figure ). Mannan stimulation recapitulates the extra-intestinal benefits of persistent C. albicans mono-colonization (A) Percent survival after influenza A PR-OVA (Flu A) intranasal infection ( x 1 PFUs) among specificpathogen free mice maintained on drinking water supplemented with an antibiotic cocktail () containing ampicillin, gentamicin, metronidazole, neomycin, vancomycin, and administered C. albicans (CA) three days after initiating antibiotic treatment, or intrarectally administered 1 mg mannan or saline (PS) every other day starting one day prior to infection. () Total number of Flu A-specific K b OVA tetramer + CD T cells (left), and IFN-γ + CD T cells after in vitro OVA 7- peptide stimulation (right), from lungs nine days after Flu A infection for mice described in panel (A). P <., P <.1, by Log-rank (Mantel-Cox) test (A) or by Mann Whitney U test (). Data are representative of at least three independent experiments. ars, mean ± s.e.m.
6 Table S1 (related to STAR METHODS). Antibodies used and staining conditions for flow cytometry Protein Fluorophore Clone Vendor Dilution CD FITC GK1. eioscience 1: CDα APC -.7 eioscience 1: CD11b PE-Cy M1/7 eioscience 1: CD11c PE-Cy N1 eioscience 1: F/ PE-Cy M eioscience 1: PE-Cy RA- eioscience 1: IFN-γ efluor XMG1. eioscience 1:1
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16108 DOI: 10.1038/NMICROBIOL.2016.108 The binary toxin CDT enhances Clostridium difficile virulence by suppressing protective colonic eosinophilia Carrie A. Cowardin,
More informationSupplemental Information. Cooperating Commensals Restore. Colonization Resistance to Vancomycin-Resistant Enterococcus faecium
Cell Host & Microbe, Volume 21 Supplemental Information Cooperating Commensals Restore Colonization Resistance to Vancomycin-Resistant Enterococcus faecium Silvia Caballero, Sohn Kim, Rebecca A. Carter,
More informationSupplemental Information. Myeloid-Derived Suppressor Cells Are. Controlled by Regulatory T Cells via TGF-b. during Murine Colitis
Cell Reports, Volume 17 Supplemental Information Myeloid-Derived Suppressor Cells Are Controlled by Regulatory T Cells via TGF-b during Murine Colitis Cho-Rong Lee, Yewon Kwak, Taewoo Yang, Jung Hyun Han,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,
More informationSupplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC
Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was
More informationSupplementary Figure 1. Effect of FRC-specific ablation of Myd88 on PP and mln organization.
Supplementary Figure 1 Effect of FRC-specific ablation of Myd88 on PP and mln organization. (a) PP numbers in 8 10 week old Cre-negative littermate (Ctrl) and Myd88-cKO mice (n = 11 mice; each dot represents
More informationDC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN
CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched
More informationNature Biotechnology: doi: /nbt.4086
Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3
More informationSupplementary Data, Romain et al., ATVB/2012/300516R2
Supplementary Data, Romain et al., ATV/212/3516R2 Methods online Mice All experiments were conducted on male mice between 8 and 12 weeks of age. Mice with genetic overexpression of SOCS3 or cell-specific
More informationSupplemental Information Inventory
Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.
More informationMurine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells
Murine and Non-Human Primate Dendritic Cell Targeting Nanoparticles for In Vivo Generation of Regulatory T-Cells Sebastian O. Stead 1, Svjetlana Kireta 2, Steven James Peter McInnes 3, Francis D. Kette
More informationTable S1. Antibodies and recombinant proteins used in this study
Table S1. Antibodies and recombinant proteins used in this study Labeled Antibody Clone Cat. no. Streptavidin-PerCP BD Biosciences 554064 Biotin anti-mouse CD25 7D4 BD Biosciences 553070 PE anti-mouse
More informationTargeting CD96 in Cancer Immunotherapy Supplementary Material
Targeting CD96 in Cancer Immunotherapy Supplementary Material Supplementary Methods Biotinylation of antibody for immobilization onto Streptavidin Biosensors. EZ-Link Sulfo-NHS-LC-LC Biotin from Thermo
More informationSupplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail
Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),
More informationB Vehicle 1V270 (35 μg) 1V270 (100 μg) Days post tumor implantation. Vehicle 100μg 1V270 biweekly 100μg 1V270 daily
Supplemental Figure 1 A 1 1V7 (8 μg) 1 1V7 (16 μg) 8 6 4 B 1 1 8 6 4 1V7 (35 μg) 1V7 (1 μg) 5 1 15 5 1 15 C Biweekly 8 11 14 17 Days Implant SCC7 cells Daily 8 9 1 11 1 Implant SCC7 cells 1V7 i.t. treatment
More informationNature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs.
Supplementary Figure 1 Overexpression of Ym1 reduces eosinophil numbers in the lungs. (a-d) Absolute numbers per mg of tissue of CD8 + T cells (a), CD4 + T cells (b), CD19 + CD11b - B cells (c) and SigF
More informationSupplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation
Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María
More informationReal-time PCR. Total RNA was isolated from purified splenic or LP macrophages using
Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion
More informationNature Immunology: doi: /ni Supplementary Figure 1. Time course of OT-II T reg cell development in thymic slices.
Supplementary Figure 1 Time course of OT-II T reg cell development in thymic slices. Time course of T reg cell development following addition of OT-II TCR transgenic Rag2 -/- mice (OT-II) thymocytes to
More informationMeasurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer
SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min
More informationSupporting Information
Supporting Information of Laser Immunotherapy in Combination with Perdurable PD-1 Blocking for Treatment of Metastatic Tumor Lihua Luo, Chunqi Zhu, Hang Yin, Mengshi Jiang, Junlei Zhang, Bing Qin, Zhenyu
More informationSupplementary Figure 1
Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter
More informationDistribution of human ILCs during chronic lung disease.
Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total
More informationFor in vitro killing assays with lysed cells, neutrophils were sonicated using a 550 Sonic
Supplemental Information Cell Host & Microbe, Volume 8 Statins Enhance Formation of Phagocyte Extracellular Traps Ohn A. Chow, Maren von Köckritz-Blickwede, A. Taylor Bright, Mary E. Hensler, Annelies
More informationA Method for the Continuous Culture of Cryptosporidium Nigel Yarlett Pace University, New York, USA
A Method for the Continuous Culture of Cryptosporidium Nigel Yarlett Pace University, New York, USA Culture Methods for Cryptosporidium Comparative development of Cryptosporidium parvum (Apicomplexa) in
More informationYalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet, Mehdi Meguenani, Stephane Jemelin, Christian Vesin, Walter Reith and Beat A.
Supplementary information Thymic epithelial cell expansion through matricellular protein CYR61 boosts progenitor homing and T- cell output Yalin Emre, Magali Irla, Isabelle Dunand- Sauthier, Romain Ballet,
More informationTWEAK/Fn14 pathway promotes a T helper 2-type chronic colitis with fibrosis in mice
Supplementary information for TWEAK/Fn14 pathway promotes a T helper 2-type chronic colitis with fibrosis in mice 1. Supplementary materials and methods. Histological analysis and scoring. Formalin-fixed
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/1/494/eaak972/dc1 Supplementary Materials for Blockade of surface-bound TGF-β on regulatory T cells abrogates suppression of effector T cell function in the tumor
More informationSupplementary figures
Mucida et al. Supplementary material Supplementary figures Supplementary Figure 1. Oral administration of OVA suppresses Th2 differentiation, Germinal Center (GC) formation and immunoglobulin class switching
More informationSupplementary Information Supplementary Figure 1
Supplementary Information Supplementary Figure 1 skeletal muscle lung (5 µg) Marker (KDa) +/+ +/+ -/- -/- -/- 17 13 7 55 MG53 4 35 25 Marker (KDa) 17 13 35 7 55 25 4 Supplementary Figure 1. The full scale
More informationTgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers
Supplemental data Supplemental Table 1: Sequences of qpcr primers Gene Forward primer Reverse primer B2m GTGACCCTGGTCTTTCTGGT GTATGTTCGGCTTCCCATTC Ppl TTGAGACAGCAACCAGAAGC TTCAGGGTCTGGATTTCCTC Evpl TGCTTCACCACCATGTTCAA
More informationSupplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence
1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for
More informationReceptor Revision Diminishes the Autoreactive B Cell Response after Antigen. PNA Tet. Day 8. Day 16
Receptor Revision Diminishes the Autoreactive Cell Response after Antigen Activation Ying-Hua Wang and etty Diamond Supplemental data: PNA Tet 5 8 11 16 Supplemental Figure 1: Kinetic analysis of tetramer-binding
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue
More informationMultivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy
In the format provided by the authors and unedited. DOI: 10.1038/NNANO.2017.69 Multivalent bi-specific nanobioconjugate engager for targeted cancer immunotherapy Hengfeng Yuan, Wen Jiang,* Christina A.
More informationA group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response
A group A Streptococcus ADP-ribosyltransferase toxin stimulates a protective IL-1β-dependent macrophage immune response Ann E. Lin, Federico C. Beasley, Nadia Keller, Andrew Hollands, Rodolfo Urbano, Emily
More informationisolated from ctr and pictreated mice. Activation of effector CD4 +
Supplementary Figure 1 Bystander inflammation conditioned T reg cells have normal functional suppressive activity and ex vivo phenotype. WT Balb/c mice were treated with polyi:c (pic) or PBS (ctr) via
More informationFigure S1. Nasal-only inoculation. A: BALB/c mice were intranasally treated with 1% Evan
Figure S1. Nasal-only inoculation. A: BALB/c mice were intranasally treated with 1% Evan Blue in PBS at the indicated volume per nostril (X ; for the µl group, only one nostril) under light anesthesia
More informationSI Appendix. Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for. adoptive immunotherapy of cancers
SI Appendix Tumor-specific CD8 + Tc9 cells are superior effector than Tc1 cells for adoptive immunotherapy of cancers Yong Lu, Bangxing Hong, Haiyan Li, Yuhuan Zheng, Mingjun Zhang, Siqing Wang, Jianfei
More informationSupporting Information
Supporting Information Cieslewicz et al. 10.1073/pnas.1312197110 SI Results Human and mouse lesions of atherosclerosis contain both M1 and M2 macrophage phenotypes (1, 2). Previous work has suggested the
More informationAt E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in
Supplementary Materials and Methods Barrier function assays At E17.5, the embryos were rinsed in phosphate-buffered saline (PBS) and immersed in acidic X-gal mix (100 mm phosphate buffer at ph4.3, 3 mm
More informationBL-7040: Oligonucleotide for Inflammatory Bowel Disease
BL-7040: Oligonucleotide for Inflammatory Bowel Disease December 2012 Forward Looking Statements This presentation contains "forward-looking statements." These statements include words like "may," "expects,"
More informationA novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated
A novel therapeutic strategy to rescue the immune effector function of proteolyticallyinactivated cancer therapeutic antibodies Supplemental Data File in this Data Supplement: Supplementary Figure 1-4
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase
More informationSTING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors
Immunity, Volume 41 Supplemental Information STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors Liufu Deng, Hua Liang,
More informationSupporting Information
Supporting Information Tomura et al. 1.173/pnas.8227815 WT CFSE Con A stimulation Before After 2 3 1 CFSE Kaede- Tg No photoconversion Photoconversion Kaede Red Fig. S1. Dilution of photoconverted Kaede
More informationSupplementary Information. Real-time imaging of oxidative and nitrosative stress in the liver of live animals for drug-toxicity testing
Supplementary Information Real-time imaging of oxidative and nitrosative stress in the liver of live animals for drug-toxicity testing Adam J. Shuhendler 1*, Kanyi Pu 1*, Lina Cui 1, Jack P. Uetrecht &
More informationSupplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein
Supplementary Figure 1. CHOP-HA is broadly expressed on the vertical and horizontal axis of the intestine. (A) Ki-67 and E-Cadherin protein expression was analyzed by performing immunofluorescence staining
More informationMice as Translational Models: Planning a Fecal Microbiota Transplantation Study
Mice as Translational Models: Planning a Fecal Microbiota Transplantation Study RANDI LUNDBERG, DVM APPLICATIONS SCIENTIST 3 rd Annual Translational Microbiome Conference Boston, April 11-13, 2017 FMT
More informationAspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host cell invasion
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16211 DOI: 10.1038/NMICROBIOL.2016.211 Aspergillus fumigatus CalA binds to integrin α 5 β 1 and mediates host
More informationNature Medicine doi: /nm.2548
Supplementary Table 1: Genotypes of offspring and embryos from matings of Pmm2 WT/F118L mice with Pmm2 WT/R137H mice total events Pmm2 WT/WT Pmm2 WT/R137H Pmm2 WT/F118L Pmm2 R137H/F118L offspring 117 (100%)
More informationM004 - Intracellular Cytokine Staining for Mouse Samples
Author Stephanie Swift Date 21st March 2017 Version 8 SOP # M004 Objective: This protocol addresses the processing, peptide-stimulation and antibody staining of fresh mouse samples for intracellular cytokine
More informationSUPPLEMENTARY INFORMATION
doi: 1.13/nature53 MPO (relative unit) 15 15 1 75 5 5 P=. control ns P=. 7 DSS CXCL1/KC (pg/1mg of colon) 7 5 3 1 P=. P=.19 control P=.7 P=.11 DSS TNFα (pg/1mg of colon) 3 5 15 1 5 P=.15 P=. control P=.33
More informationLipopolysaccharide inhibits Th2 lung inflammation induced by house dust mite allergens in
Online data supplement Lipopolysaccharide inhibits Th2 lung inflammation induced by house dust mite allergens in mice J. Daan de Boer, Joris J.T.H. Roelofs, Alex F. de Vos, Regina de Beer, Marcel Schouten,
More informationSupplementary Figure. S1
Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone
More informationSupplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating
Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low
More informationSupplementary Figure 1: Sequence alignment of partial stem region of flaviviruses
Supplementary Figure 1: Sequence alignment of partial stem region of flaviviruses E prtoeins. Polyprotein sequences of viruses were downloaded from GenBank and aligned by CLC Sequence Viewer software.
More informationSupplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1
Supplementary Information (Ha, et. al) Supplementary Figures Supplementary Fig. S1 a His-ORMDL3 ~ 17 His-ORMDL3 GST-ORMDL3 - + - + IPTG GST-ORMDL3 ~ b Integrated Density (ORMDL3/ -actin) 0.4 0.3 0.2 0.1
More informationTF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting
Supplemental Material Supplemental Methods TF-1a lymphoblastic leukemia cell line: marking with GFP, phenotyping and sorting In order to determine if the multi-parameter FACS approach would be successful
More informationSupplementary Figure and Table Legends
1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Map of pct-vhvl-k1 native V H :V L display vector.
Supplementary Figure 1 Map of pct-vhvl-k1 native V H :V L display vector. Natively-paired V H :V L sequences are cloned en masse into this vector for human antibody repertoire mining, and their corresponding
More informationNew Hope For Serious Infections
New Hope For Serious Infections Forward-Looking Statements Statements contained in this press release regarding matters that are not historical facts are "forward-looking statements" within the meaning
More informationThomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den
Cell, Volume 129 Supplemental Data Extending the Host Range of Listeria monocytogenes by Rational Protein Design Thomas Wollert, Bastian Pasche, Maike Rochon, Stefanie Deppenmeier, Joop van den Heuvel,
More informationSUPPLEMENTARY INFORMATION
VOLUME: 1 ARTICLE NUMBER: 0011 In the format provided by the authors and unedited. In situ Activation of Platelets with Checkpoint Inhibitors for Post-Surgical Cancer Immunotherapy Chao Wang 1, 2, Wujin
More informationAutocrine Complement Inhibits IL10-Dependent T-Cell Mediated. Antitumor Immunity to Promote Tumor Progression
Supplemental Information Autocrine Complement Inhibits IL10-Dependent T-Cell Mediated Antitumor Immunity to Promote Tumor Progression Yu Wang, Sheng-Nan Sun, Qing Liu, Yang-Yang Yu, Jian Guo, Kun Wang,
More informationTitle: Stromal Cell Subsets Directing Neonatal Spleen Regeneration
Title: Stromal Cell Subsets Directing Neonatal Spleen Regeneration Authors: Jonathan K.H. Tan and Takeshi Watanabe SUPPLEMENTAL INFORMATION Supplemental Tables 1-4 Supplemental Figure 1 Table S1. Marker
More informationIntestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by. Regulating Occludin
Intestinal Epithelial Cell-Specific Deletion of PLD2 Alleviates DSS-Induced Colitis by Regulating Occludin Chaithanya Chelakkot 1,ǂ, Jaewang Ghim 2,3,ǂ, Nirmal Rajasekaran 4, Jong-Sun Choi 5, Jung-Hwan
More informationThe non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells
Supplementary Information The non-muscle-myosin-ii heavy chain Myh9 mediates colitis-induced epithelium injury by restricting Lgr5+ stem cells Bing Zhao 1,3, Zhen Qi 1,3, Yehua Li 1,3, Chongkai Wang 2,
More information7-amino actinomycin D (7ADD) was added to all samples 10 minutes prior to analysis on the flow cytometer in order to gate 7AAD viable cells.
Antibody staining for Ho uptake analyses For HSC staining, 10 7 BM cells from Ho perfused mice were stained with biotinylated lineage antibodies (CD3, CD5, B220, CD11b, Gr-1, CD41, Ter119), anti Sca-1-PECY7,
More informationSupporting Information
Supporting Information Zindl et al. 1.173/pnas.1331811 SI Materials and Methods Mice. Myd88 / mice were kindly provided by S. Michalek (University of Alabama at irmingham, irmingham, AL). Isolation of
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from
More informationSupplementary Table, Figures and Videos
Supplementary Table, Figures and Videos Table S1. Oligonucleotides used for different approaches. (A) RT-qPCR study. (B) qpcr study after ChIP assay. (C) Probes used for EMSA. Figure S1. Notch activation
More informationSupporting Information for. Bongseo Choi, 1, Hyojin Moon, 1, Sung Joon Hong, 1 Changsik Shin, 1 Yoonkyung Do, 1 Seongho Ryu, 2,* Sebyung Kang 1,*
Supporting Information for Effective Delivery of Antigen-Encapsulin Nanoparticle Fusions to Dendritic Cells Leads to Antigen-Specific Cytotoxic T Cell Activation and Tumor Rejection Bongseo Choi, 1, Hyojin
More informationSupplementary Figure 1.
9 8 5 6F12 IgG2a Isotype Control 5 1 15 Supplementary Figure 1. Passive treatment with isotype control mab does not affect viral challenge. Wild type mice were treated with 4 mg/kg of mouse IgG2a 6F12
More informationErk activation drives intestinal tumorigenesis in Apc min/+ mice
correction notice Nat. Med. 16, 665 670 (2010) Erk activation drives intestinal tumorigenesis in Apc min/+ mice Sung Hee Lee, Li-Li Hu, Jose Gonzalez-Navajas, Geom Seog Seo, Carol Shen, Jonathan Brick,
More informationAN EXAMINATION OF THE EFFECTS OF SIMVASTATIN ON INNATE IMMUNE RESPONSES TO S. AUREUS A RESEARCH PAPER BY TRACI STANKIEWICZ
AN EXAMINATION OF THE EFFECTS OF SIMVASTATIN ON INNATE IMMUNE RESPONSES TO S. AUREUS A RESEARCH PAPER BY TRACI STANKIEWICZ SUBMITTED TO THE GRADUATE SCHOOL IN PARTIAL FULFILLMENT OF THE REQUIRMENTS SET
More informationThe following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700
Flow cytometry analysis and cell sorting The following fluorochrome-conjugated antibodies were used: FITC and Alexa Fluor 700 anti-cd5. (), APC-Cy7 anti-epcam (G.; Biolegend, San Diego, CA), PE-Cy7 anti-cd31
More informationSupplementary information
Supplementary information Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer Je-In Youn, Vinit Kumar, Michelle Collazo, Yulia Nefedova, Thomas Condamine,
More informationneutrophils (CD11b+, the total Statistical multiple
Supplementary Figure 1. (A) Wild type and Vim / mice were treated with (24mg/kg LPS); lungs were harvested at 48h and enzymaticallyy digested. CD45+ cells were excluded from the total cell population and
More informationThe RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The
SUPPLEMENTARY MATERIALS AND METHODS Real time quantitative PCR The RT-qPCR analysis of selected type-i IFNs related genes, IRF7 and Oas3. The RT-qPCR was performed on the Applied Biosystems StepOne TM
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More information- Figure S1 (related to Fig. 1): Phenotype of CD1d-/- mice and IL-17 secretion by
Cell Host & Microbe, Volume 10 Supplemental Information Innate Recognition of Cell Wall β-glucans Drives Invariant Natural Killer T Cell Responses against Fungi Nadia R. Cohen, Raju V.V. Tatituri, Amariliz
More informationSupplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate
Supplementary Figure Legends Supplementary Fig. 1 related to Fig. 1 Clinical relevance of lncrna candidate BC041951 in gastric cancer. (A) The flow chart for selected candidate lncrnas in 660 up-regulated
More informationEight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western
Supplemental information M. Itoh et al. 0 Supplemental Methods Inducible NASH model using wildtype mice Eight-week-old wildtype mice were kept under standard diet (SD) for weeks, or fed Western diet (WD)
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 PPAR-γ is dispensable for the development of tissue macrophages in the heart, kidneys, lamina propria and white adipose tissue. Plots show the expression of F4/80 and CD11b (a) or
More informationFlowcytometry-based purity analysis of peritoneal macrophage culture.
Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate
More informationComparative assessment of vaccine vectors encoding ten. malaria antigens identifies two protective liver-stage
Supplementary Information Comparative assessment of vaccine vectors encoding ten malaria antigens identifies two protective liver-stage candidates Rhea J. Longley 1,,,*, Ahmed M. Salman 1,2,, Matthew G.
More informationIsolation and 3-dimensional Culture of Primary Murine Intestinal Epithelial Cells Agnieszka Pastuła * and Michael Quante
Isolation and 3-dimensional Culture of Primary Murine Intestinal Epithelial Cells Agnieszka Pastuła * and Michael Quante II. Medizinische Klinik, Klinikum rechts der Isar, Technische Universität München,
More informationMicrobiota: Agents for Health and Disease Dr. B. Brett Finlay
Microbiota: Agents for Health and Disease, OC, OBC Michael Smith Laboratory University of British Columbia Vancouver, Canada 1 Talk outline A general overview: Several aspects of microbiota Various contribution
More informationBD IMag. Streptavidin Particles Plus - DM. Technical Data Sheet. Product Information
Technical Data Sheet Streptavidin Particles Plus - DM Product Information Material Number: Size: Storage Buffer: 557812 5 ml Aqueous buffered solution containing BSA and 0.09% sodium azide. Description
More informationefluor Organic Dyes 450/50 BP Fluorescence Intensity Wavelength (nm)
efluor Organic Dyes efluor Organic Dyes Catalog No. Description Clone Application Anti-Mouse efluor 450 Products 48-0042 Anti-mouse CD4 RM4-5 Flow Cytometry 48-0081 Anti-mouse CD8 53-6.7 Flow Cytometry
More informationPE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence
PE11, a PE/PPE family protein of Mycobacterium tuberculosis is involved in cell wall remodeling and virulence Parul Singh 1,2, Rameshwaram Nagender Rao 1, Jala Ram Chandra Reddy 3, R.B.N. Prasad 3, Sandeep
More informationSupplementary Information Supplementary Figure. S1: Analysis of PilA-deficient mutants in various GBS serotypes
Supplementary Information Supplementary Figure. S1: Analysis of PilA-deficient mutants in various GBS serotypes (a) Western blot analysis of total cell lysates of different GBS serotype strains and their
More informationMayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama
Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro
More informationModeling Cardiomyocyte Differentiation:
icell Cardiac Progenitor Cells Prototype Application Protocol Wnt- and Activin/TGFβ-inhibitor Induction with Flow Cytometry Analysis Introduction The ability of cardiac progenitor cells to proliferate
More informationProduct Datasheet. F4/80 Antibody (BM8) NBP Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 12
Product Datasheet F4/80 Antibody (BM8) NBP1-60140 Unit Size: 0.1 mg Store at 4C. Do not freeze. Publications: 12 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nbp1-60140
More informationLSHB-CT
Implementation of the results from the EU-FP6 project Sens-it-iv ---------- Integrated Data Analysis of In Vitro Testing Approaches Advancing BioTech Product Development and Safety ELRo_Sens-it-iv_PATC
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland DISTRIBUTION STATEMENT: Approved for Public Release;
AWARD NUMBER: W81XWH-15-1-0368 TITLE: Understanding Microbial Sensing in Inflammatory Bowel Disease Using Click Chemistry PRINCIPAL INVESTIGATOR: Dennis L. Kasper CONTRACTING ORGANIZATION: Harvard Medical
More informationTransfer of Protective Immunity in Murine Histoplasmosis by a CD4+ T-Cell Clone
INFECTION AND IMMUNITY, Feb. 1993, p. 714-718 19-9567/93/2714-5$2./ Copyright 1993, American Society for Microbiology Vol. 61, No. 2 Transfer of Protective Immunity in Murine Histoplasmosis by a CD4+ T-Cell
More information